ID: 956067465

View in Genome Browser
Species Human (GRCh38)
Location 3:65412189-65412211
Sequence AGGAGGCAGTTCCGCAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956067465_956067467 -10 Left 956067465 3:65412189-65412211 CCTCCACTGCGGAACTGCCTCCT 0: 1
1: 1
2: 1
3: 18
4: 178
Right 956067467 3:65412202-65412224 ACTGCCTCCTTGCAATTCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 272
956067465_956067471 3 Left 956067465 3:65412189-65412211 CCTCCACTGCGGAACTGCCTCCT 0: 1
1: 1
2: 1
3: 18
4: 178
Right 956067471 3:65412215-65412237 AATTCTCTGGGCATTTTCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 271
956067465_956067472 20 Left 956067465 3:65412189-65412211 CCTCCACTGCGGAACTGCCTCCT 0: 1
1: 1
2: 1
3: 18
4: 178
Right 956067472 3:65412232-65412254 CTCTGGCTGCTCCCTCTGCCTGG 0: 1
1: 5
2: 97
3: 383
4: 1607
956067465_956067468 -9 Left 956067465 3:65412189-65412211 CCTCCACTGCGGAACTGCCTCCT 0: 1
1: 1
2: 1
3: 18
4: 178
Right 956067468 3:65412203-65412225 CTGCCTCCTTGCAATTCTCTGGG 0: 1
1: 0
2: 4
3: 15
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956067465 Original CRISPR AGGAGGCAGTTCCGCAGTGG AGG (reversed) Intronic
900307943 1:2019970-2019992 AGGAGGCTGTCTCGCTGTGGAGG + Intronic
900881937 1:5388535-5388557 AGGAGCCAGTGCCGCACTGGAGG - Intergenic
901239076 1:7682501-7682523 AGGTGGCAGCTCCGAAGTGGGGG - Intronic
905617472 1:39411110-39411132 AGGTGGCATTTCCACAGTGCAGG - Exonic
907455361 1:54572050-54572072 AGGAGGAAGGTGCACAGTGGGGG + Intronic
909545907 1:76845902-76845924 AGGAGGCAGTGGTGCTGTGGAGG + Intergenic
912623038 1:111184598-111184620 GGGAGCCAGATCCGCAGTGGTGG + Exonic
912778761 1:112524627-112524649 AGCAGGCAGTTCCCAAGTGGAGG - Exonic
919785999 1:201259179-201259201 GGGAGGCAGGGCTGCAGTGGGGG + Intergenic
919806236 1:201382506-201382528 AGGAGTCATTTCAGGAGTGGAGG - Intronic
922071330 1:222196921-222196943 AGGAGGCAGTTCAGCTCTGTAGG - Intergenic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
922885829 1:229019815-229019837 AGGGGTCAGGTCCCCAGTGGTGG - Intergenic
1062846851 10:714149-714171 ATGAGGCCGTTCCTCAGTGATGG + Intergenic
1066684248 10:37965279-37965301 ATTAGGCAGTACCCCAGTGGGGG - Intronic
1067574510 10:47400753-47400775 AGGAGGCAGTGGAACAGTGGAGG + Intergenic
1067983599 10:51116019-51116041 GGGAGGCAGTTCTGGTGTGGTGG + Intronic
1069857004 10:71446866-71446888 AGGAGGCAGGCCCTCAGTAGGGG - Intronic
1070663934 10:78330157-78330179 AGGAGGCAGCTCCTGAATGGTGG + Intergenic
1072109118 10:92301172-92301194 AGGAGGCAGGTCAGGCGTGGTGG - Intronic
1072201278 10:93161138-93161160 ATGAGTCAGTTTCCCAGTGGCGG - Intergenic
1073605782 10:104894516-104894538 AGGAGGAGGTTCAGAAGTGGAGG + Intronic
1074349469 10:112721906-112721928 AGAAGGCATTTCTGCATTGGGGG + Intronic
1074803945 10:117028897-117028919 ATCAGGCAGTGCCTCAGTGGGGG - Intronic
1076162631 10:128257063-128257085 AGGTGCCAGTTCCTCAGAGGTGG + Intergenic
