ID: 956065322

View in Genome Browser
Species Human (GRCh38)
Location 3:65391428-65391450
Sequence AGTGCTAAACAAAGACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956065322_956065323 10 Left 956065322 3:65391428-65391450 CCAGCTTGTCTTTGTTTAGCACT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 956065323 3:65391461-65391483 CATACATATCAACAGTATTTTGG 0: 1
1: 0
2: 1
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956065322 Original CRISPR AGTGCTAAACAAAGACAAGC TGG (reversed) Intronic
900280904 1:1867987-1868009 AGTTCTAAAGAAAGAAAAGGGGG - Intronic
900981745 1:6049693-6049715 AGAGCTAAAGAGAGACCAGCAGG - Intronic
905728944 1:40281437-40281459 TGTACTAAACAAAGACATCCAGG + Exonic
906107367 1:43302835-43302857 AGGGCTGAACAAAGGCAGGCTGG + Intronic
907575147 1:55519703-55519725 ATTACAAAAGAAAGACAAGCTGG + Intergenic
908569633 1:65395218-65395240 AGAGCAAAACAAAGTTAAGCAGG - Intronic
908629124 1:66082891-66082913 AGTGGGAGATAAAGACAAGCAGG + Intronic
910156119 1:84222240-84222262 AATGGAAAACAAAAACAAGCAGG - Intronic
910683561 1:89892440-89892462 AGTGCTAAATAATGCCAAGCGGG - Intronic
911144137 1:94536161-94536183 AGTGCTAAAGAAAGAAAAGAAGG + Exonic
912586329 1:110770094-110770116 AGAGCTAAAAAAAGAAAAACTGG + Intergenic
913986031 1:143566905-143566927 AGTGCTAGAGAAAGAGAGGCAGG - Intergenic
916474076 1:165151812-165151834 AGTGCTTAACAAAGAAATGATGG - Intergenic
916554150 1:165878645-165878667 AGTGCTAAAAAGAAATAAGCTGG - Intronic
917088399 1:171327493-171327515 AGTGCAAAACAAAAACAAACAGG + Intronic
918452310 1:184671386-184671408 AGTGCTAAAGAAAGAAAAAGGGG - Intergenic
918862990 1:189857682-189857704 AATGGAAACCAAAGACAAGCAGG - Intergenic
919015455 1:192027651-192027673 ATTGCCAAACAAAGAAGAGCTGG - Intergenic
920521130 1:206627568-206627590 AGTGAAAAACAAAGACAGGCAGG + Intergenic
1063459876 10:6208426-6208448 AATCCTGAGCAAAGACAAGCTGG - Intronic
1064364245 10:14692597-14692619 AGTCCTAAACCATGACAAACGGG - Intronic
1066662950 10:37754399-37754421 AGTCCTCAACAAAGACTTGCAGG - Intergenic
1066975142 10:42361408-42361430 GGTCCTAGACAAAGACAATCTGG + Intergenic
1070241585 10:74687331-74687353 AATGGAAAACAAAGACAGGCTGG - Intronic
1073636712 10:105206782-105206804 AGCACTCAACAAACACAAGCAGG - Intronic
1074313119 10:112339519-112339541 AGTGTTAAACAGAGACAACTTGG - Intergenic
1074668267 10:115756982-115757004 AATGCAAAACAAAAAAAAGCAGG - Intronic
1075577786 10:123592090-123592112 AGTGTTAAGCAAAGACATTCTGG - Intergenic
1079711156 11:23683405-23683427 AGTGCTAAGCAAAGACTAAAAGG + Intergenic
1083368586 11:62159112-62159134 AATGCTAAGCAAAAAAAAGCAGG + Intergenic
