ID: 956066535

View in Genome Browser
Species Human (GRCh38)
Location 3:65402610-65402632
Sequence TAGGAATCACTTTGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956066535_956066539 5 Left 956066535 3:65402610-65402632 CCTGTTTTTCAAAGTGATTCCTA 0: 1
1: 0
2: 3
3: 22
4: 295
Right 956066539 3:65402638-65402660 TGTGACGATCTCAACTCTTTTGG 0: 1
1: 0
2: 1
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956066535 Original CRISPR TAGGAATCACTTTGAAAAAC AGG (reversed) Intronic
905520838 1:38598351-38598373 GCGCAATCACTTTGGAAAACTGG + Intergenic
906989136 1:50719046-50719068 TAGCAATCAGTTTGAAAATCTGG + Intronic
907792617 1:57682228-57682250 TAAGAAGCACTTTAAAAAAATGG + Intronic
908247931 1:62242733-62242755 TGGGAATGTCTTTGGAAAACTGG - Intronic
908301953 1:62770893-62770915 TAACAATCAGATTGAAAAACGGG - Intergenic
908929615 1:69303258-69303280 TAAGAACCCCTTAGAAAAACTGG + Intergenic
909097829 1:71311462-71311484 TAAGCATCACTTTGAAAATATGG + Intergenic
909127499 1:71692591-71692613 TAGGAATAGCTTTAAAAAACTGG + Intronic
909250864 1:73354316-73354338 TGAGAATCATTTTGAAATACAGG + Intergenic
909389431 1:75101912-75101934 TAGGACCCACTCTGATAAACAGG - Intergenic
910052797 1:82995503-82995525 TATGAATCAGTTTGAAAAAATGG - Intergenic
911997639 1:104787555-104787577 TAATAATCACTTTTAAAAAATGG + Intergenic
914267053 1:146047135-146047157 TAAGCATCAATTAGAAAAACTGG + Intergenic
914948073 1:152084638-152084660 AATGAATCAGTTGGAAAAACTGG + Exonic
915065017 1:153217805-153217827 TACGAATCCTTTTGAAAATCAGG - Intronic
916482349 1:165225968-165225990 CAGGAATCACTCTGAAGAGCTGG - Intronic
917899490 1:179528152-179528174 TAGCAAACGCTGTGAAAAACTGG - Intronic
919597045 1:199577310-199577332 AGAGAATCAATTTGAAAAACAGG - Intergenic
922150781 1:223002228-223002250 TAGGAATCAGTTTGAATACAGGG - Intronic
922651555 1:227343991-227344013 TAAAAATCACTTCTAAAAACCGG - Intergenic
1064594007 10:16924627-16924649 TAGGCATCACTTCAAAAAAAGGG - Intronic
1064924479 10:20555236-20555258 TAGGAATCAGTTGGAAATAGAGG - Intergenic
1065469417 10:26061947-26061969 TAAGAATCGCTTTGAAAATAGGG + Intronic
1066045341 10:31589667-31589689 TAGAAATTTCATTGAAAAACTGG + Intergenic
1066054402 10:31666990-31667012 TGGGAAAGACTTTGGAAAACTGG + Intergenic
1066431425 10:35355368-35355390 TAGGAAACACTTTTAAAAACAGG + Intronic
1067010673 10:42710144-42710166 TAGGCATCACTTCCAAAAAACGG - Intergenic
1067230776 10:44407783-44407805 AAGCATTCCCTTTGAAAAACTGG - Intergenic
1067312835 10:45131054-45131076 TAGGCATCACTTCCAAAAAACGG + Intergenic
1072112955 10:92340981-92341003 TAAGATTCACTATGAAAAAAGGG - Intronic
1074805062 10:117041186-117041208 AAGAAATCACTTAGAGAAACAGG - Intronic
1074926058 10:118072904-118072926 TAAAAATCATTTTGAAAAATTGG + Intergenic
1075157026 10:119986567-119986589 TAGGATTCACTTGGCAATACGGG + Intergenic
1078112250 11:8405581-8405603 CAGAAAGCACTTTTAAAAACTGG - Intronic
