ID: 956051039

View in Genome Browser
Species Human (GRCh38)
Location 3:65248793-65248815
Sequence ACCCAAGGCACCCAGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956051039_956051044 2 Left 956051039 3:65248793-65248815 CCCCATCTCTGGGTGCCTTGGGT No data
Right 956051044 3:65248818-65248840 GCATCACTCCTCCCCAGTCTAGG No data
956051039_956051050 19 Left 956051039 3:65248793-65248815 CCCCATCTCTGGGTGCCTTGGGT No data
Right 956051050 3:65248835-65248857 TCTAGGGAAAAAACCTTAGATGG No data
956051039_956051045 3 Left 956051039 3:65248793-65248815 CCCCATCTCTGGGTGCCTTGGGT No data
Right 956051045 3:65248819-65248841 CATCACTCCTCCCCAGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956051039 Original CRISPR ACCCAAGGCACCCAGAGATG GGG (reversed) Intergenic
No off target data available for this crispr