ID: 956064355

View in Genome Browser
Species Human (GRCh38)
Location 3:65381251-65381273
Sequence ATCTGAAGGCAGTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956064348_956064355 14 Left 956064348 3:65381214-65381236 CCATGAGTCACTAGAATGGCAAG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956064355 Original CRISPR ATCTGAAGGCAGTTGGAGGA AGG Intronic
900572869 1:3367983-3368005 ATCTGCAGAGAGCTGGAGGAGGG + Intronic
901343012 1:8512530-8512552 ATTGGAGGGCAGTTGGAGGCTGG - Intronic
901657178 1:10776119-10776141 ATTTCAAGGAAGTTGAAGGATGG - Intronic
902408521 1:16199573-16199595 ATCTGGGGGCAGTTGGACGTTGG - Intronic
903373442 1:22851392-22851414 GGCTGAATGCAGCTGGAGGAGGG + Intronic
905062764 1:35153736-35153758 AGCTGAAGGCAGTAGTAGTAGGG + Intergenic
905129037 1:35738490-35738512 GTCAGAAGCCAGGTGGAGGAAGG - Exonic
905363331 1:37435061-37435083 ATATGAAGGCTGGTGGAGGGAGG - Intergenic
905772613 1:40648144-40648166 ATCAGAGGGAGGTTGGAGGAAGG - Intronic
907237601 1:53062590-53062612 ATCTGAGGGCGGTTGGGGGCGGG + Intronic
907653340 1:56317841-56317863 ATGGGAAGCCAGTTGGATGAGGG - Intergenic
908054109 1:60264540-60264562 ATGTGAAGACAGTTGAATGAAGG - Intergenic
908363135 1:63389955-63389977 AGCTGATGGGAGCTGGAGGAGGG + Intronic
909673544 1:78214346-78214368 GTCTGGAGGCTGTTGGGGGAGGG + Intergenic
909870250 1:80729801-80729823 ATCTGATGGCATTAGGAGGTGGG - Intergenic
910605613 1:89080453-89080475 ATCACAAGGCAGTTGGAGGCAGG - Intergenic
910649987 1:89556275-89556297 ATTTGAGGGCAGTGGGAGGATGG - Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912411678 1:109484383-109484405 AGCTGGAGGCAGGTGCAGGAGGG - Intronic
913501613 1:119477214-119477236 CTCTGAAGGCAACTGAAGGAAGG - Intergenic
915407583 1:155673121-155673143 CTCAGGAGGCAGTGGGAGGATGG - Intronic
916445071 1:164864520-164864542 ATCTGAAGACAGTTGGGGTTGGG - Intronic
916806230 1:168264265-168264287 GTCTGAAGGGAGTTCGTGGATGG + Intergenic
918201934 1:182275831-182275853 ATATGAAGGCAGTGAGAAGATGG + Intergenic
918248161 1:182678988-182679010 ATCTGAGGGCAGCTGGAAGGAGG - Intronic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
920950548 1:210568223-210568245 ATGTGAAGGCTCTTGGAGGGTGG + Intronic
921021745 1:211242190-211242212 ATCTGAGGGTAGTTGGTGGTTGG - Intergenic
921655805 1:217735453-217735475 ATGTGATGGCATTTGGAGGTGGG - Intronic
921936078 1:220798494-220798516 ATCTGAGGGCAGATGGAAGGTGG - Intronic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
922869589 1:228891338-228891360 ATCTCAGGGCAGCTGGAGGGTGG + Intergenic
923405156 1:233652405-233652427 ATCTGAAAGCAGATGCATGATGG - Intronic
924346590 1:243078030-243078052 ATCACAAGGCAGATGGAGGCAGG - Intergenic
1065171533 10:23035298-23035320 ATGTGATGGCATTTGGAGGTGGG - Intronic
1066446486 10:35488511-35488533 AACTGAGGGCAGCTGGAGAAAGG - Intronic
1067220246 10:44338782-44338804 ATGTGGAGGCATTTGGAGGATGG - Intergenic
1068090930 10:52431401-52431423 ATCTAAAGGCAAGTGGAGGTTGG - Intergenic
1070650300 10:78230544-78230566 ATGTGGAGGTAGTGGGAGGAGGG - Intergenic
1070766828 10:79061620-79061642 ATCAGATGGCACTTGGGGGAGGG - Intergenic
1071300337 10:84251785-84251807 ATGTGATGGCATTTGGAGGTGGG - Intronic
1072827560 10:98623110-98623132 ATTTAAAGGCAGTTAGAGAAAGG + Intronic