1078827558 11:14944536-14944558 TAAAATTCACTTGGAAAAACAGG - Intronic
1081410615 11:42753462-42753484 AAGTATTCCCTTTGAAAAACCGG - Intergenic
1082298757 11:50478278-50478300 AAGGAAACTCTCTGAAAAACTGG - Intergenic
1083037433 11:59652569-59652591 GTAGAATTACTTTGAAAAACTGG - Exonic
1083700488 11:64474281-64474303 TTGGAATCACTTTGGAAAACTGG - Intergenic
1085582212 11:77663089-77663111 GAGGCATCACCTTGAATAACGGG + Exonic
1086313887 11:85568835-85568857 TGTTGATCACTTTGAAAAACTGG + Intronic
1087709538 11:101533048-101533070 GAGGAAGCACTTAGAAAAATGGG + Intronic
1088477437 11:110257678-110257700 AAGAAACTACTTTGAAAAACAGG + Intronic
1089138078 11:116265344-116265366 TAAGAATCACTCTGAACACCTGG + Intergenic
1091477809 12:794333-794355 TGGTAGTCACCTTGAAAAACAGG - Intronic
1092623014 12:10294326-10294348 GAGGATGCACTTTGACAAACTGG - Intergenic
1092841328 12:12544537-12544559 TTGGAATAACTGTGGAAAACTGG - Intronic
1093552158 12:20426519-20426541 TAGGAAAGACTTGGACAAACTGG + Intronic
1094244016 12:28266069-28266091 TAGGCGTCATTTTTAAAAACTGG - Intronic
1094390215 12:29940740-29940762 AATTAATCACTTAGAAAAACTGG - Intergenic
1094797151 12:33988152-33988174 TAAGAAGCACTTTGAGAAGCAGG + Intergenic
1095392976 12:41730531-41730553 GAGCAATCACTTTGGAAAATTGG + Intergenic
1095465592 12:42484528-42484550 TAGGAATCACTCCGAAATGCAGG - Intronic
1097789219 12:63796442-63796464 TTGTAATCATATTGAAAAACAGG - Intronic
1097893471 12:64801426-64801448 TAATCATCACTTTGACAAACAGG + Intronic
1098217997 12:68240119-68240141 TATGAATCACATTCACAAACAGG - Intergenic
1099291042 12:80776885-80776907 AATGAAACACCTTGAAAAACTGG - Intergenic
1099699514 12:86065625-86065647 AAGCATTCCCTTTGAAAAACGGG + Intronic
1100064727 12:90628324-90628346 TATGAATCACTTTAAATAACAGG + Intergenic
1100245801 12:92755729-92755751 CAGGAATCATTTAGAAACACTGG - Intronic
1100330391 12:93576128-93576150 AAATAAACACTTTGAAAAACAGG - Exonic
1102700626 12:114835939-114835961 GTGCAATCAGTTTGAAAAACAGG + Intergenic
1103091305 12:118100061-118100083 GAGCAATCACTTTAAAAAGCAGG + Intronic
1105354129 13:19642974-19642996 AAGCAATCACTTAGTAAAACAGG + Intronic
1105790450 13:23793022-23793044 TGATGATCACTTTGAAAAACTGG + Intronic
1106583006 13:31033760-31033782 TAGGAGTCACTGTGAGAAGCAGG - Intergenic
1108082856 13:46755318-46755340 CATGTATCACTTTGATAAACAGG - Intergenic
1108508088 13:51131303-51131325 TAGGACACAATTGGAAAAACTGG + Intergenic
1108780388 13:53823728-53823750 CAGAAATCTCTTTGAAACACTGG + Intergenic
1109439211 13:62347074-62347096 TAAAAATGATTTTGAAAAACTGG + Intergenic
1109468193 13:62767039-62767061 TTGGAATCACTTAGAAAACTTGG - Intergenic
1109671129 13:65609642-65609664 TAGGAAGTGCTTTGAATAACAGG + Intergenic
1109801250 13:67381180-67381202 GAGGAATGACTTTGAATAAATGG - Intergenic
1109842313 13:67935347-67935369 TAGTAATCATTATGAAAGACAGG + Intergenic
1111578953 13:90197727-90197749 TTGCAACCACTTTGAAAATCAGG + Intergenic