1084160587 11:67347268-67347290 TGAGCTGAACAAAGGCAAGCAGG - Intronic
1085414623 11:76311826-76311848 AGTGATGAACAAAAATAAGCAGG - Intergenic
1088197928 11:107296008-107296030 AATGCAAAACAAAAAAAAGCAGG + Intergenic
1089316011 11:117591930-117591952 AGTTCTAAACAAAGGGAGGCAGG + Intronic
1089563638 11:119358642-119358664 AGTGTTCAACAAAGCAAAGCAGG - Intronic
1089935107 11:122356535-122356557 AGTGTTAAATAGAGACAATCTGG + Intergenic
1090054906 11:123414595-123414617 AGAGCTATGCAAAGACAAGGGGG - Intergenic
1090154358 11:124422026-124422048 AGTGTTAAACAAATAGAAGGAGG - Intergenic
1091395130 12:149753-149775 AGAGCTAAACAGAGACCTGCAGG + Intronic
1094164094 12:27424440-27424462 ATTGTGAAACAAAGACAAACAGG + Intronic
1094731515 12:33181521-33181543 TTTGCTAAAGAAAGACAAGTGGG + Intergenic
1094790561 12:33909049-33909071 AATGGAAAACAAAGAAAAGCAGG - Intergenic
1096046893 12:48570282-48570304 AGGGCTAAACAAAGCCAAATGGG - Intergenic
1096482997 12:51955035-51955057 TGTGCTAATCAAAGACAGTCTGG + Intronic
1097641542 12:62189671-62189693 AGTGCTAAACCAAAATAACCAGG - Intronic
1098441365 12:70522800-70522822 ATAGCTAAATAAAGAAAAGCAGG - Intronic
1099805435 12:87512865-87512887 AGTGCTAAAAATAAACAAACAGG - Intergenic
1099965411 12:89440206-89440228 TGTGCTAACCAAAGATGAGCTGG - Intronic
1101353223 12:103952811-103952833 ACTGCTGAACAAAGACATGGAGG + Intronic
1103054860 12:117810761-117810783 AAAACAAAACAAAGACAAGCTGG - Intronic
1106089642 13:26578696-26578718 AGTGCCAAACAGAGACAGACAGG - Intronic
1106357482 13:28997714-28997736 AATGGAAAACAAAGAAAAGCAGG - Intronic
1107619950 13:42216805-42216827 AGTGCCAAAAAAAGCCAAGAAGG - Intronic
1109036429 13:57267519-57267541 AGTGCTAATCAAAACAAAGCTGG + Intergenic
1109579598 13:64310171-64310193 ATTGCTCAACAAAAACAATCTGG + Intergenic
1109772004 13:66987465-66987487 AGTGCAAAACAAGGTCAAACTGG - Intronic
1109865428 13:68257660-68257682 ATTGCTAAACAAAGCCCTGCGGG - Intergenic
1112202270 13:97288546-97288568 AGGTCTAAACAAAGGCCAGCGGG + Intronic
1113266257 13:108621280-108621302 AGTGCTCAACAAAGACTTCCAGG + Intronic
1113306578 13:109085673-109085695 ATCGCTAAAGAAAGACATGCTGG + Intronic
1113463645 13:110498666-110498688 AGTGCTCAACAAATACTTGCTGG + Intronic
1113928001 13:113951855-113951877 AGTGCTGAACACAGAGCAGCAGG - Intergenic
1115870779 14:37800416-37800438 ACTGTTAAACAAAGTCAACCAGG + Intronic
1116108948 14:40550601-40550623 AGTACTTAACAAAAATAAGCTGG + Intergenic
1116593504 14:46810383-46810405 TGTGCTAAACAATGAAAAACTGG - Intergenic
1117524454 14:56583606-56583628 AGTGCTAAATAGACTCAAGCAGG + Intronic
1120212922 14:81652053-81652075 AGCCCTATGCAAAGACAAGCTGG - Intergenic