1076216434 10:128697579-128697601 AGAAGGCAAGTCCCCAGTGGTGG + Intergenic
1076260154 10:129058866-129058888 AGGAGGCACGCCCACAGTGGTGG - Intergenic
1076812749 10:132897806-132897828 AGGAGGCAGTCCCCCGGAGGAGG + Intronic
1077137062 11:1005579-1005601 AGGAGGCAGGTCCGCAGCCAGGG - Intronic
1077236054 11:1482506-1482528 AGGTGCCAGTGCCGGAGTGGCGG - Intronic
1077800256 11:5529635-5529657 AGGAGGCAGTGCTGCCGAGGGGG - Intronic
1078261879 11:9717104-9717126 AGAAGGCAGTTTCGCTGTAGTGG + Intronic
1080574517 11:33585993-33586015 AGGAGGCAGTTCCACCCTGCTGG - Intronic
1080720168 11:34840840-34840862 AGGAGGCAGTGGTGTAGTGGTGG + Intergenic
1080738870 11:35045114-35045136 GGGAGGCACTTCCGGGGTGGGGG + Intergenic
1081001661 11:37680815-37680837 AGAAGGCAGGTCCCCAGGGGAGG + Intergenic
1083026368 11:59554446-59554468 AGGAGGGAGTCCCGCAGAGGAGG + Intergenic
1083305610 11:61760685-61760707 AGGAGGCCATTCCGCAGTCAGGG - Intronic
1084760899 11:71270266-71270288 TGGAGGCAGTTCCTCTATGGAGG + Intergenic
1085218288 11:74851176-74851198 AGGAAGCTCTTCAGCAGTGGAGG + Exonic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1094847396 12:34367333-34367355 GGGAGGCACTTCTGCCGTGGGGG + Intergenic
1101769168 12:107732599-107732621 ATGTGGCAGGTCTGCAGTGGAGG - Intergenic
1101793867 12:107955003-107955025 AGAAGGCAGTTCCTCAGTTGTGG - Intergenic
1101999833 12:109550442-109550464 GGGAGGCATTTCGGCAGTGAGGG + Intergenic
1102626439 12:114239201-114239223 AAGAGACAGTTACTCAGTGGAGG - Intergenic
1103978098 12:124716982-124717004 AGGTGCCAGTTCTGCAGTGCTGG - Intergenic
1104190880 12:126480825-126480847 AGCAGGCAGTTCAGCCATGGAGG - Intergenic
1104684539 12:130776147-130776169 AGGAGGGAGTTCTGCAGGGCAGG + Intergenic
1107419899 13:40236477-40236499 AGGAGGCAGTTCCTCGGCCGAGG - Intergenic
1110187858 13:72695576-72695598 AGGAGGCAGTTATGCAAAGGTGG + Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1113448325 13:110387553-110387575 AGGAGGCAGCCCAGCAGTCGGGG + Intronic
1114534685 14:23415417-23415439 AGGAGGCAGTGCAGGAGTGCAGG - Exonic
1116967084 14:51026009-51026031 AGGAGGCAGTTCTGCTGGGTTGG + Intronic
1123008628 14:105336431-105336453 AGGATGCAGCCCAGCAGTGGTGG + Intronic
1124342606 15:28899975-28899997 AGGAGGCAGGGCAGGAGTGGAGG + Intronic
1126736678 15:51737722-51737744 AGCAGGCCGTTCCGCGGGGGCGG + Exonic
1127130420 15:55856395-55856417 AGGAGGCAGTCCAGCACGGGGGG - Intronic
1127849066 15:62897286-62897308 AAGAGGCAGAGCCGCAGGGGTGG + Intergenic
1128681923 15:69658681-69658703 AGGAGGCAGCTCCACAGAGAGGG - Intergenic
1129159907 15:73741418-73741440 AGGGGGCAGCTCAGCTGTGGAGG + Intronic
1129890106 15:79066323-79066345 AGGCGGCAGTTGCCCAGTGCAGG - Intronic
1131990044 15:98084298-98084320 AGGATGTACTTCCGAAGTGGTGG - Intergenic
1132057401 15:98662789-98662811 AGGAGGCAGCTCCCCAGGAGAGG + Intronic
1133746702 16:8692454-8692476 AGGAGGCAGTTGAGCAGGTGAGG + Intronic