1111799872 13:92968400-92968422 TGGGAAACACTTAGAAATACTGG + Intergenic
1112052270 13:95654839-95654861 GTGCAACCACTTTGAAAAACTGG - Intergenic
1115044801 14:28978401-28978423 TTGGAATCACTTTTTAAAGCAGG - Intergenic
1115070040 14:29310591-29310613 AAGGTATCATTTTGAAAAGCTGG + Intergenic
1116153248 14:41169048-41169070 TATGAATCATTAGGAAAAACAGG - Intergenic
1116367169 14:44082079-44082101 TGGGCATCACTTTTAAATACTGG + Intergenic
1117767300 14:59096330-59096352 CAGCAATCACAATGAAAAACAGG - Intergenic
1117939383 14:60945451-60945473 TAGGAATCACTTTACAATATGGG + Intronic
1118611466 14:67543797-67543819 TATGAATCACCTGGAAATACTGG + Intronic
1121062626 14:90929487-90929509 TAAGAATTACCTTTAAAAACTGG - Intronic
1122397277 14:101442300-101442322 TGGGCATAACTTTGAAAATCAGG - Intergenic
1125053818 15:35334363-35334385 AAGAAATGACTTTGAAAAACTGG - Intronic
1125338414 15:38651202-38651224 TAGGAATGAGTTTTAAAATCTGG - Intergenic
1126602915 15:50447105-50447127 TATAAATAACTTAGAAAAACTGG - Intronic
1126905831 15:53363782-53363804 AAAAAATTACTTTGAAAAACTGG + Intergenic
1127788796 15:62380070-62380092 GAGGAAGCAGTTTGAAAACCAGG + Intergenic
1129633912 15:77293837-77293859 TATGTATGACTTTAAAAAACAGG + Intronic
1130900469 15:88203133-88203155 TAGCAATCACTGTGGGAAACTGG - Intronic
1131686741 15:94776196-94776218 TAGAAATCACTTTGCTAAATAGG + Intergenic
1134394721 16:13852431-13852453 CAGGAAGGACTTGGAAAAACAGG + Intergenic
1135682811 16:24472819-24472841 TAGGAATCAAGTTGATAACCAGG - Intergenic
1135692771 16:24556791-24556813 TTGTAATCATTTTGAGAAACAGG + Intronic
1137327876 16:47460513-47460535 CAGGAAGCACTTTGGAAAACAGG + Intronic
1137459237 16:48644165-48644187 TAGGAATCAATTTAACCAACAGG - Intergenic
1140221822 16:73049035-73049057 CAGCAATCACTTTGACCAACTGG - Intronic
1140666473 16:77232807-77232829 GTGCAAACACTTTGAAAAACGGG + Intergenic
1141314857 16:82952152-82952174 CAGGATTCACTTTGAAGAACTGG + Intronic
1141853229 16:86662363-86662385 AACGAATCACTCTGCAAAACTGG + Intergenic
1146206628 17:30910444-30910466 GTTGAATCACTTTGAAAAGCTGG + Intronic
1149014578 17:51892862-51892884 TATGAATAACATTGAACAACTGG + Intronic
1149472655 17:56931272-56931294 TAGGAACCCCTTGGAAAAACTGG + Intergenic
1149573157 17:57690052-57690074 TTGCAGTCACTTTGGAAAACAGG - Intergenic
1149937611 17:60824561-60824583 TAGGATTCACTCTGAGAAGCAGG - Intronic
1151172944 17:72263351-72263373 TAGGTATCAGTGGGAAAAACAGG + Intergenic
1153550191 18:6254392-6254414 AAGGTGTCACTTTGAAAAAGCGG - Intronic
1155837055 18:30599024-30599046 AAGAAATTACTTTGGAAAACAGG + Intergenic
1156965052 18:43081104-43081126 TATCAATGACTTAGAAAAACTGG - Intronic
1157484787 18:48079374-48079396 TAGGTAACACTTTAAAAAATTGG - Intronic
1158295485 18:55992466-55992488 TATCACTCACTTTGAAAATCTGG + Intergenic
1158447762 18:57536036-57536058 TAGGAATCATTTGGAAAATGGGG - Intergenic
