ID: 956064533

View in Genome Browser
Species Human (GRCh38)
Location 3:65383267-65383289
Sequence CTCCCTTGGGGGAAAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956064525_956064533 0 Left 956064525 3:65383244-65383266 CCTGTTTTGCTTTCTGTTTTCAT 0: 1
1: 0
2: 11
3: 142
4: 1277
Right 956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG 0: 1
1: 0
2: 0
3: 41
4: 292
956064523_956064533 27 Left 956064523 3:65383217-65383239 CCACTGTGATATTAGGTGATGCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG 0: 1
1: 0
2: 0
3: 41
4: 292
956064524_956064533 6 Left 956064524 3:65383238-65383260 CCTATTCCTGTTTTGCTTTCTGT 0: 1
1: 1
2: 9
3: 84
4: 815
Right 956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG 0: 1
1: 0
2: 0
3: 41
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956064533 Original CRISPR CTCCCTTGGGGGAAAAGGGG TGG Intronic
900371586 1:2334524-2334546 CTCCCTTGGGGGAGCAGGCCTGG + Intronic
900639975 1:3684000-3684022 CTCCTCTGGGGGAAAAGGCCAGG + Intronic
900981850 1:6050179-6050201 CTCTCTTGGGGCAGAAGGTGGGG + Intronic
901016930 1:6237129-6237151 TTCACTTGGGGAAAAAGGGCAGG + Intergenic
903296779 1:22348784-22348806 GTCCCTTGGGAGCAAAGGGCTGG - Intergenic
903500849 1:23799592-23799614 GACCCTTGAGGGAAAGGGGGTGG - Intronic
903643251 1:24874846-24874868 TTCCCTTGGTGGAAAGGGGCTGG - Intergenic
905302335 1:36993948-36993970 CTCCCCTGGGGAAGAAGGGAGGG - Intronic
906078327 1:43068168-43068190 TTCCCTTTGGGGGAAAGGGGAGG + Intergenic
908353043 1:63304955-63304977 CTCCCTGGGTGGAAAAGGGTAGG - Intergenic
908387152 1:63653641-63653663 CTCACTTGGGGAAAAATGTGTGG - Intronic
909599614 1:77448141-77448163 TGCCCTTGGGTGGAAAGGGGCGG + Intronic
910413152 1:86967446-86967468 CTCAGTAGGGGGAGAAGGGGAGG - Intronic
910421599 1:87070201-87070223 TTCCCTTAGTAGAAAAGGGGAGG + Intronic
911730906 1:101291462-101291484 CTCGCTTGGGGGAACTGGAGAGG - Intergenic
912466320 1:109877322-109877344 CTCCCTGGGGGCACAAGGTGGGG - Intergenic
914320073 1:146550738-146550760 CCCCCTCGGGGGAAATGGGTTGG + Intergenic
915233047 1:154460033-154460055 GGCCTTTGGGGTAAAAGGGGTGG + Intronic
915250452 1:154584584-154584606 TTCACTTGGGGGAAAAAAGGGGG + Exonic
915941404 1:160120771-160120793 CTGCCTTGGGGGAGATAGGGGGG - Intronic
915977277 1:160399857-160399879 CTGCCTTAGGGAAGAAGGGGAGG - Intergenic
916590240 1:166183185-166183207 GTGCCTTGGGAGCAAAGGGGGGG - Intergenic
919696840 1:200585715-200585737 CTCACTTGGTGGAAGAGGTGAGG + Intronic
920338129 1:205258510-205258532 CTCCCAGGTGGGCAAAGGGGTGG - Intronic
920459828 1:206130930-206130952 CTCCCTTGGGGGCAAAGTCTAGG + Intergenic
921220247 1:212968610-212968632 CTCCTTTGTGGGAAACAGGGAGG - Intronic
924052106 1:240089516-240089538 TTCCTTTGTGGGAAAATGGGTGG + Intronic
924611818 1:245579910-245579932 CCCCCTTGGAGGAACAGTGGTGG + Intronic
924835007 1:247639077-247639099 CTGCCATAGGGGAAAAGTGGAGG + Intergenic
1065864278 10:29900268-29900290 TTCCCTTGGTGGAAATGGTGGGG - Intergenic
1066135370 10:32440414-32440436 CTCCCTTTGGGGAAGAAGGCAGG + Intergenic