1073140745 10:101245877-101245899 ATATTTAGGAAGTTGGAGGAAGG + Intergenic
1073333071 10:102683799-102683821 ACCTGATGGGAGTTGGGGGAGGG + Intronic
1074030108 10:109678472-109678494 AACTGGAGGTAGTTAGAGGAAGG + Intergenic
1074418398 10:113287078-113287100 ATCTGAAGGGGGTTGGGGGAGGG + Intergenic
1077898599 11:6473149-6473171 ATCTGAAGCCAATTGCAGAAGGG + Intronic
1079228457 11:18628663-18628685 ATTTGAGTGCAGTTTGAGGATGG - Intronic
1079358751 11:19752895-19752917 ATCTGATGGTATTTGGAGGTGGG + Intronic
1080459452 11:32440226-32440248 AACTGAGGGCAGTTGGGAGAGGG - Intergenic
1080698564 11:34624346-34624368 ATCTGAAGACAGAGGCAGGAGGG + Intronic
1080845268 11:36021317-36021339 CTCTGAAGGCTGTTAAAGGAGGG + Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082098346 11:48150238-48150260 ATCTGAGGGGAGTTGGTGGATGG + Intronic
1082251800 11:49990703-49990725 ATGTGAAGGCATTTGGAGGTTGG + Intergenic
1082884369 11:58067575-58067597 ACCTGAGGGCAGTAAGAGGAGGG + Intronic
1083281939 11:61632332-61632354 ATCTGGCGGGAGTTGGGGGAGGG + Intergenic
1083638340 11:64132299-64132321 ATCTGAAAACAGGTGGAGAAAGG - Intronic
1085437752 11:76524090-76524112 TTCTGAAGGCAGTTGGTAGGAGG + Intronic
1085853428 11:80148498-80148520 TTCTCAAGGAAATTGGAGGATGG + Intergenic
1087046514 11:93848047-93848069 ATGTGATGGTATTTGGAGGAGGG - Intronic
1087826913 11:102775651-102775673 ATATGAAGGGAGCTGGAGGACGG + Intronic
1088364319 11:109022947-109022969 AGCTGAAGGAATTTGGAGAAAGG + Intergenic
1088612507 11:111591317-111591339 ATCTGCAGGGAGTGTGAGGATGG - Intergenic
1088989209 11:114937215-114937237 CTCAGAATGCAGTTGGTGGAGGG - Intergenic
1090555862 11:127874718-127874740 ATCTGATGGCAGTTGGTAGAAGG - Intergenic
1091215340 11:133898025-133898047 ATCAGGAGCCAGTGGGAGGAAGG + Intergenic
1091539900 12:1450339-1450361 ATCAGAAGGCAGATGGAATATGG - Intronic
1091763164 12:3101063-3101085 GTCTGAAGTCATCTGGAGGAGGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092884041 12:12910281-12910303 GTCTGAAGGGAGGCGGAGGAGGG + Intronic
1093010347 12:14100933-14100955 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1093058419 12:14578270-14578292 GTATGAAGGCACTTGGTGGAAGG + Intergenic
1093378725 12:18463803-18463825 ATATAAAGGGATTTGGAGGAGGG - Intronic
1094317003 12:29145994-29146016 TTCTGAAGGCAGATGCAGCACGG - Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095236772 12:39805707-39805729 AAGTGAAGGGAGTTGGAGGAGGG + Intronic
1095295822 12:40526396-40526418 ATGTGAACGCATTTGAAGGAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096948757 12:55441211-55441233 ATCAGAAGGCAAATGGAGGCAGG + Intergenic
1097318738 12:58202089-58202111 ATCTGATGTCAGTTTGAGAATGG + Intergenic
1098134576 12:67388815-67388837 ATCTGCCCCCAGTTGGAGGAGGG + Intergenic
1098960582 12:76735950-76735972 ATCACAAGGCAAATGGAGGAGGG - Intergenic
1099028733 12:77497961-77497983 ATCAGAAGGCATTTAGAGGAAGG - Intergenic
1100208572 12:92377591-92377613 TGCTCAAGGCAGTTGGAGTATGG + Intergenic
1101447539 12:104748138-104748160 AGATGAAGGGAGTTGGAGGCTGG + Intronic
1101488464 12:105190297-105190319 ATATGAAGGAAGTTTGAAGAAGG - Intronic
1102157343 12:110742216-110742238 CTCGGAAGGCAGTTTGATGAGGG - Intronic
