ID: 956050532

View in Genome Browser
Species Human (GRCh38)
Location 3:65243454-65243476
Sequence TCTAGGGCCTCTTGCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956050532_956050534 -9 Left 956050532 3:65243454-65243476 CCACTGTGGCAAGAGGCCCTAGA No data
Right 956050534 3:65243468-65243490 GGCCCTAGATAGGCCAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956050532 Original CRISPR TCTAGGGCCTCTTGCCACAG TGG (reversed) Intergenic
No off target data available for this crispr