1066554511 10:36596559-36596581 GTCCCTTGGGAGCAGAGGGGTGG + Intergenic
1067430337 10:46238749-46238771 CTCTTTTGGGAGAAAAGGAGAGG - Intergenic
1067719573 10:48717519-48717541 CCCCATTGGAGGAAAAGGGAGGG - Intronic
1068621074 10:59183554-59183576 CACCCTTTGAGGGAAAGGGGTGG + Intronic
1069651528 10:70053190-70053212 CTTCCTTGGGCGATAAAGGGGGG + Intronic
1070201206 10:74207835-74207857 CTCTCCTGGGAAAAAAGGGGTGG - Intronic
1070430416 10:76332345-76332367 CATCCTTGGAGGAAAAGGAGAGG - Intronic
1070675004 10:78406326-78406348 ACCCCCTGGGGTAAAAGGGGGGG + Intergenic
1071217391 10:83424271-83424293 CTTCCCTGGGTGAAAAGGGGTGG + Intergenic
1071520008 10:86324422-86324444 CTCCACTGGGAGAAAGGGGGAGG + Intronic
1073980686 10:109149979-109150001 ATCCCTTGGGGGAATTGGGGAGG + Intergenic
1074442921 10:113494628-113494650 CCACCCTGGGGGACAAGGGGTGG - Intergenic
1074676875 10:115861147-115861169 TTCTCTTGGTGCAAAAGGGGAGG - Intronic
1076701973 10:132278008-132278030 CTCCCTGGAGGGAACTGGGGAGG - Intronic
1077661465 11:4072207-4072229 ATCTCTAGGGGGAAAAGGGGAGG - Intronic
1077879844 11:6340477-6340499 TTTCCTTGGGGGAAAATGAGGGG - Intergenic
1078637654 11:13066649-13066671 CTCCCAAGGGGTAATAGGGGAGG + Intergenic
1079270197 11:18977206-18977228 CTCCCTTGTGGTAAAGGTGGAGG + Intergenic
1079674014 11:23202552-23202574 GTCCCTTGGGGGGGAAGGGGTGG + Intergenic
1081765162 11:45605385-45605407 CTCCCTGGGGACAGAAGGGGAGG - Intergenic
1083608746 11:63994826-63994848 CTCCCGAGGGAGAAAAGAGGTGG + Intronic
1083631274 11:64096777-64096799 CTCCCTGAGGGGAAGAGGGCAGG + Intronic
1085016772 11:73178955-73178977 CTGCCCTGGGGGAAGAGGGGAGG - Intergenic
1085039228 11:73317292-73317314 CTACCTTGGGGGGTAGGGGGAGG - Intronic
1087137380 11:94734651-94734673 CTCCCCTGGGAGAGGAGGGGAGG + Intronic
1087365438 11:97212781-97212803 TTCCTTTGGGGAAAAAGGAGAGG + Intergenic
1087365866 11:97217887-97217909 CTCCCTTGAGGGAAGAGGAGGGG + Intergenic
1087979603 11:104594703-104594725 TTCACTGGGGAGAAAAGGGGTGG - Intergenic
1088884658 11:113997397-113997419 AGCCCTTGGGGGAAAAGGGCAGG - Intergenic
1089003717 11:115073532-115073554 CTCCCTTGGGCGATCAGGAGGGG + Intergenic
1090205702 11:124882917-124882939 CTCCCTTGGCGGGAAAGGTCGGG - Intergenic
1092332035 12:7593796-7593818 GAACCTTGGGAGAAAAGGGGTGG - Intergenic
1093091654 12:14928204-14928226 GTACCTTGGGGAAAAAAGGGTGG - Intronic
1093998912 12:25673717-25673739 CTCCCTTTGGAGAGATGGGGAGG + Intergenic
1094240171 12:28213156-28213178 TTCCCCTGGGGGGAAAGGAGGGG - Intronic
1096409090 12:51364526-51364548 CGCCTTTGGGGGTAGAGGGGTGG - Intronic
1096464700 12:51841865-51841887 CTTCTTTTGAGGAAAAGGGGAGG - Intergenic
1097246169 12:57608963-57608985 CTCCCTTAGGGGAGGTGGGGAGG + Intronic
1097347677 12:58512578-58512600 TTCCCTTGAGAGAAAAGGGAGGG - Intergenic
1098510940 12:71313340-71313362 CTCCCTTTGGTGAAAAGGGCAGG + Intronic
1098565881 12:71934995-71935017 CTACCTGGGGGCAAAAGAGGAGG + Intergenic
1098627546 12:72691082-72691104 TTCACCTGTGGGAAAAGGGGAGG - Intergenic