1158669735 18:59464018-59464040 CAGGAATCTCACTGAAAAACAGG - Intronic
1159719807 18:71874385-71874407 ATGGAATCAATTTGAAAAACTGG + Intergenic
1164317324 19:24103389-24103411 TATGAATCGCTTTGTAAAATTGG - Intronic
1165561657 19:36685651-36685673 GAGAAATCACTTTACAAAACAGG + Intergenic
1166020441 19:40024109-40024131 CCAGAATTACTTTGAAAAACTGG - Intergenic
1166249118 19:41553839-41553861 CAGGACACAATTTGAAAAACTGG - Intronic
926468352 2:13219863-13219885 TATGAATAACTTTCAAAAATTGG - Intergenic
929342064 2:40831996-40832018 TGGGAATGATTTAGAAAAACAGG + Intergenic
929496409 2:42448245-42448267 CTGGAATCATTTTGCAAAACTGG - Intronic
929524512 2:42688089-42688111 CAGGATTCAGTTAGAAAAACAGG + Intronic
930347566 2:50203494-50203516 TAGGCATTACTTTGGACAACAGG + Intronic
930396724 2:50830771-50830793 TACAATTAACTTTGAAAAACTGG + Intronic
930516845 2:52419194-52419216 TAGGAATCACAGGGGAAAACAGG + Intergenic
930981402 2:57530032-57530054 AAGCATTCCCTTTGAAAAACTGG + Intergenic
932623487 2:73280979-73281001 CAAGAATCACCTTGAATAACAGG + Intronic
933238440 2:79891667-79891689 TCAGAATCACTTTCAAAATCTGG + Intronic
934489749 2:94754068-94754090 TAAAAATCATTTTCAAAAACAGG + Intergenic
935255001 2:101302253-101302275 AATGAATCAATCTGAAAAACTGG + Intronic
935803509 2:106723732-106723754 TAGGGCTCACTATGAAAAACTGG + Intergenic
935870424 2:107442224-107442246 TAGGATAAACTTTTAAAAACTGG - Intergenic
937350993 2:121161641-121161663 CAGAATTCACTTTAAAAAACTGG - Intergenic
937643868 2:124244244-124244266 TTGGAATCATTTAGAAACACAGG - Intronic
939793541 2:146611754-146611776 TAGGAATCAATTTAACAAAAGGG - Intergenic
941345087 2:164358568-164358590 TAGGAATCATTTTTAAAAGTTGG - Intergenic
941648822 2:168070830-168070852 TAGCCATCACATTGAAAAATTGG - Intronic
941716314 2:168767388-168767410 AATTAATCACTTTGTAAAACTGG + Intronic
943712695 2:191115220-191115242 CAGGAATCACCTTGACAAATGGG - Intronic
943768006 2:191683196-191683218 CAGGAAGCACTTGGATAAACTGG + Intronic
943967638 2:194357649-194357671 CAGGAATCTCTTTGATATACTGG - Intergenic
945603727 2:211900150-211900172 TAGGAATCACTTTAAAGTTCAGG - Intronic
947126815 2:226877806-226877828 TAGGAATATCTTTGACAAAGCGG - Intronic
947220778 2:227790394-227790416 AGGGAATTACTTTGAGAAACTGG - Intergenic
947653428 2:231806841-231806863 TAGGAACCAATTCAAAAAACTGG + Intronic
1169101676 20:2955627-2955649 GAGAAATCAGCTTGAAAAACTGG - Intronic
1169505656 20:6208609-6208631 TAGGAAGTACCTTGAAAGACTGG + Intergenic
1170261501 20:14413428-14413450 TAGGAAGCACAATGACAAACAGG - Intronic
1171885646 20:30650317-30650339 TATGATTTACTTTGAAAAAGAGG + Intergenic
1171945057 20:31368987-31369009 CAGGAATCATTTTCAAAAGCTGG - Intronic
1173949847 20:46982629-46982651 CAGGAATAAGGTTGAAAAACAGG - Intronic
1176701159 21:10052144-10052166 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1177708758 21:24742771-24742793 AAGGAAACATTTTGAGAAACTGG + Intergenic