1102536091 12:113582704-113582726 ATCTCTAGGCAGTAAGAGGAAGG + Intergenic
1103218066 12:119218862-119218884 ATCACAAGGCAATTGGAGGCAGG + Intronic
1104791760 12:131487201-131487223 ATCTGAATACAGGGGGAGGAGGG - Intergenic
1106724699 13:32471845-32471867 GTCTGAAGGGAGTGGGTGGATGG - Intronic
1110490867 13:76104977-76104999 ATTTGAAGCCAGTTTCAGGAAGG + Intergenic
1112437333 13:99399712-99399734 CTCTGCAGGCAGTGGGAGCAAGG - Intergenic
1113235129 13:108263968-108263990 GCCTGACGGCAGTTGCAGGATGG + Intronic
1113890553 13:113733064-113733086 AACTGGAGGCAGCTGGAGGCTGG + Exonic
1114570395 14:23663212-23663234 ATGTGATGGTAGTTGGAGGTGGG + Intergenic
1115446821 14:33500093-33500115 AACGGAAGGGAGTTTGAGGAAGG + Intronic
1117397461 14:55325051-55325073 ATGTGAAGGTATTTGGAGGTGGG - Intronic
1117770897 14:59133786-59133808 ATTTGAAGGAGGTTGGGGGAAGG + Intergenic
1118398136 14:65354992-65355014 AACTAAAGGCAAATGGAGGAGGG + Intergenic
1118459401 14:65974944-65974966 AGCTGAAGGCAGGTAGTGGAGGG + Intronic
1119154862 14:72400780-72400802 ATAAGAAGGTAGGTGGAGGATGG - Intronic
1119600378 14:75971972-75971994 ATGTCAAGGCAGTGGGAGGAGGG - Intronic
1120407328 14:84105407-84105429 ACCTGAAGGTGGTTGGAGGGGGG - Intergenic
1120807312 14:88766634-88766656 ATCAGAAGGCAAATGGAGGCAGG - Intronic
1120823362 14:88933224-88933246 GTGTGAAGTCAGTGGGAGGAGGG + Intergenic
1121241135 14:92430808-92430830 ATCTGAAGGTGGAGGGAGGAGGG - Intronic
1121650064 14:95551661-95551683 ATCAGAGGGCAGCTGGAGGGTGG - Intergenic
1124441755 15:29690584-29690606 TTCTGAAGGAAGTTAGAGAAAGG + Intergenic
1124859704 15:33427001-33427023 ATGTGATGGCATTTGGAGGAGGG - Intronic
1124896424 15:33781460-33781482 ATCTCATGGCAGTTTGAGAAAGG - Intronic
1126874746 15:53029237-53029259 ATCTCAAGGAAGTTGTAAGAAGG - Intergenic
1127812199 15:62573902-62573924 ATCTGATGAAAGTTGGAGGCAGG + Intronic
1128366644 15:67008289-67008311 AGCTGCAGGCAGGGGGAGGATGG - Intergenic
1128825354 15:70710798-70710820 ATGTGGAGGCACCTGGAGGATGG - Intronic
1129508370 15:76101970-76101992 ATCTGTATGCAGTAGGAGGAAGG - Intronic
1129630316 15:77251857-77251879 ATCTGCATGCAGTTAAAGGAAGG + Intronic
1129664601 15:77572477-77572499 GTATGAGGGCAGTTGGAGGGTGG + Intergenic
1129708165 15:77806460-77806482 ACCTGAAGGCAGGTGGAGCTGGG - Intronic
1134108603 16:11500825-11500847 ATCTGTGGGCTGTGGGAGGAAGG + Exonic
1135654774 16:24238360-24238382 ATGTGATGGTAGTTGGAGGTGGG - Intergenic
1137616219 16:49848819-49848841 ATCTGGAGGCAGTTGGCAGCAGG + Intronic
1138377182 16:56572626-56572648 ATGTGATGGTATTTGGAGGAGGG + Intergenic
1139000784 16:62507159-62507181 ATATGATGGCATTTGGAGGTGGG + Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141605381 16:85150178-85150200 AGCTGCAGGCTGTGGGAGGAAGG - Intergenic
1141673155 16:85503360-85503382 AGCTGAGGGCAGGTGGAGGCTGG - Intergenic
1142478967 17:206382-206404 TTCTTACGGCAGCTGGAGGAAGG + Intergenic
1143990502 17:10956211-10956233 TTCTGAAGGAGTTTGGAGGAGGG + Intergenic
1144338485 17:14293870-14293892 ATCTGAAGTTAGTAGGAAGAAGG + Intergenic
1144755561 17:17678699-17678721 ATATGCAGGCAGATGGAAGAGGG - Intergenic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1147937785 17:44023529-44023551 AGGTCAAGGCAGCTGGAGGAGGG - Intronic