1099023659 12:77438175-77438197 TTCCCCTGGGAGTAAAGGGGTGG + Intergenic
1099128764 12:78799930-78799952 CTCCCTTGGAGGAGAATAGGTGG + Intergenic
1099143238 12:79006740-79006762 TTGCAATGGGGGAAAAGGGGAGG + Intronic
1100293901 12:93242919-93242941 TTCCCTTTGGGGAGAAGGGCTGG - Intergenic
1103078599 12:118005399-118005421 TTCTCTTGGAGGAAAAGGAGGGG + Intergenic
1103464227 12:121129028-121129050 CTCCGTTGGGGGAGAAGGGAGGG - Intergenic
1103597552 12:122032849-122032871 CGCCCTAGAGGGAAAGGGGGTGG - Intronic
1104443134 12:128811497-128811519 CTACCTGGGGGCTAAAGGGGAGG + Intronic
1104960282 12:132485306-132485328 CTCCCCTGGGTGAACAGGGAGGG + Intergenic
1105671946 13:22628980-22629002 CTGCATTGTGGGAAAAGGGGAGG - Intergenic
1106434739 13:29713414-29713436 TCCCCTTGGGGAAAAAGAGGAGG - Intergenic
1107596307 13:41966429-41966451 CTCCTTTGGAGGTAAAGGGATGG - Intergenic
1108438142 13:50421497-50421519 TTCCCCTGGAGGAAAAGGGGTGG + Intronic
1110461955 13:75755034-75755056 ATCCCTTGAGGGAAAAGGTGGGG - Intronic
1113718594 13:112533966-112533988 TTCCCTTGGAGGGAAAGGGTGGG - Intronic
1113933060 13:113978642-113978664 GTCCCTTGGAGGGAAAGGTGTGG - Exonic
1115661069 14:35494678-35494700 TTCTGTTTGGGGAAAAGGGGAGG + Intergenic
1118739759 14:68731087-68731109 CCCCCTTTGGGAAAAAGGGAGGG - Intergenic
1121476821 14:94216592-94216614 CTCCCTTGGTGATAAAGGTGTGG + Intronic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1122974289 14:105164688-105164710 CTCCCTAGGGGGCAAAGGAGAGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124442049 15:29692873-29692895 GTCCCTTGGGGGTAAGGGGAAGG + Intergenic
1125249729 15:37686438-37686460 TTCTCTTGGGGACAAAGGGGAGG - Intergenic
1126205299 15:46038500-46038522 CTCCCTATGGGGAAAATGGGTGG - Intergenic
1126436523 15:48644321-48644343 GTTCCTTGGGGAAGAAGGGGAGG - Intronic
1126462688 15:48929881-48929903 CTGCCTTGGGGCATAAAGGGAGG - Intronic
1126809177 15:52383425-52383447 CTTCCTGTGGGGAAAAGGAGTGG - Intronic
1127539503 15:59922813-59922835 GTCCCTTGGGAAAAAAGGGCAGG + Intergenic
1128843300 15:70868045-70868067 CACCCTTGGGGGAAAGGGAGGGG + Intronic
1129034574 15:72641593-72641615 CAGCCTTGGGGGACTAGGGGAGG + Intergenic
1129215308 15:74095623-74095645 CAGCCTTGGGGGACTAGGGGAGG - Intergenic
1129392330 15:75226584-75226606 CAGCCTTGGGGGACTAGGGGAGG + Intergenic
1129770656 15:78201347-78201369 CTCCCTGGGGGGCAAGGGTGAGG - Intronic
1131818303 15:96245612-96245634 GTACCTTGGGGGATAAGGAGAGG + Intergenic
1132724344 16:1332419-1332441 AGCCCTTTGGGGACAAGGGGTGG - Intergenic
1132816781 16:1832815-1832837 CTCCCTTGGGGAGAACTGGGGGG - Intronic
1133099774 16:3472010-3472032 AGCCCTTAGGGGAAAGGGGGTGG + Intronic
1136078843 16:27838502-27838524 CACCATAGGGAGAAAAGGGGAGG + Intronic
1138138816 16:54548670-54548692 CTCCTTTGTGAGAAGAGGGGAGG + Intergenic
1138512696 16:57517814-57517836 CTCCATGAGGGGAAGAGGGGAGG + Intronic
1138925374 16:61583794-61583816 CAGCCTTGGGGAAAAAGGGATGG - Intergenic
1139852393 16:69959155-69959177 CACCCTTGGTGGGAGAGGGGAGG + Intronic