1178729741 21:35090319-35090341 TAGGAATAACTCAGAAAAACTGG - Intronic
1180883279 22:19221754-19221776 TAGAAATCAGTTTGGAAACCAGG - Intronic
1182757028 22:32688639-32688661 AAAAAATCTCTTTGAAAAACTGG - Intronic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
1183531468 22:38356232-38356254 TAGGAAACATTTTTAAAAGCCGG - Intronic
1185253695 22:49819751-49819773 AAATAAACACTTTGAAAAACAGG - Intronic
949207261 3:1455059-1455081 TGGCAATCACTTTGAAAAGTGGG - Intergenic
949472832 3:4414590-4414612 AAGGAACCAATTTGACAAACAGG - Intronic
949862739 3:8521386-8521408 TTGGGGTCACTTTGAAAAAGAGG - Intronic
950773983 3:15333934-15333956 TAGGGGTCACTTTGGAACACAGG + Intronic
951365224 3:21773324-21773346 TAGGTTTCTCTTTTAAAAACAGG + Intronic
951597226 3:24331508-24331530 TAAGAATCACCTGGAAAAAGAGG - Intronic
952115589 3:30176971-30176993 GAGGAATCTCTTTGAAAAGATGG + Intergenic
952144169 3:30513612-30513634 TAGGAATCACTTTGATTTAAGGG - Intergenic
952989636 3:38820617-38820639 TAGGTATCACCATGAATAACTGG - Intergenic
953259823 3:41326980-41327002 TAGGAATAACTATATAAAACAGG + Intronic
953922563 3:46962549-46962571 TAGAAATCAATAGGAAAAACAGG + Intronic
955236608 3:57144881-57144903 AAGGAGTCATTTTTAAAAACAGG + Intronic
955701838 3:61689232-61689254 TAGGAATCACTCTCCAAAACAGG - Intronic
955769648 3:62374413-62374435 TATGAATCACTTCGGAAAATTGG - Intergenic
956066535 3:65402610-65402632 TAGGAATCACTTTGAAAAACAGG - Intronic
956290922 3:67658752-67658774 TAGGAATCTCTTTGAGAACAGGG + Intergenic
956295468 3:67707921-67707943 TAGCAATCACTGTCAAAAAGTGG - Intergenic
956869585 3:73403534-73403556 TAGAAATCACTTTGAGCATCAGG + Intronic
957551150 3:81706451-81706473 TAGGAAAAACTTGGTAAAACTGG + Intronic
960857796 3:122120858-122120880 GAGAAATGACTTTGAAAACCTGG + Exonic
962434565 3:135353608-135353630 TAGGAATAACTCTAAAAAAGAGG + Intergenic
962493126 3:135913129-135913151 TATTGATCACTTTGATAAACCGG + Intergenic
962783380 3:138743046-138743068 TGTGAATTACTTTGTAAAACTGG - Intronic
963300309 3:143590153-143590175 TAGTCACCACTTGGAAAAACAGG - Intronic
965275790 3:166680190-166680212 TAGGAAACAAAATGAAAAACAGG - Intergenic
967720279 3:192808875-192808897 TAGTTATCTCTTTGTAAAACTGG - Intronic
970037759 4:11757833-11757855 TAGGTATCACTTTGAAAGGTGGG + Intergenic
970303147 4:14702775-14702797 GGAGAATCACTTTGACAAACAGG - Intergenic
970493430 4:16599898-16599920 TAGAAATGAATTTGAAAGACAGG - Intronic
970886594 4:20993493-20993515 AATGAATCACTTTGACAAAAGGG + Intronic
971579831 4:28322071-28322093 TAGGAATTACTTTTTGAAACTGG + Intergenic
971777531 4:30986043-30986065 TAAGAATCACCTTGAAAAGCAGG + Intronic
972065491 4:34938650-34938672 TTTGAATCACTTTGAAAATTGGG + Intergenic
972126541 4:35773866-35773888 GAGGAAGCACATTGAAAATCCGG + Intergenic
973196020 4:47442939-47442961 TAAAAATTACTTTTAAAAACAGG + Intergenic
973306022 4:48651072-48651094 AAGGAATCACATTGAACTACAGG - Intronic