1148071396 17:44910873-44910895 ATCTGAAGGAAGATGGAAAAGGG + Intronic
1148686068 17:49501958-49501980 AATAGAAGGCAGTGGGAGGAGGG + Intronic
1148846188 17:50531567-50531589 ATCTGAGGGCAGGTGGAACATGG - Intergenic
1148890067 17:50800791-50800813 TTCAGAAGGCAGGCGGAGGATGG + Intergenic
1149271380 17:54981941-54981963 ATCTCAAGGTAGTTGGAGTGAGG - Intronic
1150952312 17:69817234-69817256 ATATAAAGTCAGTTGGAGAATGG + Intergenic
1151524932 17:74658570-74658592 AGCAGAAGGCAGCTGCAGGATGG + Intergenic
1153015908 18:582545-582567 ATCTGAGGGCAGGGGAAGGAGGG + Intergenic
1155378053 18:25183527-25183549 AACTGGAGGCAGTTGTAGCATGG - Intronic
1156520843 18:37721298-37721320 CACTGAAGGCAGGTGGAGGGAGG - Intergenic
1156680725 18:39585524-39585546 AACTGAAGGCAGATGAAGAAAGG - Intergenic
1157208783 18:45723020-45723042 CTCGGGAGGCACTTGGAGGAAGG + Intergenic
1158372190 18:56820624-56820646 AACTGAGGGCAGGGGGAGGAGGG - Intronic
1159615719 18:70577363-70577385 GTCTGAGGGCATTTGGAAGACGG + Intergenic
1160960984 19:1720735-1720757 ATTTCCAGGCAGTTGGAGGAAGG - Intergenic
1161455791 19:4369197-4369219 TGCTGAAGGCATTAGGAGGAAGG + Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1163371331 19:16902862-16902884 ATCTGGGGGGTGTTGGAGGATGG + Exonic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1163767886 19:19173440-19173462 ATAGGAAGGCTTTTGGAGGAGGG - Intronic
1163899099 19:20085210-20085232 ATCTGATGGCGGTAGGAGGGTGG + Intronic
1164430986 19:28188647-28188669 ATCACAAGGCAATTGGAGGCAGG - Intergenic
1164518005 19:28952851-28952873 ACATGATGGCAGTAGGAGGAGGG + Intergenic
1164740707 19:30573575-30573597 ATCTTGGGGGAGTTGGAGGATGG - Intronic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1166023958 19:40062260-40062282 ATCTGAAGCTAGTAGAAGGAAGG - Intergenic
1166278633 19:41774411-41774433 ATGAGAAGGAAGTAGGAGGAGGG + Intergenic
1166293507 19:41878028-41878050 TTCTGGAGGTAGGTGGAGGAGGG - Intronic
1166468745 19:43058956-43058978 ATGAGAAGAAAGTTGGAGGAGGG - Intronic
925275469 2:2645167-2645189 TTCTGAAGGCAGTGGGTGGAAGG - Intergenic
925504339 2:4544015-4544037 ATCTGAGGGTATTTGGAGGTGGG - Intergenic
926118904 2:10230415-10230437 AACTGAAGGCAAATGGAGCAAGG + Intergenic
926639974 2:15224735-15224757 CTCTGAAGGCCACTGGAGGAAGG + Intronic
926939529 2:18120131-18120153 AACTGAAGGCAGTTGGAAGCTGG + Intronic
927033386 2:19146558-19146580 ATCTAAAGAAAGTTAGAGGAAGG + Intergenic
927106395 2:19831046-19831068 ATGTGATGGCAGTGAGAGGATGG + Intergenic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
927943193 2:27118651-27118673 CCCTGAGGGCAGGTGGAGGAAGG - Intronic
928109351 2:28494126-28494148 ATGTGAAAGGAGTTAGAGGAAGG + Intronic
928400203 2:30972278-30972300 GTCTGAAGACAGTTAGAGAATGG + Intronic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929944834 2:46362451-46362473 TTCTGAAGGCAGTTAGTGGCTGG + Intronic
929997432 2:46837481-46837503 CTCTGTAGGGATTTGGAGGACGG - Intronic
931076918 2:58725561-58725583 ATCTGATGGTATTTGGAGGTGGG + Intergenic
931344411 2:61433130-61433152 ATCTGAGTGCAGTTGGGGAATGG + Intronic
934904070 2:98184074-98184096 ATCTTGTGGCAGTTGGAGGCAGG + Intronic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
935828391 2:106974245-106974267 ATCTGTAGGCAAATGAAGGAAGG + Intergenic