1139881364 16:70182063-70182085 CACCCTTGGTGGGAGAGGGGAGG + Intronic
1140013452 16:71159339-71159361 CCCCCTCGGGGGAAATGGGTTGG - Intronic
1140371143 16:74413441-74413463 CACCCTTGGTGGGAGAGGGGAGG - Intronic
1140765189 16:78150765-78150787 CCGCCTTGGGGGAAGAGGAGGGG - Intronic
1141295257 16:82762133-82762155 GTCACTTGGGGGAAAAGAAGGGG - Intronic
1141423239 16:83930672-83930694 CTCCCTTACGGGAAATGGGATGG + Intronic
1141501696 16:84449199-84449221 TTCCCTTGGGGGAAAGTGAGAGG + Intronic
1142599815 17:1048113-1048135 CTCTCTGTGGGGATAAGGGGAGG - Intronic
1142798757 17:2330484-2330506 CTGTCTTGTGGGAAAATGGGGGG - Intronic
1143430719 17:6881231-6881253 ATCCCTTATGGGAAAAGGGATGG + Intronic
1146521407 17:33528290-33528312 CTTCCTGTGGGGAAAAAGGGAGG + Intronic
1146941100 17:36845132-36845154 CTCCTTTCAGGGATAAGGGGTGG - Intergenic
1147110108 17:38256231-38256253 GTCACTTGAGGGAAAGGGGGAGG + Intergenic
1147315673 17:39618987-39619009 TCCCCTTGGGAGAAGAGGGGTGG - Intergenic
1147704001 17:42413603-42413625 GTCCCTGGGGCCAAAAGGGGTGG + Intronic
1147970327 17:44215985-44216007 CTCACCTGGAGGAAGAGGGGTGG + Exonic
1148336924 17:46848169-46848191 CACCCATGGGGGAACAGTGGGGG + Intronic
1148419405 17:47532190-47532212 GTCACTTGAGGGAAAGGGGGAGG - Intronic
1148729785 17:49826626-49826648 CTTGGTTGGGGGCAAAGGGGTGG + Intronic
1150684357 17:67308665-67308687 CTGACATGGGGGAAAAGGGAGGG + Intergenic
1151239066 17:72743741-72743763 CTCACTGGGGGGAAAAGGAAAGG + Intronic
1151826886 17:76528662-76528684 GACCCTCGGGGGAAAGGGGGAGG + Intronic
1155207688 18:23575327-23575349 CCCACTTGGTGGAAGAGGGGTGG + Intronic
1156273051 18:35554897-35554919 CCTCCTTGGAGGTAAAGGGGTGG + Intergenic
1158284376 18:55863052-55863074 CGCACTTGGGGGGAAAGGTGTGG + Intergenic
1161253728 19:3295026-3295048 CTCACCTGGGGGAGAAGGGACGG - Intronic
1161412078 19:4122675-4122697 ATCCCTTTGGGGAAAAGATGGGG - Intronic
1161906360 19:7159778-7159800 CTCCTTTTTGGGAGAAGGGGCGG - Intronic
1163184096 19:15624159-15624181 CCCAGGTGGGGGAAAAGGGGAGG + Intronic
1164155738 19:22596015-22596037 CTCCAGTGGGAGGAAAGGGGCGG - Intergenic
1164628242 19:29743654-29743676 CTCCCTTGAGGGAAAAGAGAAGG + Intergenic
1165773873 19:38393874-38393896 TTCCCTGGGCAGAAAAGGGGAGG + Intronic
1166219207 19:41354079-41354101 CAGCCCTGGGGGAAAGGGGGCGG + Intronic
1166725949 19:45027693-45027715 GTCCCTTGAGGGAAAATTGGAGG + Intronic
1167172123 19:47840118-47840140 CTCCCTGTGGAGGAAAGGGGTGG - Exonic
1167666583 19:50825945-50825967 CACCCTGTGGGGAAAAGAGGGGG + Exonic
927074798 2:19567007-19567029 CTCCATTCGGGGAAGAGTGGAGG + Intergenic
927656273 2:24949303-24949325 CTCCCTTGTGGGGAAGAGGGAGG - Intronic
927852873 2:26510944-26510966 CTGCCTTGGGGGAGATGGGAGGG + Intronic
930875523 2:56211188-56211210 TTCCCTTTGGGGAAAAGAGTGGG + Intronic
932058490 2:68470822-68470844 CTCAGTTGGGGGAACAGGGAAGG + Intronic
935038548 2:99403218-99403240 CTCACTTGGGGCAGGAGGGGAGG - Intronic
936333610 2:111570056-111570078 CTCCTTTTGTGTAAAAGGGGGGG + Intergenic