976094244 4:81490457-81490479 TGGCAATCACTTTGAACATCAGG + Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
978482084 4:109204423-109204445 TAGGAATAATTTGGAAAAAATGG + Intronic
978495071 4:109350246-109350268 TTGCAACCACTTTGAAAAACTGG - Intergenic
979725946 4:123960966-123960988 TAGAAATCAATTTAAGAAACTGG - Intergenic
979889897 4:126077987-126078009 TAGAAATCTCTTTGCAGAACTGG + Intergenic
980390695 4:132142522-132142544 TTGGTACCACTTAGAAAAACTGG + Intergenic
981810066 4:148763805-148763827 AAGCATTCCCTTTGAAAAACTGG + Intergenic
982565877 4:156986162-156986184 GGTAAATCACTTTGAAAAACTGG - Intergenic
983321430 4:166201122-166201144 TAGGACACAATTGGAAAAACTGG + Intergenic
983745651 4:171196029-171196051 GAGGAATCAATTTGTAACACAGG - Intergenic
983974849 4:173921511-173921533 TATCAATCACTTTAAATAACAGG + Intergenic
984719395 4:182955843-182955865 AAGGAATAAGTTTGAAAAATGGG + Intergenic
987789666 5:22548866-22548888 TAGGAAGCACTATGAGAAAGGGG - Intronic
988570587 5:32361119-32361141 CAGCAGTCACTTTGAAAAACAGG - Intronic
988585679 5:32505553-32505575 TAGGTATCATTTTCCAAAACAGG - Intergenic
988811818 5:34792539-34792561 TAGGAATGATCTTGAAAAGCAGG - Intronic
988824357 5:34919552-34919574 TAGGAATCCTTTTCAAAAATGGG - Intronic
990061326 5:51652789-51652811 TATCAATTACTTTGAAATACAGG + Intergenic
992648301 5:78832773-78832795 ATGGAATCACTTTGAAGAGCTGG + Intronic
993507245 5:88724707-88724729 TATGAATCCTTTTGAAATACAGG - Intronic
994007606 5:94857998-94858020 TTTGAATTACTTAGAAAAACTGG - Intronic
994768316 5:103950753-103950775 TAAGAATTACTTCAAAAAACAGG - Intergenic
994782056 5:104102583-104102605 TATCAGTCACTTTCAAAAACAGG + Intergenic
994957239 5:106547681-106547703 TATGAATGATTTTGAATAACAGG - Intergenic
995175889 5:109176168-109176190 TAGGTATCCCTTTGATATACTGG - Intronic
996057146 5:118994008-118994030 AAGCATTCCCTTTGAAAAACTGG - Intergenic
997776729 5:136615571-136615593 GAGAAATCACTTTAAAAAGCAGG + Intergenic
998288900 5:140893216-140893238 CAGGTATCACTTTGACATACTGG + Intronic
999678554 5:154032374-154032396 TAAGAAGGGCTTTGAAAAACTGG - Intronic
1001038175 5:168313209-168313231 TAGGAATCACACAGACAAACAGG - Intronic
1002438764 5:179252682-179252704 TAGGAAACACTTGTAACAACTGG - Intronic
1002957528 6:1881682-1881704 GAGGAGTCCCATTGAAAAACTGG - Intronic
1003313537 6:4990308-4990330 TAGGACTCAATTTGATAAACTGG + Intergenic
1003788264 6:9512702-9512724 TAGGATTGACTTGGCAAAACTGG + Intergenic
1004059863 6:12183199-12183221 TTGTAATCCTTTTGAAAAACAGG + Intergenic
1004887354 6:20063924-20063946 TATGAATCACTAAGCAAAACGGG + Intergenic
1006644913 6:35509352-35509374 TTGGAAGCACTTTGCAAACCAGG - Intronic
1007952975 6:45888569-45888591 GAGGGATCATTTTCAAAAACAGG - Intergenic
1009042827 6:58200928-58200950 TTGGAATCACTTAGGAGAACTGG + Intergenic
1009218660 6:60955164-60955186 TTGGAATCACTTAGGAGAACTGG + Intergenic