1120320431 14:82952952-82952974 TGTGCTAAGAAAATACAAGCAGG + Intergenic
1121035879 14:90703238-90703260 AGTGCAGAAAAAAGACAATCTGG + Intronic
1121445279 14:93974829-93974851 AGTGCTCAACAAAGGCTTGCTGG + Intronic
1124516699 15:30372446-30372468 AGTGCTAAAAAAAAAAAAGGGGG + Intronic
1124726219 15:32158285-32158307 AGTGCTAAAAAAAAAAAAGGGGG - Intronic
1125097339 15:35870124-35870146 AGTGCCAACCAAAGACAAAAAGG - Intergenic
1128591120 15:68898359-68898381 AGTGCCAAACACACACTAGCAGG - Intronic
1128830169 15:70761895-70761917 AGTGCAAATCAAACACAACCAGG + Intronic
1140391320 16:74589617-74589639 AGTGCGAAGCAGAGGCAAGCAGG + Intronic
1140650894 16:77087177-77087199 AATGTTAAACAAAAACAAACAGG + Intergenic
1142722718 17:1787483-1787505 AGTGCTAATGAAGGACACGCTGG + Exonic
1143901745 17:10179686-10179708 AGTGCTAAAACCAGACAAACAGG + Intronic
1146576632 17:33999181-33999203 AATGGTAACCAAAGAAAAGCAGG - Intronic
1146600738 17:34213566-34213588 AATGGAAAACAAAGAAAAGCAGG - Intergenic
1146661974 17:34670862-34670884 AATGCTAAGCAAACACAAACAGG - Intergenic
1147699882 17:42387352-42387374 AGAGGGAAACAAAGACAGGCTGG - Intronic
1148143941 17:45348495-45348517 AATGCTAAGCAAAAACAATCTGG + Intergenic
1148507608 17:48140498-48140520 AGTGATAAACACAGACATGGTGG - Intronic
1149842054 17:59974048-59974070 AGTAATAAACAAAGCCAGGCCGG - Intergenic
1150624725 17:66834711-66834733 AGTGCTCAATAAATACTAGCTGG + Intergenic
1153620911 18:6976904-6976926 ATTGCTAAATAAATACAGGCTGG - Intronic
1154041947 18:10864775-10864797 AGAGCTCAAGAAAGACAAGATGG + Intronic
1154081055 18:11257421-11257443 ACTGGAGAACAAAGACAAGCAGG - Intergenic
1155147994 18:23099750-23099772 AGTGCTAAGCAAAGACAGGAAGG - Intergenic
1156934429 18:42686041-42686063 AATGCCCAACAAAGATAAGCTGG - Intergenic
1157768139 18:50318647-50318669 AGTGAAAAACAAACACATGCTGG + Intergenic
1158670545 18:59469979-59470001 AATACTAAACAAAGGCCAGCTGG + Intronic
1159366646 18:67474824-67474846 TGAGGTAAAGAAAGACAAGCAGG - Intergenic
1160215863 18:76930240-76930262 AATGCTAAAGAAAGAGAAACAGG - Intronic
1161467437 19:4439386-4439408 AGTGCTAAACACAGACACGGAGG - Intronic
1163879692 19:19907133-19907155 AGTACTAGATAAAGACAATCTGG - Intronic
1164552770 19:29225549-29225571 AGTAAGAAACAAAGACCAGCTGG - Intergenic
1164607887 19:29613101-29613123 AGGGCTGAACAATGAGAAGCTGG - Intronic
1167245622 19:48371364-48371386 TGTGCCAGACAAAGACGAGCTGG - Intronic
1167858339 19:52261287-52261309 AGTGCTAAAGACAGACAAAGAGG + Intergenic
1168271796 19:55254081-55254103 GGTGCTAAACACAGAGGAGCAGG + Intronic
925394618 2:3524233-3524255 AGTGCTCAACACAGAGAAGAAGG + Intergenic
930428720 2:51246521-51246543 AGGGCTATACAAAGGCAAGCTGG - Intergenic