936452618 2:112645363-112645385 CTCGCCTGGGGGAAGCGGGGGGG - Intergenic
936497235 2:113033013-113033035 CTCCCTTGGAGGCAGAGGTGTGG + Intronic
936951415 2:117981414-117981436 GTCACTTGGGGGAAACGGGCAGG - Intronic
937219864 2:120336589-120336611 CTGCTTTGGGAGAAAAGTGGTGG - Intergenic
937313308 2:120915374-120915396 CTCACTTGGGGGAAAAACGTGGG - Intronic
939863094 2:147442362-147442384 TTCCCTTGTGGGTAAAGGTGGGG - Intergenic
945594803 2:211778088-211778110 CACCATTGGGGGAAAAAGGCAGG + Intronic
947643778 2:231722830-231722852 CTCACATGGTGGAAAGGGGGAGG + Intergenic
947846085 2:233244766-233244788 CTACCTTAAGGGAAAAAGGGGGG - Intronic
948639816 2:239368550-239368572 CTCCATTGGGGGATAACAGGGGG + Intronic
1169547215 20:6662592-6662614 CTCCCTTGTGTGAACAGGGTGGG + Intergenic
1170620317 20:17990394-17990416 CTCCCTTGAGGGACATTGGGGGG + Exonic
1171983159 20:31641030-31641052 CACTCTTGGGGGGAGAGGGGAGG + Intronic
1172005398 20:31815945-31815967 CTCCCTTGGAGGCACAGGGGTGG - Intergenic
1172009233 20:31836821-31836843 CTGCCTCTGGGGACAAGGGGAGG - Intergenic
1172120112 20:32593387-32593409 CTCCCTGGTGGGACATGGGGAGG + Intronic
1172614207 20:36272897-36272919 GTCCCCTGGGTGAAAGGGGGTGG - Intergenic
1172846414 20:37932071-37932093 CTCCCTTCGGGGTACAGGTGAGG + Intronic
1173878800 20:46395024-46395046 GTCCTTTGAGGGGAAAGGGGTGG - Intronic
1174584363 20:51596024-51596046 GTCCCTTGGGGGACACGTGGCGG - Intergenic
1175400930 20:58699449-58699471 CGTCCCTGGGGGAGAAGGGGAGG + Intronic
1176105163 20:63382435-63382457 CTCCCTGGGGGTAAAATGGGTGG - Intergenic
1176172215 20:63701151-63701173 TCCCCTCGGAGGAAAAGGGGAGG - Intronic
1176240795 20:64074989-64075011 CTCCCCTGGGGGAGATGGGGTGG + Intronic
1176241224 20:64076808-64076830 CTCCCCTGGGGGAGATGGGGTGG - Intronic
1179824664 21:43957377-43957399 CTCCCATGGGGCAAAGGGGTGGG - Intronic
1180975380 22:19845113-19845135 CAACCTTGGGTGGAAAGGGGAGG + Intronic
1182287876 22:29258867-29258889 CTCCTTCGGGGCAAGAGGGGCGG + Exonic
1183323727 22:37180398-37180420 CTCCCTCTGGGGAGAAGGGCAGG + Exonic
1183686151 22:39362454-39362476 CTCACTCTGGGGAAAAGGTGGGG - Intronic
1183780883 22:39998152-39998174 CTCCCTCAGGGCGAAAGGGGAGG - Intronic
1184128371 22:42502801-42502823 CTCCCTTGGGTGGAGTGGGGAGG + Intergenic
1184137163 22:42556116-42556138 CTCCCTTGGGTGGAGTGGGGAGG + Intronic
1184208118 22:43018072-43018094 GCCCCTTGGCTGAAAAGGGGTGG - Intergenic
1184399423 22:44265171-44265193 CTCCCTTGGTACCAAAGGGGAGG - Intronic
1184998530 22:48227675-48227697 TCCCCTAGGGGAAAAAGGGGAGG - Intergenic
949214365 3:1547462-1547484 CTCCCTTTGGAGGAAAGGGCAGG - Intergenic
950673056 3:14538790-14538812 CTCCCATGGCAGCAAAGGGGTGG + Intronic
951803416 3:26622409-26622431 CCTCCTTGGGGGAAAAGCGGAGG - Intergenic
952577572 3:34793778-34793800 CCACATTGAGGGAAAAGGGGTGG - Intergenic
952952943 3:38539038-38539060 CTCCCTTTGGGGCAGTGGGGTGG - Intronic
954358387 3:50102566-50102588 GTCCTTTGGGGGGAAAGGGAGGG - Intronic
954378324 3:50206205-50206227 CCCCGTGGGGGGAAAAGGGCGGG - Intronic