936160802 2:110082976-110082998 ATCAGAAGGCAAATGGAGGCAGG - Intergenic
936183861 2:110288378-110288400 ATCAGAAGGCAAATGGAGGCAGG + Intergenic
936478254 2:112860274-112860296 AGCTGAAGGGAGTTGAAGGAGGG - Intergenic
937470084 2:122166966-122166988 AGCTGAAGGCAGTTAGTGCATGG + Intergenic
938977880 2:136496507-136496529 ATCTGAAGAAACTTGGAGAAGGG + Intergenic
939536165 2:143431956-143431978 ATCTGAAGTCAGTTGGAAGCTGG + Intronic
939667368 2:144968086-144968108 TTCTCAAGCCAATTGGAGGAGGG + Intergenic
941376354 2:164735769-164735791 ACCTGAAGGCAGTTGGCTAATGG + Intronic
941405448 2:165081639-165081661 AACTGAAGGTGGTGGGAGGAGGG + Intergenic
942290521 2:174465473-174465495 TACTGAAGGCAGATGGAGAAAGG - Intronic
942595281 2:177586443-177586465 CCCTGATGGCAGTTGGAGGAGGG - Intergenic
943049713 2:182900170-182900192 AGCTGAAGGCACCTGGAGCATGG - Intergenic
943289431 2:186049603-186049625 ATGTGATGGCATTTGGAGGCAGG - Intergenic
943594092 2:189834461-189834483 TTCTCATTGCAGTTGGAGGATGG + Intronic
944591372 2:201220832-201220854 ATGTGAAGGCAAGTGAAGGATGG + Exonic
945972341 2:216243103-216243125 CTCTGGAGGCATGTGGAGGAGGG - Intergenic
946111845 2:217426763-217426785 ATCTGAAGGCTGCTAGAGAAGGG - Intronic
946178269 2:217935161-217935183 ATCTGAAGGCAGGGTGAGGAGGG + Intronic
946790984 2:223300195-223300217 ATCTGAAGGACGTTGGTGAAGGG + Intergenic
948277963 2:236724642-236724664 ATCTGAAGGAAGATGGAGAAGGG - Intergenic
948339483 2:237238009-237238031 ATCAGAAGGAAGCTGCAGGATGG + Intergenic
948792514 2:240386292-240386314 CTCTGAGGGCTGTTGGGGGATGG + Intergenic
948983619 2:241507648-241507670 ATCCGAAGGCAGTGGAAGGTCGG - Intronic
1170104345 20:12737370-12737392 ATCTGAAGGGCCTTGGAGGTGGG + Intergenic
1170468449 20:16644314-16644336 ACCTGGAGGGAGATGGAGGATGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174753262 20:53133168-53133190 AACTGAAGCCAGTTGGAAGAAGG - Intronic
1175238433 20:57528520-57528542 ATATAAAGCCAGTGGGAGGAGGG + Intergenic
1175572504 20:60034638-60034660 ACCTGAAGGCAGCTGGGGGCTGG - Intergenic
1176300430 21:5096548-5096570 ATCTGAAGGCATGGGGAGGGCGG - Intergenic
1178836252 21:36100119-36100141 ATCACAAGGCAATTGGAGGCAGG - Intergenic
1179794130 21:43772694-43772716 AGCGGAAGGCAGGTGGGGGAGGG - Exonic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1179856614 21:44165433-44165455 ATCTGAAGGCATGGGGAGGGCGG + Intergenic
1179977213 21:44874899-44874921 ATTCAAAGGCAGTTGGAGGCTGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1181110364 22:20599146-20599168 AGCTGGAGGCAGCTGGAGGGAGG + Intergenic
1182110207 22:27717853-27717875 AGGTAAAGGAAGTTGGAGGAAGG + Intergenic
1182311309 22:29409858-29409880 AACTGAGGCCAGTTGGATGATGG + Intronic
1183220786 22:36511625-36511647 ATCTGCATGAAGCTGGAGGAGGG - Exonic
1183371012 22:37432416-37432438 TTCTGAAGGGAGTGGGGGGAAGG - Intergenic
1184130084 22:42512464-42512486 ATCTCCAGCCAGCTGGAGGAAGG + Exonic
1184243299 22:43222780-43222802 ATCTGAGGGCCGTGGGAGGGAGG - Intronic
1185113996 22:48920812-48920834 ATCTGAAGCCAGTGCCAGGAGGG + Intergenic
949111780 3:269930-269952 ATCTCCAGGAAGCTGGAGGAAGG + Intronic
949466510 3:4349848-4349870 AAGGGAAGGAAGTTGGAGGATGG + Intronic
