ID: 956057491

View in Genome Browser
Species Human (GRCh38)
Location 3:65315634-65315656
Sequence TACTACTGCATTGGGGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956057483_956057491 9 Left 956057483 3:65315602-65315624 CCTAATCACCTCCCAAAGACACC No data
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057481_956057491 18 Left 956057481 3:65315593-65315615 CCCTCATGACCTAATCACCTCCC 0: 299
1: 1087
2: 2797
3: 6774
4: 9972
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057482_956057491 17 Left 956057482 3:65315594-65315616 CCTCATGACCTAATCACCTCCCA 0: 289
1: 1440
2: 5600
3: 9393
4: 13390
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057486_956057491 -3 Left 956057486 3:65315614-65315636 CCAAAGACACCATCTCTCAATAC No data
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057484_956057491 1 Left 956057484 3:65315610-65315632 CCTCCCAAAGACACCATCTCTCA No data
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057480_956057491 21 Left 956057480 3:65315590-65315612 CCACCCTCATGACCTAATCACCT 0: 169
1: 594
2: 1383
3: 3332
4: 5404
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data
956057485_956057491 -2 Left 956057485 3:65315613-65315635 CCCAAAGACACCATCTCTCAATA No data
Right 956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956057491 Original CRISPR TACTACTGCATTGGGGATTA AGG Intergenic
No off target data available for this crispr