1135854329 16:25993010-25993032 AGGAGGCAGTTTCACAATGGTGG - Intronic
1139489280 16:67278096-67278118 AGAAGGCAGTGACTCAGTGGGGG + Exonic
1142142005 16:88476615-88476637 GGGAGGCATTTCAGCAGAGGAGG + Intronic
1145273663 17:21417747-21417769 TGGAGGAACTTCAGCAGTGGAGG - Exonic
1146587050 17:34091414-34091436 AGGAGGCAGTTCCCCAGGTTTGG + Intronic
1151422837 17:74009752-74009774 ACCAGGCAGTCCCACAGTGGGGG - Intergenic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1160968884 19:1758689-1758711 AGGAGGCAGCTCCGAAGTGCGGG - Intronic
1160983354 19:1826749-1826771 TGGAGGCAGCTCCTCAGTGCTGG - Intronic
1161455235 19:4366633-4366655 AGGAGGCGGTGCAGCAGCGGGGG - Intronic
1162471844 19:10876788-10876810 AGGAGGCAGTTTCTCAGGGAGGG + Intronic
1162575282 19:11495594-11495616 AGGCGGCCGTTTCGCTGTGGGGG + Intronic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1163173380 19:15548449-15548471 AGGAGGCAGTGTCGCAGGGATGG + Intronic
1163262911 19:16201954-16201976 AAGTGGCAGTTCAGCAGTGGGGG + Intronic
1163437393 19:17303525-17303547 AGGCGGCAATTCCGTAGTGGAGG + Intronic
1165291357 19:34888624-34888646 AGGAGGAAGATCCTCAGTGTGGG + Intergenic
1165749541 19:38251682-38251704 AGGAGACAGATACGGAGTGGGGG + Intronic
1166858011 19:45792776-45792798 GGGCGGCAGTCCGGCAGTGGCGG - Exonic
1167466477 19:49653159-49653181 AGGAAAAAGGTCCGCAGTGGAGG + Exonic
1167733034 19:51272970-51272992 AGGAAGCAGTTCCCTAGTGAGGG + Intergenic
925200757 2:1965987-1966009 AGCAGGCAGAGCCGCAGTGCAGG - Intronic
926128693 2:10286895-10286917 AGGAGGGGGTGCCGCAGTGTGGG + Intergenic
926951218 2:18245658-18245680 TGGAGCCAGCTCAGCAGTGGAGG + Intronic
927211736 2:20642936-20642958 AGGAGGGGGCACCGCAGTGGAGG - Intronic
927289278 2:21388815-21388837 GGGAGGAGCTTCCGCAGTGGGGG + Intergenic
932001427 2:67888779-67888801 AGGTAGCAGTTGCCCAGTGGGGG + Intergenic
934149992 2:89137000-89137022 AGGCTGCAGTTTTGCAGTGGAGG + Intergenic
934217303 2:90045028-90045050 AGGCTGCAGTTTTGCAGTGGAGG - Intergenic
934870393 2:97859980-97860002 AAGAGGCAGTTCAGTACTGGCGG - Intronic
935379885 2:102440775-102440797 AGGAGGAAGTTTGACAGTGGAGG + Intronic
937346094 2:121126385-121126407 AGAAGGCAGGTCAGCAGTTGTGG + Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
946144010 2:217715002-217715024 AGGAGGCTGGTCAGCAATGGTGG + Intronic
948896849 2:240931646-240931668 GGGAGGCGGCTCCCCAGTGGAGG + Intronic
1172487312 20:35306097-35306119 ACGAGAAAGCTCCGCAGTGGGGG - Intronic
1174358604 20:50014480-50014502 AGGAGGCCATTCCTCAGAGGAGG - Intergenic
1175572868 20:60037296-60037318 AGGGGGCAGTGTCCCAGTGGAGG + Intergenic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1176040840 20:63065001-63065023 AGGAGGCAGCTCCGCGTTTGGGG - Intergenic
1179358269 21:40682224-40682246 AGAAGGCAGGTCCGAAGTTGGGG + Intronic
1181959996 22:26616152-26616174 AGGAGGCAGTTCCGCCGCCTTGG + Exonic
1184152444 22:42646732-42646754 TGGAGGAAGTTCTGCAGTGGGGG + Intronic