951099411 3:18669395-18669417 ATATGAAAGCAGGTGGAGGGGGG - Intergenic
951541171 3:23783416-23783438 ATGAGAAGGCAGCTGGTGGAGGG + Intergenic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
957290320 3:78270347-78270369 ATGTGAAGGTATTTGGAGGTGGG + Intergenic
957874797 3:86131279-86131301 ATCAGAAGGCAAATGGAGGCAGG + Intergenic
960153645 3:114275833-114275855 ATGTGATGGCTGTTGGGGGATGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961864319 3:129942524-129942546 AGCTGAAAGGAGATGGAGGAGGG + Intergenic
962360628 3:134740024-134740046 ATCTGCAGGCTAGTGGAGGACGG - Intronic
963527397 3:146431362-146431384 ATGTGAAGGGAGTTGTGGGATGG - Intronic
964428161 3:156574929-156574951 ATTTGAAGGCAGTTGGATAGAGG - Intergenic
967795650 3:193596123-193596145 ATCCAAAGGGAGTGGGAGGATGG - Intronic
967976836 3:195040269-195040291 AGCTGCAGGCAGTGGGAGGAGGG - Intergenic
968192877 3:196683306-196683328 ATCACAAGGCAAGTGGAGGAAGG + Intronic
968295544 3:197573777-197573799 ATCTGAAGGCAGATTCAAGAAGG + Intergenic
968358259 3:198124813-198124835 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
970207546 4:13669940-13669962 ATCTGATGGTACTTGGAGGTGGG - Intergenic
970376447 4:15462516-15462538 ATGTGATGGCATTTGGAGGTGGG + Intergenic
970538944 4:17058473-17058495 CTCTGGAGGCAGTTGTAGCAGGG - Intergenic
970588417 4:17536867-17536889 ATTTCAAGGGAGTAGGAGGAAGG + Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
974603304 4:64117819-64117841 ATCGGAAGTTGGTTGGAGGATGG - Intergenic
974899776 4:67982635-67982657 ATCTCAAGGTTGTTGGAGTAGGG - Intergenic
975384488 4:73739761-73739783 TTCCAAAGGCAGTTGGAGCAAGG - Intergenic
975922367 4:79407495-79407517 AACTGAAGACATTTGGAAGAAGG + Exonic
976812043 4:89108665-89108687 GTCTGAGGGGAGTTGGTGGACGG - Intronic
978470004 4:109054992-109055014 CTCTGAATGTAGCTGGAGGATGG - Intronic
978640711 4:110867946-110867968 ATAGGAAGGCAGTGGAAGGAAGG - Intergenic
982074396 4:151724261-151724283 AACTGAAGGCAAGAGGAGGAGGG - Intronic
982317139 4:154043456-154043478 CACTCAAGGCAGTTGTAGGACGG + Intergenic
982588291 4:157271327-157271349 ATCTGAAGGCAGCAGCAGGGAGG - Intronic
983833752 4:172364311-172364333 CTCTGGAGGCTGTGGGAGGATGG + Intronic
984613768 4:181872468-181872490 ATCAGAAGGCAGAGGGTGGAAGG - Intergenic
985005005 4:185525669-185525691 ATGTGATGGTATTTGGAGGAGGG + Intronic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
987175367 5:15302551-15302573 ATGTGATGGCATTTGGAGGTGGG + Intergenic
988342579 5:29993122-29993144 ATCTGAAGGAAGTTGAAGTTAGG + Intergenic
990808961 5:59700756-59700778 ATCTGAATGCAACTGGAGAAGGG - Intronic
992073243 5:73167966-73167988 ATCTGATGGCAGCTGGATCATGG - Intergenic
993767450 5:91878866-91878888 ATCTGAAAAAAGTTTGAGGAGGG - Intergenic
993767952 5:91886012-91886034 AACAAAAGGCAGTTGGGGGAGGG + Intergenic
993884608 5:93401042-93401064 ATCTGAATCCAAGTGGAGGAAGG + Intergenic
994276877 5:97849374-97849396 ACCTGAAGGCAGGTGGCAGAAGG + Intergenic
995213382 5:109566994-109567016 AACTGAGGGCAGTGGGAGGCAGG + Intergenic
995254642 5:110032498-110032520 ATCTGGAGACAGATGGTGGAGGG + Intergenic
995597148 5:113759892-113759914 ATCTGATAGCACGTGGAGGATGG + Intergenic
995852830 5:116563909-116563931 ATCTGAGGGGAGGTGGAGAAGGG + Intronic