1009820619 6:68796494-68796516 CAGAAATCACTTCGAAAGACTGG - Intronic
1010578446 6:77563855-77563877 TAGGAGACACTTTGAAGAAAAGG - Intergenic
1010601471 6:77833229-77833251 TAATAATAACTTTGAAAAAGTGG + Intronic
1010835322 6:80580057-80580079 TAGGAGTTACTTTGAAAATCAGG - Intergenic
1011305721 6:85924157-85924179 ATGCAACCACTTTGAAAAACTGG - Intergenic
1011362162 6:86539125-86539147 TAGGAATGAGCTTGAAAAATTGG + Intergenic
1012060976 6:94480259-94480281 TAGGAATCACTTTTCAACACAGG + Intergenic
1012722344 6:102761311-102761333 TAGGAATTACTTTTAAAATCAGG - Intergenic
1015079869 6:129210731-129210753 TAGGATTTTGTTTGAAAAACAGG - Intronic
1015389203 6:132662316-132662338 TAAGAATAACATTTAAAAACAGG - Intergenic
1016135861 6:140541761-140541783 TAAGAATTAGTTTAAAAAACTGG + Intergenic
1016188667 6:141232100-141232122 TTGGTAGCAATTTGAAAAACTGG - Intergenic
1020759441 7:12250134-12250156 TAGGAAAGACTTGGAAAAAGTGG - Intergenic
1022693809 7:32684772-32684794 AAGCATTCCCTTTGAAAAACTGG - Intergenic
1022696573 7:32712059-32712081 AAGCATTCCCTTTGAAAAACTGG + Intergenic
1023921039 7:44630190-44630212 TTGGCCTCACTTTGAAAAATAGG + Intronic
1025806878 7:64841691-64841713 TAGCAATCACGTAGAAAAAAGGG - Intergenic
1026702930 7:72663460-72663482 TAAAAATCACTTTCAAAAGCCGG + Intronic
1027631854 7:80616518-80616540 GAGAAATCACTTTAAAATACTGG - Intronic
1028580514 7:92404640-92404662 CAGCATCCACTTTGAAAAACAGG + Intergenic
1028680637 7:93526109-93526131 CATGAATCACTTTGAAATAGTGG - Intronic
1028975608 7:96909971-96909993 TAGGATTTACTTTGAAATAAGGG - Intergenic
1029908180 7:104114141-104114163 TAAAAATCACTTTCCAAAACTGG - Intergenic
1031357799 7:120809421-120809443 TAGGAAGCACTTAAATAAACAGG + Intronic
1033892117 7:146026194-146026216 TATGAATCACTTTTAGAAATAGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036483756 8:9161385-9161407 TATGAATTATATTGAAAAACTGG + Intronic
1036837566 8:12088477-12088499 GTGGAAGCAGTTTGAAAAACAGG - Intergenic
1036859360 8:12334725-12334747 GTGGAAGCAGTTTGAAAAACAGG - Intergenic
1037302733 8:17469794-17469816 TAGCAATCACTTTGGACAAAAGG - Intergenic
1038474229 8:27852710-27852732 TAAAAATCAATTTAAAAAACAGG - Intergenic
1038951063 8:32415120-32415142 CAGGTTTCACTTTTAAAAACAGG + Intronic
1039248686 8:35637123-35637145 TAGGAACCACTTTAGGAAACTGG - Intronic
1039562496 8:38523946-38523968 TAAAAATCATTTTTAAAAACAGG - Intronic
1039613903 8:38939770-38939792 TTAGAATGACATTGAAAAACTGG - Intronic
1039728240 8:40245386-40245408 CAGGTATCACTTTGATATACTGG - Intergenic
1040847337 8:51857571-51857593 AGGGAATTCCTTTGAAAAACAGG - Intronic
1042856171 8:73270299-73270321 TAGACCTGACTTTGAAAAACTGG - Intergenic
1043158551 8:76817049-76817071 TAGGAAACACTTTAAAAAAAAGG + Intronic
1043248983 8:78045481-78045503 AAAGAATCATTTTTAAAAACTGG + Intergenic
1044291530 8:90476704-90476726 TATGTATAACTTTGAAAAGCAGG - Intergenic
1045382136 8:101637529-101637551 TAGAAAGCACTTTGAAGATCTGG - Intronic