1184289300 22:43489888-43489910 AGAAGGCATTTTCACAGTGGTGG + Intronic
1184352774 22:43955489-43955511 AGAAGGCGGGTCCGCGGTGGCGG - Exonic
1184550673 22:45202783-45202805 AGGAGGCACTGCCGCAGGGGAGG - Intronic
1184880405 22:47300811-47300833 AGGTGGCAGGTCCACCGTGGAGG - Intergenic
950053555 3:10009184-10009206 AGGTGGCAGTGACGCAGCGGGGG - Intronic
950209947 3:11115892-11115914 AGGAGGGAGTTATGCAGGGGAGG - Intergenic
951108937 3:18778219-18778241 TGGATGTAGTTCCTCAGTGGGGG + Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
954745904 3:52787452-52787474 AGGAGGCAGGACCCCAGGGGAGG + Intronic
956067465 3:65412189-65412211 AGGAGGCAGTTCCGCAGTGGAGG - Intronic
960581483 3:119282854-119282876 ATGAGGCAGTGCCCCAGTGGGGG - Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
965516910 3:169631054-169631076 TGCAGGCAGCTCTGCAGTGGTGG + Intronic
967487573 3:190051831-190051853 GGGAGGCATTTCAGCTGTGGAGG + Intronic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
968092819 3:195909126-195909148 CGGAGGCAGCCCCGCAGTGCAGG - Intronic
968251749 3:197223097-197223119 AGGAGGCAGTTCTTTAGGGGTGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
970435849 4:16034450-16034472 AGGAGCCAGATCCACAGTGAAGG + Intronic
970464273 4:16307384-16307406 AGGCAGCAGTTCCGCTGTGCAGG - Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
977659304 4:99564022-99564044 GGGCGGTAGTTACGCAGTGGAGG + Intronic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
981659485 4:147148922-147148944 AGGAGGCAGCCTCGCAGGGGAGG - Intergenic
981823741 4:148915593-148915615 AGGATGGAGATCAGCAGTGGTGG - Intergenic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
984024328 4:174524460-174524482 AGGAAGCAGTTTGGCGGTGGCGG + Intergenic
984844372 4:184097500-184097522 AGCAGGAAGTGCCGCAGCGGAGG - Intronic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986375979 5:7131367-7131389 ATGAGGCAGTTCTACAGTGTAGG + Intergenic
987611093 5:20203555-20203577 AGGAGGCAGTGACCTAGTGGAGG + Intronic
988431365 5:31122729-31122751 AGGAGGCAGTTCAGCAGGGGCGG - Intergenic
988440030 5:31223229-31223251 AGGACACAGTTTCACAGTGGCGG + Intronic
995439549 5:112175021-112175043 AGGAGGCACTTCCGGGTTGGGGG + Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
997289788 5:132721024-132721046 AGGAGGCAGTTAGTCAGTTGAGG + Intronic
997535122 5:134614665-134614687 AGGAGGGAGTACCGGAGAGGAGG - Intronic
1000831801 5:166111163-166111185 CTGAGTCAGTTCCCCAGTGGGGG - Intergenic
1002314471 5:178334131-178334153 GGGAGGCAAGTCTGCAGTGGAGG - Intronic
1002637020 5:180613543-180613565 AGGAGGGAGTTCAGCAGTCCAGG - Intronic
1007205214 6:40144488-40144510 AGGAGGCATCTCAGCAGTGTTGG - Intergenic
1007952285 6:45883166-45883188 AGGAACGAGTTCCACAGTGGGGG + Intergenic
1011683870 6:89808692-89808714 AGAACGAAGTTCAGCAGTGGTGG - Intronic
1012229791 6:96747480-96747502 AGGGGACAGTTGCTCAGTGGAGG + Intergenic