954999015 3:54909492-54909514 CTCCCTTGGGAAAAAAGGGACGG + Intronic
956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG + Intronic
956129288 3:66038951-66038973 CTCCCTTCGGGGAGGAGGGGAGG - Intergenic
956693283 3:71897590-71897612 ATCCCCTGGGGGAAAAGAAGTGG - Intergenic
958195293 3:90235635-90235657 CTTCCTAGGTGGAAAAGGGTGGG + Intergenic
958418701 3:93907041-93907063 CTTCCTAGGTGGAAAAGGGTAGG + Intronic
958582036 3:96039261-96039283 ATCCTTTGGGGGGAGAGGGGAGG - Intergenic
958864272 3:99482923-99482945 CTTCTTTAGGGGAAAAGGGTAGG - Intergenic
961009316 3:123425287-123425309 CTCACTTGGGGGAAAGGGATTGG + Intronic
961445728 3:126980431-126980453 CTGCCTTGGGGCAAAAGGGCGGG + Intergenic
961477288 3:127156818-127156840 CACCCTTGTGGGAAATGGGGAGG - Intergenic
962027172 3:131560501-131560523 GTCCTTTGTGGGAAGAGGGGTGG - Intronic
963044822 3:141094778-141094800 CTCCCAGGGGGGCAAAGGGGCGG - Intronic
963875307 3:150468679-150468701 GTACCTTGAGGGAATAGGGGTGG + Intergenic
964445615 3:156754285-156754307 CTCCCTTGTTGGGCAAGGGGAGG - Intergenic
966880304 3:184346322-184346344 CCCCTTTGAGGGGAAAGGGGTGG - Exonic
969369485 4:6722755-6722777 CTCACTTGGGGGAGAAGAGAAGG - Intergenic
969595566 4:8147699-8147721 CTCCCTCGGGGGCTCAGGGGAGG - Intronic
969840160 4:9875717-9875739 GTCACTGGGGGGAAAAGGGGAGG - Intronic
970332423 4:15001418-15001440 CTCCCTGGGGGGAAGGGGCGGGG + Intergenic
974246627 4:59328564-59328586 CTCACTTGGGGAAAAAAAGGTGG - Intergenic
975444414 4:74445545-74445567 CTCCCTAGGAGGAAAAGAGAAGG + Intronic
975486972 4:74944541-74944563 CTCCCATGGGAGAAGAGGTGGGG - Intronic
975779277 4:77821202-77821224 ATCTCTTGGGGGAAAAGGTGCGG + Intergenic
976184883 4:82433251-82433273 CACACTTGGGGAAAAAGGTGGGG - Intronic
976886596 4:89992070-89992092 TTCACTTGGTGGAAAAGAGGAGG - Intergenic
976978369 4:91192192-91192214 GTCCATGGGGGGAAAAGTGGGGG - Intronic
977701223 4:100025109-100025131 TTCCACTGGGGGAAAAGAGGTGG + Intergenic
978798867 4:112735542-112735564 CCCCCTTGTGGGAAGATGGGTGG - Intergenic
979646673 4:123077704-123077726 CTCCCTCAGGGGCAAAGGGCAGG - Intronic
981056555 4:140368008-140368030 CTCACTTGAGGAAACAGGGGTGG + Intronic
981079259 4:140622602-140622624 CTCCCTTGGAGGACAAATGGAGG - Exonic
982675899 4:158375385-158375407 CTACCTTGGGGGAAAAAGCGAGG + Intronic
983296429 4:165873878-165873900 CTCCCCCGGAGGAAAAGGAGGGG - Exonic
983726892 4:170940372-170940394 CTCCCATGGGGGACAGGGGGTGG + Intergenic
983939003 4:173522531-173522553 GTCGCTTGGGGGAAGAGGTGAGG + Intergenic
984184131 4:176521574-176521596 CTTCCTAGAGGGAAAAGGGTGGG + Intergenic
984259401 4:177426749-177426771 CTCCCTTGGAGGCAAAGGTTAGG - Intergenic
985017036 4:185647289-185647311 ATTCCTTGGGGGAAAAGTGCTGG - Intronic
985769054 5:1797625-1797647 CTCCTTTCTGGGAGAAGGGGAGG + Intergenic
986782911 5:11083833-11083855 CCCCCATGGGGGAAGGGGGGTGG - Intronic
987168305 5:15224333-15224355 ATGCCTTTGGGGAAAAGGGCAGG - Intergenic
988360778 5:30233672-30233694 ATTCCCTGGGGCAAAAGGGGTGG + Intergenic