931110839 2:59109857-59109879 AGTGCTATACACAGAGCAGCTGG + Intergenic
931297385 2:60941597-60941619 ATTGCTAAACAAAGACGAACTGG - Intronic
933013767 2:77097057-77097079 AATACTAATCAATGACAAGCTGG + Intronic
933269065 2:80214038-80214060 AATGGAAAACAAAAACAAGCAGG - Intronic
935976512 2:108584194-108584216 AGTGCTTAGCAAACACAGGCTGG - Intronic
936867858 2:117096865-117096887 AGTGCAAAATAAAGACAGACTGG + Intergenic
937899210 2:127004502-127004524 AGTGCTCTACAAAGTCAAACAGG - Intergenic
938781674 2:134590276-134590298 AGGGCTAGAGACAGACAAGCTGG - Intronic
940234776 2:151498331-151498353 GGTGCTATACAAAGAAAACCTGG - Exonic
941462699 2:165790306-165790328 ATTGCAAAGCAAAGACAAGTAGG - Intronic
941693488 2:168526408-168526430 AGAGCTCAAAAAAGAAAAGCTGG + Intronic
941877939 2:170454020-170454042 ACTGCTAACCAAAGTCCAGCAGG - Intronic
943210783 2:184963498-184963520 AGGGATAAACAAAGACAACAGGG - Intergenic
1168814138 20:725149-725171 GGGGCTAAAGAAAGACAGGCAGG + Intergenic
1169212526 20:3775361-3775383 AGTGTTAAACTAAGACCAGGTGG - Intergenic
1170444712 20:16414259-16414281 AATACTAAACAAATTCAAGCAGG + Intronic
1171984889 20:31653057-31653079 AATGCTACACAAAGACAACCAGG - Intergenic
1172452443 20:35036644-35036666 AGAGATAAAGTAAGACAAGCTGG + Intronic
1174006915 20:47418094-47418116 AGCATTAAACAAAGACCAGCCGG - Intergenic
1174289197 20:49495699-49495721 AGGGCTTAATAAAGACAATCAGG - Intergenic
1179318326 21:40266541-40266563 TGTGATAAACATAGACATGCAGG - Intronic
951590496 3:24259201-24259223 GTTCCTACACAAAGACAAGCTGG + Intronic
953032187 3:39186211-39186233 AGTTCTGAACAAGCACAAGCAGG - Exonic
953032221 3:39186385-39186407 ATTGCAAAACACAGAAAAGCAGG - Exonic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953516171 3:43593928-43593950 AATGGAAAACAAAAACAAGCAGG + Intronic
953539575 3:43804700-43804722 AATGGAAAACAAAAACAAGCAGG - Intergenic
954861163 3:53691963-53691985 ATTGATAAACAAAAACAAGCAGG - Intronic
955361013 3:58274991-58275013 AGTGATCAATAAAGACAAGAAGG + Intronic
956009460 3:64815131-64815153 ATTTTGAAACAAAGACAAGCAGG + Intergenic
956065322 3:65391428-65391450 AGTGCTAAACAAAGACAAGCTGG - Intronic
956937422 3:74119152-74119174 AGAACAAAACAAACACAAGCAGG - Intergenic
957211226 3:77261177-77261199 AGTGTTAAACAAAGCCAAGTAGG + Intronic
958162440 3:89834016-89834038 AATGGAAAACAAAGAAAAGCAGG + Intergenic
958649224 3:96916094-96916116 AGTCCTAAATAAAGAGAAGATGG + Intronic
958895330 3:99822769-99822791 AGTGCTCAACAAATGCAAGCTGG - Intronic
959722101 3:109503669-109503691 AATGCACAACAAAAACAAGCAGG - Intergenic
961533510 3:127555025-127555047 AGTGCTGTTCAAAGACAAGGCGG - Intergenic