1014799254 6:125759426-125759448 AGGAGGCACTTCTGAAGTTGTGG - Exonic
1015952876 6:138571784-138571806 AAGAGGCTGTTTCGCAGTGATGG - Exonic
1015999564 6:139029208-139029230 AGGAGCCAGTTCTGCAGAGCTGG + Intronic
1019104885 6:169660056-169660078 AGGAGGCCCTGCTGCAGTGGAGG + Intronic
1019374407 7:681711-681733 AGGAGCAAGGTCTGCAGTGGTGG - Intronic
1020232869 7:6333420-6333442 AGGAGGCTGTTCCACAGAGCAGG + Intronic
1023303026 7:38793793-38793815 AGAAGGCAGTACCACTGTGGAGG - Intronic
1023665889 7:42522851-42522873 AGGAGGCATTTCCTGAGTAGAGG + Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1029188914 7:98758437-98758459 AGGAGAGAGTTCAGAAGTGGGGG + Intergenic
1034404964 7:150897049-150897071 AGGGGGCAGGGCCGAAGTGGAGG - Intergenic
1036200525 8:6767485-6767507 CTGAGTCAGTTCCTCAGTGGGGG - Intergenic
1036663545 8:10724395-10724417 AGGGACCAGTTCAGCAGTGGAGG + Intergenic
1039453924 8:37695953-37695975 AGGAGGCAGCGCCGCTGGGGGGG - Exonic
1041917972 8:63154918-63154940 TGGAGTCAGTTCCTGAGTGGGGG + Intergenic
1042050728 8:64702855-64702877 AGAAGGCATTTACTCAGTGGTGG - Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046702564 8:117418079-117418101 AGGAGACAGTTTAGCACTGGAGG + Intergenic
1046708052 8:117477775-117477797 AGGAGGCAGGAAGGCAGTGGGGG + Intergenic
1048509385 8:135048681-135048703 AGGGGTCAGTTCCACTGTGGTGG - Intergenic
1049615749 8:143575201-143575223 TGGAGGCAGAGCCGCAGTAGTGG + Exonic
1050033805 9:1413950-1413972 GGGCGGCAGTTTCACAGTGGAGG + Intergenic
1053284592 9:36842048-36842070 AGGAGGCAGTATGGCAGTGGAGG + Intronic
1053575265 9:39353534-39353556 AGAATGCAGTCCAGCAGTGGGGG - Intergenic
1053839768 9:42181468-42181490 AGAATGCAGTCCAGCAGTGGGGG - Intergenic
1054096827 9:60912217-60912239 AGAATGCAGTCCAGCAGTGGGGG - Intergenic
1054118231 9:61187843-61187865 AGAATGCAGTCCAGCAGTGGGGG - Intergenic
1054589524 9:66994721-66994743 AGAATGCAGTCCAGCAGTGGGGG + Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1059348920 9:113650775-113650797 AGGAGGCTGTTCCGCATCAGGGG - Intergenic
1060129199 9:121078513-121078535 AGCAGTTAGTTCTGCAGTGGTGG + Intronic
1062324452 9:136005454-136005476 AGGGGTCTGTTCCCCAGTGGGGG - Intergenic
1062512790 9:136916718-136916740 AGGAGGCAGTGCTGCAGAGGTGG - Intronic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1190420417 X:50224775-50224797 AGGAGGCAGATATGGAGTGGTGG + Intronic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192149230 X:68701652-68701674 AGGAGGGAGTTGGGCAGTGGGGG + Intronic
1192923948 X:75736233-75736255 AGGAGGTAGTAACCCAGTGGTGG - Intergenic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1195234531 X:102883617-102883639 AGGCAGCATTTCCGAAGTGGAGG + Intergenic
1195523624 X:105859840-105859862 AGGAGGCAGATGTGCAGTTGGGG + Intronic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1200333764 X:155325576-155325598 TGGAGCCAGTTGCGGAGTGGGGG + Intronic