996226684 5:121007962-121007984 ACCTTAAGGCAGTGGGAGAATGG - Intergenic
996424866 5:123303791-123303813 ATGTGATGGCAGTAGGAGGTGGG - Intergenic
996528759 5:124504819-124504841 ACCTCAGGGCAGTGGGAGGAAGG - Intergenic
996907844 5:128621897-128621919 ATGTGAAGGTATTTGGAGGTGGG + Intronic
997487632 5:134245060-134245082 GTCCGAAGGCAGTGGGTGGATGG + Intergenic
999665860 5:153912254-153912276 TACTGAAGCCTGTTGGAGGATGG - Intergenic
1000439310 5:161248266-161248288 ACCTGAAGGGAGTTTGAGGGAGG + Intergenic
1001018138 5:168160158-168160180 AGCTGAAGGTAGCTGGAGGTTGG + Intronic
1001299591 5:170524104-170524126 ATCTGGAGGCAGTGGGAGGCTGG - Intronic
1001485995 5:172120041-172120063 ATGTGGAGGCGGTGGGAGGAGGG + Intronic
1001870797 5:175153966-175153988 ATCTAAAGTCAGATGGAGAAAGG + Intergenic
1003406414 6:5830180-5830202 CTCTGAAGGCTGTTGATGGATGG - Intergenic
1003875585 6:10433605-10433627 AATTGAAGGGAGTTGGGGGATGG + Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1003902991 6:10672423-10672445 ATGTGAAGGCATTTGGAGATGGG + Intronic
1005610768 6:27523054-27523076 ATATGATGGCAGTGGGAAGAAGG - Intergenic
1007254084 6:40516476-40516498 ATCTGAAGGCAGCTGGGGAAGGG + Intronic
1007973883 6:46080623-46080645 ATTTGGAGGCAGTTGGAGGAGGG - Intergenic
1007980435 6:46150188-46150210 ATCCAAAGTCAGTGGGAGGAAGG + Intergenic
1008619378 6:53256994-53257016 AGCTGAAGGCAGTGGCAGGATGG - Intergenic
1009744568 6:67796646-67796668 ATGTGATGGCATTTGGAGGTGGG + Intergenic
1013318399 6:108963368-108963390 ATCTGCAGGTAGTGAGAGGATGG - Intronic
1013615698 6:111841155-111841177 ATCTGCAGGCAGTGGGAGTGGGG - Intronic
1013894783 6:115073644-115073666 CTCTGGAGTCAGTTGGAAGATGG + Intergenic
1013969965 6:116005088-116005110 ATTGTAAGGCAGTTGGGGGAAGG + Intronic
1014029257 6:116681792-116681814 ACCTGCACGCAGGTGGAGGAGGG - Intronic
1014351954 6:120356862-120356884 ATTTGAAGGCATGTGGAGAAAGG - Intergenic
1014529986 6:122547227-122547249 GTCTGAAGGGAGTGGGTGGATGG + Intronic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1014896290 6:126904070-126904092 TTCTGAGGGCAGTGGAAGGAGGG - Intergenic
1018536642 6:164827435-164827457 GTCTGAAGGGAGTGGGTGGATGG - Intergenic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019289005 7:240881-240903 ATGTGAAGGCAGCGGGCGGAGGG + Intronic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1019890146 7:3940039-3940061 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1019890157 7:3940108-3940130 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1019890168 7:3940177-3940199 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1020907231 7:14078474-14078496 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1021228778 7:18060305-18060327 CTCTGTAGGCAGTGGGAGAATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024511836 7:50210725-50210747 ATTTGAAGGAGGTGGGAGGATGG + Intergenic
1024940892 7:54761875-54761897 ATGTGATGGCATTTGGATGAGGG - Intergenic
1027457700 7:78414105-78414127 TTCTGAAGGCAGTTGATGTATGG + Intronic
1029148614 7:98464581-98464603 ATCTGGGGGCAGTTGCCGGAAGG + Intergenic
1029630246 7:101745767-101745789 ATCTAAGGGCAGATGGAAGAGGG + Intergenic
1029779800 7:102719864-102719886 ATGTGAAGGTAGTTGGAGATGGG + Intergenic