961854640 3:129857512-129857534 AGTACTATACAAATACAAGGTGG - Intronic
962050510 3:131809281-131809303 AGTTATAAACCAAGACATGCAGG + Intronic
962833943 3:139170295-139170317 AATGGAAAACAAAAACAAGCAGG - Intronic
963962022 3:151320292-151320314 ATTACAAAACAAAGACAAGCAGG + Intronic
964618586 3:158697442-158697464 AGTGCTAAACAGTCACCAGCAGG - Exonic
964826052 3:160829198-160829220 TTTGCTAAACAAAAACAAGGAGG - Intronic
965913651 3:173814212-173814234 AGAGCTAACCAAAGGCAATCTGG + Intronic
966257138 3:177929959-177929981 ACTGTTAAACAAAAAGAAGCTGG + Intergenic
966487415 3:180486693-180486715 AGTGGAAAACAAACAAAAGCAGG + Intergenic
967274851 3:187764372-187764394 AATGCTAAAAAAAGACAGTCAGG + Intergenic
968374690 4:29301-29323 AGTGCTACACAAATACACACAGG - Intergenic
970845603 4:20534272-20534294 AGTGTAAAAGAAAGACAGGCTGG + Intronic
971407620 4:26336948-26336970 AACGCTAAACAAAGACCATCAGG - Intronic
972984537 4:44747815-44747837 AGTGGAAAACAAAAAAAAGCAGG - Intergenic
973300353 4:48575571-48575593 AGTGCTAAAGTCAGACACGCTGG + Intronic
973579620 4:52330106-52330128 AGTACTAAAAAAACACAAACTGG - Intergenic
974005899 4:56556950-56556972 AATGCTAAACAGAGAGAGGCCGG + Intronic
974423399 4:61708115-61708137 AGTACTAAACAAAAAGAAGACGG - Intronic
976019641 4:80605995-80606017 AATGCAAAAGAAAGGCAAGCTGG - Intronic
976981958 4:91243154-91243176 AGTGGAAAATAAAGCCAAGCTGG + Intronic
977338880 4:95731763-95731785 ACTGCTAAACCCAGACAACCCGG + Intergenic
978737847 4:112104522-112104544 AGTGATAAAAAAAGAAAAGAGGG + Intergenic
978955045 4:114602224-114602246 ATTCCTAAACAAAGACGATCTGG - Intronic
980477910 4:133344122-133344144 AGTGCTAAACAAAGAGAACATGG - Intergenic
980871641 4:138617749-138617771 AATGCTAAAGAATGATAAGCGGG + Intergenic
983240699 4:165229059-165229081 AATGCAAAACAAAGACGAGGAGG - Intronic
983316141 4:166134658-166134680 AGTACAAAGCAAAGAAAAGCAGG - Intergenic
983906243 4:173185039-173185061 AATCCTAAATAAAGACAAACAGG - Intronic
985473568 5:63918-63940 AATGGAAAACAAAAACAAGCAGG - Intergenic
985698098 5:1353379-1353401 AGGGATAAACAAAGACAACAGGG - Intergenic
985804392 5:2031588-2031610 AGAGCTAAGCTAAGACATGCTGG - Intergenic
986482182 5:8200814-8200836 AGAGCTAAACACACACAAGCTGG + Intergenic
988497720 5:31758952-31758974 AGTGGGAAACACAGCCAAGCAGG - Intronic
988722216 5:33890537-33890559 AATCCTAAACAAGGACAGGCTGG + Intronic
988834299 5:35016144-35016166 AGTGAAAAAGAAAGACACGCAGG - Intronic
988843570 5:35106544-35106566 AATGGAAAACAAAGAAAAGCAGG + Intronic
990065667 5:51711475-51711497 TGAGCTAAACAGAAACAAGCTGG - Intergenic
991720519 5:69491544-69491566 ATTGGAACACAAAGACAAGCAGG + Intergenic