989348237 5:40453810-40453832 CTCCCTGGGTGGAAGAAGGGGGG - Intergenic
992084073 5:73262222-73262244 CTCCCTTTGGAGCAAAGAGGAGG - Intergenic
992194351 5:74324941-74324963 CTCCCATGGAAGAAAAGGGAAGG - Intergenic
992328850 5:75694654-75694676 CTCCATTGGGAGAAAAGATGAGG - Exonic
992399959 5:76403158-76403180 CTCCCCCGGGGGAGAAGGGGCGG + Intergenic
997651721 5:135526772-135526794 CTCCCTTCAGGGAAAATGGCTGG + Intergenic
998518803 5:142781540-142781562 CACACCTGGGGGAAAAGGGAGGG + Intronic
1001020414 5:168178098-168178120 GTCCCTGGGGGGAAGATGGGAGG - Intronic
1003246387 6:4385687-4385709 TTCCCCTGAGGTAAAAGGGGAGG - Intergenic
1003684694 6:8290375-8290397 GTATCTTGGGGGAAAAGGGGTGG - Intergenic
1003847398 6:10187274-10187296 CTGTCGTGGGGGACAAGGGGAGG + Intronic
1004938688 6:20533055-20533077 AGATCTTGGGGGAAAAGGGGTGG + Intergenic
1006168500 6:32079791-32079813 ATTCCTTGGGGTTAAAGGGGAGG - Intronic
1007163210 6:39809609-39809631 CTCTCTAGGGGGAAAAGTAGGGG - Intronic
1007577946 6:42938257-42938279 CTCCCTTGGGGGAGGTGGGTAGG + Intronic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1010037978 6:71347806-71347828 CTCCCTTGGGGCAACAAGGGTGG - Intergenic
1011274065 6:85611511-85611533 ATCCCTTTGGGGAAGGGGGGAGG + Intronic
1011937771 6:92802174-92802196 CTCCCTTGGGATGAAAGGGTAGG - Intergenic
1012623311 6:101376016-101376038 CTCCCTTGGGTGCAATGGGTAGG - Intergenic
1015198201 6:130547818-130547840 CTGCCTTGGGGGAAAAGGCAAGG + Intergenic
1016601450 6:145866114-145866136 CCCCCTTGGGGATAAAGGTGAGG - Intronic
1017817748 6:158027675-158027697 CTCCCCTGGGGGCACAGGTGGGG + Intronic
1017829927 6:158117067-158117089 CTCCTCTGGGTGAAATGGGGAGG + Intronic
1019794014 7:3036462-3036484 CTCCCTTAGGGGACAGGGGAGGG + Intronic
1021024138 7:15643472-15643494 CTCCCATAGGGGAACAGGGGTGG + Intronic
1021906872 7:25343300-25343322 ATGCCTTGGAGGAAGAGGGGAGG + Intergenic
1022233940 7:28443349-28443371 CTCCCTTGGGAGCAAAGGTCAGG - Intronic
1022813079 7:33888068-33888090 CCACCTTGGGGGACAAGGGAGGG - Intergenic
1023658804 7:42452770-42452792 TAAACTTGGGGGAAAAGGGGAGG - Intergenic
1023819841 7:43974577-43974599 CTATCCTGGGGGTAAAGGGGTGG - Intergenic
1024970495 7:55065267-55065289 CTCCCTAGGGAGGAGAGGGGTGG + Intronic
1025084323 7:56010210-56010232 CTCCCTGGAGGAAAAATGGGGGG - Intergenic
1025229054 7:57187677-57187699 CGCCTTTGGGGGAAAAAAGGAGG + Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026407502 7:70082397-70082419 CTCCCTAGAGGAAAGAGGGGAGG + Intronic
1026864650 7:73815998-73816020 CAGCCTTGGGGGGAAGGGGGAGG - Intronic
1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG + Intergenic
1028322400 7:89476619-89476641 CTCACTTTGGGGAAAACTGGAGG - Intergenic
1028987098 7:97017378-97017400 CCTCCTTGTGGGACAAGGGGCGG - Intergenic
1029976125 7:104835915-104835937 CTCCCATTTGGGGAAAGGGGAGG - Intronic
1031465270 7:122102324-122102346 GTTCCTTGGGAGAAAAGAGGAGG - Intronic
1032132779 7:129244577-129244599 CTCACTTGGGGGAAGAGGGAAGG + Intronic