1031729619 7:125282635-125282657 ATCTGATGGGAGTTGGAGGCTGG - Intergenic
1031866657 7:127044320-127044342 GTCTGTAGGCAGGTGGAGTAGGG - Intronic
1032874569 7:136023827-136023849 AGCTGAAGGCAGATAGAAGACGG - Intergenic
1033132374 7:138755642-138755664 GTCTGATGGCAGCTGCAGGAGGG - Intronic
1033793532 7:144820409-144820431 ATCTGGAGGTAGGTGGTGGAGGG - Intronic
1035745085 8:1956037-1956059 ATCTGAAAGCACTTGGGGAAAGG + Intronic
1035924482 8:3712321-3712343 CTCTGAGGGCAGTTGGAGGGAGG - Intronic
1037399307 8:18477756-18477778 ATCTGAAGGAAGAGGAAGGAAGG + Intergenic
1039410655 8:37352500-37352522 ATTTGAAGGCAAGGGGAGGATGG - Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041290742 8:56306127-56306149 ATGTGACGGCATTTGGAGGTGGG + Intronic
1041738538 8:61135676-61135698 TTCTGAAGTCAGTTGGAGCCTGG + Intronic
1042528801 8:69794175-69794197 AACTGAAGACAGTTGCTGGAAGG + Intronic
1043846151 8:85166243-85166265 ATCTGAAGGCATTTGGAGGGTGG - Intergenic
1045662547 8:104453041-104453063 ATCTGGAAGCTGTTGGGGGAGGG - Intronic
1045687687 8:104728477-104728499 ATATGACGGCATTTGGAGAAAGG - Intronic
1045809500 8:106204966-106204988 ATCTGCAGGAGATTGGAGGATGG - Intergenic
1046610567 8:116419065-116419087 ATCTTAAGGCTGCTGGAGAAAGG + Intergenic
1048715344 8:137262654-137262676 ATCTGAAAGCAGTTGGAAAATGG + Intergenic
1049317262 8:141975906-141975928 AGCTGGTGGCAGCTGGAGGAAGG + Intergenic
1049505438 8:142994053-142994075 AACTGGAGGCAGCTGGAGGCAGG + Intergenic
1051149966 9:14069555-14069577 ACATGAAGGCAGTCGGGGGAGGG - Intergenic
1051657538 9:19397311-19397333 ATCTGAACGGAGTTGGGGGTTGG + Intergenic
1053266006 9:36714084-36714106 ATCTGAAGGCAAAGGGGGGATGG + Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054923688 9:70566725-70566747 ATCTGAAGGCAGCTGAATGTTGG + Intronic
1057913002 9:99034799-99034821 ATTTGAATGCATTTGGAGGGAGG - Intronic
1058600154 9:106660287-106660309 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1059186198 9:112273766-112273788 TTCTCAGGGCATTTGGAGGATGG - Intronic
1059721384 9:116963453-116963475 ATTTTGAGGCAGTTGAAGGATGG + Intronic
1061192083 9:129087922-129087944 AAATGAAGGCAGGTGGAGGCCGG - Intronic
1061391685 9:130320464-130320486 ATCTGAGGGCCGTGGGAGGTGGG + Intronic
1062742131 9:138181346-138181368 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
1187138099 X:16567831-16567853 ATGTGACGGCATTTGGAGGTGGG - Intergenic
1187723522 X:22177013-22177035 AACTGAAGGCACATGGAGAAAGG - Intronic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1190018391 X:46849381-46849403 ATTTGAAGTGAGTTGGTGGAAGG - Intronic
1194253363 X:91604860-91604882 ATCTCAACTGAGTTGGAGGAGGG + Intergenic
1195056286 X:101148618-101148640 ATATGCAGGCAGGTGGAGGAGGG + Intronic
1195128113 X:101828997-101829019 ATCTGAAGGCAGTTTGCTGGCGG + Intergenic
1196238081 X:113306302-113306324 ATCACAAGGCAGGTGGAGGCAGG + Intergenic
1198221857 X:134609860-134609882 ATGTGATGGCATTTGGAGGTGGG - Intronic
1199052181 X:143249075-143249097 ATCTGAATGCAGATTCAGGAAGG + Intergenic
1200250644 X:154552112-154552134 TTCTGAAGGCAGGTGCAGCATGG - Exonic
1201148187 Y:11078019-11078041 ATGTGATGGCATTTGGAGGTAGG + Intergenic
1202132701 Y:21628297-21628319 ATCAGAAGGCAAATGGAGGCAGG + Intergenic