992480815 5:77150957-77150979 AGGGCAAAACAGAGACCAGCAGG + Intergenic
992926209 5:81590438-81590460 AGAGCTCATCAAGGACAAGCAGG + Intronic
993124449 5:83815944-83815966 AGGGGTAAACAAGGACAACCGGG + Intergenic
993515483 5:88828537-88828559 ACTGTTAAATAAATACAAGCTGG + Intronic
993828612 5:92724974-92724996 ATTGATAAACAAAGAAAAGGGGG + Intergenic
994005379 5:94830773-94830795 ATTTCTAAACACAGACAAGATGG + Intronic
995845869 5:116493300-116493322 AGTCCTAAACAATGACAAACAGG + Intronic
996691375 5:126343897-126343919 AGTGCTATAGAAACAAAAGCAGG + Intergenic
996771173 5:127087492-127087514 AGGGCTAAATAATGACAAGAAGG - Intergenic
996898803 5:128519911-128519933 AGGGCAAAACAAAGAAAAGGGGG + Intronic
998317737 5:141199816-141199838 CGAGCAAAACAAAGAGAAGCAGG - Exonic
999139019 5:149345204-149345226 AGCGATAAACAGATACAAGCGGG - Intergenic
1000468825 5:161612933-161612955 TGTAGTAAACAAAGTCAAGCAGG - Intronic
1002512416 5:179731471-179731493 AATGCTAAAAAAAAAAAAGCAGG + Intergenic
1003247080 6:4391654-4391676 AGTGCAAAACTCAGACATGCAGG - Intergenic
1003385629 6:5665019-5665041 AGGGCAAAACAAAGACCAGTGGG + Intronic
1004881619 6:20013861-20013883 AGTGCTGAATGCAGACAAGCAGG - Intergenic
1005024739 6:21451762-21451784 AGTTATATACAAAGACAAGCTGG - Intergenic
1005688611 6:28280035-28280057 AGTGCTAAAAAGAAATAAGCTGG - Intronic
1007250432 6:40491399-40491421 AGTGCCAAAGAAAGAGTAGCCGG + Intronic
1007427068 6:41754076-41754098 AGGGCAAAGCAAAGAGAAGCAGG - Intronic
1007638493 6:43316175-43316197 AGTGCTCAACAAATACTTGCTGG + Intronic
1008988387 6:57574177-57574199 ATGGCCAATCAAAGACAAGCTGG - Intronic
1009957792 6:70476722-70476744 AGTGCTACTCAAAAATAAGCAGG - Intronic
1010028452 6:71246093-71246115 AGTGCTAAGCAGAGAAAGGCGGG - Intergenic
1011774565 6:90715189-90715211 AGTTATAAACATAGAGAAGCTGG + Intergenic
1012469811 6:99558545-99558567 ATTCCTAAAGAAAGAAAAGCAGG + Exonic
1012793451 6:103730831-103730853 AATGTTAAACACAGAAAAGCTGG - Intergenic
1013489972 6:110636748-110636770 AGTGCTAAAGAAAAACAAGATGG + Intronic
1014675652 6:124361481-124361503 AGGGTTAAATAAAGACAAGTTGG - Intronic
1016494258 6:144641979-144642001 AGTTCTAGTCAAAGACAAACAGG - Intronic
1018687766 6:166317118-166317140 AGGGCTAAGAAAAGAGAAGCTGG + Intergenic
1020969443 7:14916468-14916490 AATGCTAATCAAAGTAAAGCTGG + Intronic
1021186307 7:17569358-17569380 AGTGCAAAACAAAAAAAGGCAGG - Intergenic
1021994502 7:26166655-26166677 AGTGCTCAATCAACACAAGCTGG + Intronic
1022212518 7:28225433-28225455 GCTGCTAAATAAAGACAAGCAGG - Intergenic
1025135707 7:56410468-56410490 TGTGCTAAGAAAAGACAGGCTGG + Intergenic
1026135947 7:67660886-67660908 TGTGCCAAACAAAGCCAGGCTGG + Intergenic