1034493684 7:151407943-151407965 CTGTCTTGGGGGTAGAGGGGTGG - Intronic
1036604132 8:10291632-10291654 ATCTCGTGTGGGAAAAGGGGAGG + Intronic
1037174880 8:15935479-15935501 CTCACTTGGAGGAGAAGGGCTGG + Intergenic
1037752565 8:21692437-21692459 CTCCCTTTGGGGAGAGGGAGGGG - Exonic
1038126173 8:24675254-24675276 CTCCCAAGGGGAAAGAGGGGAGG + Intergenic
1038850234 8:31268489-31268511 GTCTCCTGGGGGTAAAGGGGTGG + Intergenic
1039958037 8:42222064-42222086 CTCCCTTGGGGAGAAGGGAGTGG + Intergenic
1040825210 8:51612669-51612691 CTCCCATGGTGGAATTGGGGAGG - Intronic
1040850221 8:51892899-51892921 ATCCCAGGGGGGAAAATGGGAGG + Intronic
1044065929 8:87700165-87700187 CTCTCTTTGGGGGGAAGGGGAGG + Intergenic
1045952888 8:107871744-107871766 CTCCCTTGTGGGAACATGGATGG + Intergenic
1049026337 8:139991984-139992006 CTCCTGTGAGGGAAAAGGGCAGG + Intronic
1049433915 8:142577521-142577543 CTCCCTGCGAGGAAAAGGGCAGG - Intergenic
1049989877 9:980865-980887 CTCCCCTGGAGGAAAAGTTGGGG - Intronic
1050735257 9:8754864-8754886 ATCCTTTTGGGGAAATGGGGTGG + Intronic
1052816093 9:33103517-33103539 CTCCCCTGGGGGAATGGTGGAGG - Intergenic
1052872757 9:33524040-33524062 CTCTCTTCGGAGAAGAGGGGCGG + Intergenic
1054473435 9:65556436-65556458 CTCCCTTGGTGGGAGATGGGAGG - Intergenic
1054864648 9:69987703-69987725 CTCCCATGAGGTAAAAGGGAAGG - Intergenic
1057247255 9:93467252-93467274 ATTCAATGGGGGAAAAGGGGGGG - Intronic
1058048900 9:100386933-100386955 CACACTTGGGGGAAACAGGGAGG + Intergenic
1060298136 9:122356818-122356840 CTCCCCTGGTGGAGAAAGGGTGG + Intergenic
1061019980 9:128008101-128008123 CTCCGGTGAGGGAAGAGGGGAGG + Intergenic
1061431235 9:130532720-130532742 ACCCCCTGGGGGAAAAGAGGCGG + Intergenic
1061488870 9:130934279-130934301 CTCCCCTGGGGGTGAAGGGTTGG + Intronic
1061612495 9:131756437-131756459 CTCCTTAGGGGGAAAACGTGGGG + Intergenic
1061907270 9:133705103-133705125 CACCCTTGGGTGTAAAGTGGCGG - Intronic
1062439253 9:136562371-136562393 CTGCCTTGGGGGGAAAGCTGGGG - Intergenic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1062564105 9:137156376-137156398 TTACCTTGGGGGAGCAGGGGTGG - Intronic
1185724003 X:2404896-2404918 CTGCCTTGGGGCAAAAGGATTGG - Intronic
1185815990 X:3156453-3156475 CTCCCATGGTGGAAAGGGTGAGG - Intergenic
1186459220 X:9734853-9734875 CTCCCTGGAGGGAAACCGGGAGG + Intronic
1186963533 X:14762642-14762664 TTCCCTTGGGAGAAATGTGGAGG - Intergenic
1187269257 X:17765050-17765072 CTCCCCTGGAGGAGCAGGGGTGG + Intergenic
1190954469 X:55178886-55178908 CACCGTTGGGGGAAAAGGTGGGG - Intronic
1194088604 X:89559243-89559265 TTCCCTTGGGGGAAAATGAGGGG - Intergenic
1195530145 X:105944693-105944715 CACCCTTGGAGGAAAAAGGAGGG + Intronic
1195750865 X:108161293-108161315 ATCCCTGGGTAGAAAAGGGGAGG + Intronic
1197587924 X:128372625-128372647 ATCCCTAGGGGGAAAATGGAGGG - Intergenic
1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG + Intergenic
1200441280 Y:3215296-3215318 TTCCCTTGGGGGAAAATGAGGGG - Intergenic
1201265456 Y:12202146-12202168 CTCCCATGGTGGAAGAGGTGAGG + Intergenic