1046393793 8:113612166-113612188 AAGCATTCCCTTTGAAAAACTGG + Intronic
1049106522 8:140617110-140617132 AAGGAAGCACTCTGAAAAAGAGG + Intronic
1049957789 9:709509-709531 CAGATAACACTTTGAAAAACAGG + Intronic
1051084404 9:13331390-13331412 CATGCATCACTTTGAATAACTGG + Intergenic
1051127166 9:13817532-13817554 TAGGCATTACTATAAAAAACAGG + Intergenic
1051757647 9:20421462-20421484 TAGTATTCACTTTGAGAAACTGG + Intronic
1051890470 9:21937437-21937459 TCACAATCACTTTTAAAAACTGG - Intronic
1052223970 9:26061579-26061601 TAGGAATATCTTGGAAAAATTGG - Intergenic
1052323494 9:27193070-27193092 CATGAATTACTTTGAAAAATTGG - Intronic
1052679712 9:31673694-31673716 TAGCAAAAACTTTGAGAAACTGG - Intergenic
1053638302 9:40038643-40038665 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1053767782 9:41426577-41426599 TAGGAAGCATTGTGAAAAAATGG + Intergenic
1054319095 9:63635242-63635264 TAGGAAACATTGTGAAAAAATGG - Intergenic
1054546448 9:66338081-66338103 TAGGAAGCATTGTGAAAAAATGG + Intergenic
1056089971 9:83195855-83195877 TAGGAATCACTTTGATTGTCAGG + Intergenic
1056388474 9:86118648-86118670 TAGAAATCATTTAGAAAAATGGG + Intergenic
1056794217 9:89646472-89646494 TAGGAGGCTCTTTGAAAAATAGG + Intergenic
1057161634 9:92892927-92892949 TATGATTCATTTTGAAAAAGAGG + Intergenic
1057471818 9:95364206-95364228 TAAAATTCACTTTAAAAAACGGG - Intergenic
1057678018 9:97151132-97151154 TAAGATTCATTTTGAAAAAGAGG + Intergenic
1058333805 9:103800203-103800225 TAAGGAACCCTTTGAAAAACTGG + Intergenic
1059813646 9:117886228-117886250 TAAGAAGGACTTTGAAAAATGGG + Intergenic
1061221888 9:129256967-129256989 CGGGAATCACTTTGAAAAACAGG + Intergenic
1202786175 9_KI270719v1_random:22199-22221 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1186032334 X:5381805-5381827 AAGGATTCATTTTTAAAAACCGG + Intergenic
1186688335 X:11948693-11948715 TAGGATTTTCTTTGAAAAAAAGG + Intergenic
1187194492 X:17069811-17069833 TAGTCATCACTTACAAAAACAGG - Intronic
1189226501 X:39417815-39417837 GTAGAATCACTTTGGAAAACTGG - Intergenic
1189753666 X:44249097-44249119 TTAGAATGACTTTGAAAAATAGG - Intronic
1190787261 X:53663653-53663675 TAAGAATCCCTTTGAAAATTGGG + Intronic
1191010947 X:55758280-55758302 CAGGAAACACTTTGAAAAGCTGG + Exonic
1191843894 X:65532212-65532234 TATGAGTCACTTTGTAAATCAGG - Intronic
1192829219 X:74732714-74732736 TAGCAAATACTTTGAAATACTGG + Intergenic
1196520506 X:116665528-116665550 TAGGATGCAATTGGAAAAACTGG - Intergenic
1197116960 X:122844791-122844813 CAGGAAACACTTTATAAAACAGG - Intergenic
1197901331 X:131376368-131376390 AATTAATCACTTTGAATAACAGG + Intronic
1198375611 X:136036093-136036115 TTGCAATCACTCTGGAAAACTGG - Intronic
1198852987 X:140985747-140985769 TAGGAATCATTTTGAAACTAAGG - Intergenic
1199230225 X:145428550-145428572 TTGAATTCACTTTGATAAACTGG + Intergenic
1200869993 Y:8087614-8087636 TTGGTATCACTATGAAACACAGG + Intergenic