1032024742 7:128432069-128432091 AGTCCTAATTAGAGACAAGCTGG + Intergenic
1033092058 7:138394708-138394730 AGCGCCAAACAAAGACAATCAGG - Intergenic
1034371295 7:150599393-150599415 AATGCAAAACAAAAACAGGCAGG + Intergenic
1035496355 7:159330568-159330590 GGTGCTGAGCAGAGACAAGCAGG - Intergenic
1036394647 8:8358869-8358891 AGTGCTAAACAAAGGAAAAGAGG + Intronic
1037181607 8:16013377-16013399 GGTGGTCAACAAAGAGAAGCTGG + Intergenic
1037385851 8:18340404-18340426 AGTGGTAACCAAAGGAAAGCAGG + Intergenic
1037525842 8:19723304-19723326 CGTGCTAACGAAAGACAAGTGGG + Intronic
1041828535 8:62125875-62125897 AGTGCTAATCAAACAAATGCTGG + Intergenic
1041871498 8:62639683-62639705 AGTGATAAAAATAGACAAGTTGG + Intronic
1044427727 8:92072569-92072591 TGTGTTGAACACAGACAAGCAGG - Intronic
1044784144 8:95777034-95777056 TCTGCAAGACAAAGACAAGCAGG - Intergenic
1046373759 8:113348378-113348400 TGTACCAAACAAAGACAACCTGG + Intronic
1048607687 8:135986474-135986496 AGTGCTCAACAAAGACTAACAGG - Intergenic
1049900371 9:156524-156546 AATGCTAAACAAAAAAAAGTTGG + Exonic
1050049735 9:1587212-1587234 AATGGAAAACAAAGAAAAGCAGG - Intergenic
1050421994 9:5475642-5475664 AATGGAAAACAAAGAAAAGCAGG - Intergenic
1050740676 9:8816173-8816195 AATGTCAAACAAAGATAAGCAGG + Intronic
1052307846 9:27031155-27031177 ATTCCTTAACAAAAACAAGCTGG - Intronic
1053041858 9:34880524-34880546 AGTGGAAAACAAAAAAAAGCAGG + Intergenic
1053362577 9:37499827-37499849 AGAACTAAGCAAATACAAGCTGG - Intronic
1054411551 9:64819903-64819925 GATGCTAAATAAAGAAAAGCTGG - Intergenic
1055557948 9:77494551-77494573 AGTGTTAAACAAAGTCAAACTGG - Intronic
1057026918 9:91740999-91741021 GGTGCTAAATAAAGACAACTCGG + Intronic
1057931064 9:99193510-99193532 AATGAAAAACAAATACAAGCTGG + Intergenic
1058376509 9:104328264-104328286 AGTGCTTAACAGGGACAATCAGG + Intergenic
1058738571 9:107919865-107919887 AGAGCTAAGCAAAGACAAGAGGG - Intergenic
1060814803 9:126629330-126629352 AGTGCTAAACAAGCATCAGCTGG - Intronic
1203574530 Un_KI270744v1:164850-164872 AGTGCTACACAAATACACACAGG + Intergenic
1186866060 X:13721999-13722021 AGTGGATAACAAAGACGAGCTGG + Intronic
1187376273 X:18757886-18757908 TATGCAAAACAAAGACAAGATGG - Intronic
1189386849 X:40544121-40544143 AGAGCTAATCAAAGCAAAGCGGG + Intergenic
1192064609 X:67868483-67868505 AGTGGAAAACAAAGAAAAGTAGG - Intergenic
1199557217 X:149122557-149122579 ACTACTACACAGAGACAAGCTGG - Intergenic
1200782538 Y:7229645-7229667 AGTGAAAAACAAACAGAAGCTGG - Intergenic
1201787550 Y:17802335-17802357 ATTGGGTAACAAAGACAAGCAGG + Intergenic
1201814003 Y:18103653-18103675 ATTGGGTAACAAAGACAAGCAGG - Intergenic