ID: 956067846

View in Genome Browser
Species Human (GRCh38)
Location 3:65415787-65415809
Sequence ACCAATAATGTCTTCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 3, 2: 31, 3: 82, 4: 251}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956067846_956067856 23 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067856 3:65415833-65415855 TGCTACCGGCAGCTAGTGCTAGG 0: 1
1: 0
2: 2
3: 10
4: 130
956067846_956067851 -3 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067851 3:65415807-65415829 GGTTGTTAAAACTGGGGAGACGG 0: 1
1: 0
2: 9
3: 43
4: 381
956067846_956067854 0 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067854 3:65415810-65415832 TGTTAAAACTGGGGAGACGGGGG 0: 1
1: 0
2: 1
3: 39
4: 662
956067846_956067852 -2 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067852 3:65415808-65415830 GTTGTTAAAACTGGGGAGACGGG 0: 1
1: 0
2: 0
3: 20
4: 225
956067846_956067853 -1 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067853 3:65415809-65415831 TTGTTAAAACTGGGGAGACGGGG 0: 1
1: 0
2: 2
3: 15
4: 169
956067846_956067849 -10 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067849 3:65415800-65415822 CATTATTGGTTGTTAAAACTGGG 0: 1
1: 1
2: 50
3: 278
4: 960
956067846_956067850 -9 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067850 3:65415801-65415823 ATTATTGGTTGTTAAAACTGGGG 0: 1
1: 2
2: 27
3: 179
4: 855
956067846_956067855 9 Left 956067846 3:65415787-65415809 CCCTGTCTGAAGACATTATTGGT 0: 1
1: 3
2: 31
3: 82
4: 251
Right 956067855 3:65415819-65415841 TGGGGAGACGGGGGTGCTACCGG 0: 1
1: 0
2: 4
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956067846 Original CRISPR ACCAATAATGTCTTCAGACA GGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903078328 1:20788805-20788827 ACCAAGATTGTTTTGAGACAGGG - Intergenic
903801228 1:25969882-25969904 GCCATTAAAGTCTTGAGACATGG + Intronic
904592543 1:31622977-31622999 ACCAATAATATCTTTCCACAAGG + Intronic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
905251540 1:36651973-36651995 ACCACTAATGACTCCAGTCAAGG + Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905514251 1:38550277-38550299 CCCAATCAAGTCTTCATACAAGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
908134845 1:61120623-61120645 TCCAATAATGTCTTTTGAGATGG - Intronic
908560538 1:65301731-65301753 CCCAATGAAGTCTTCATACAAGG - Intronic
909598345 1:77432270-77432292 ACCAATCACGTCTTCTGATATGG - Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921456289 1:215376038-215376060 ACCAATGATGCCTTCCGCCATGG - Intergenic
921677088 1:217988487-217988509 ATAAATGATGTCTTCATACAAGG - Intergenic
921763795 1:218946855-218946877 ACCAACCATGTCCTCAGCCAGGG + Intergenic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923292332 1:232558345-232558367 AACAATTATGGCTTCAGACAAGG - Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1063992305 10:11579316-11579338 GCCATTAATGTTTTTAGACAGGG - Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068652589 10:59539049-59539071 ACAAATTATGTCTTCACGCACGG - Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1071920011 10:90338957-90338979 TCCAATAATGAAATCAGACAAGG - Intergenic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078976923 11:16487822-16487844 ACAAATAATGACTTCAGTAATGG + Intronic
1081229848 11:40572468-40572490 ACCAATAATATCTACAAAAAAGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083092473 11:60214507-60214529 ATCAATAATGTATTCTGCCAGGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084325707 11:68398740-68398762 ATAAATAATTTCTTGAGACAGGG + Intronic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1085703925 11:78769271-78769293 AGCACCCATGTCTTCAGACAAGG - Intronic
1086223680 11:84481582-84481604 ACCCACAATGTCTTCAGAAGTGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087907698 11:103718260-103718282 ACCAATAATGACGTCTGAAATGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091015770 11:132049707-132049729 ACCAATGCTGTGTTCAGCCATGG + Intronic
1091360178 11:134973218-134973240 ACACATAATGTCTTCAGTAAAGG - Intergenic
1091465301 12:678762-678784 TCCTATAATGTCGTCACACATGG + Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092887772 12:12940452-12940474 GCCCTTAATTTCTTCAGACAGGG + Intergenic
1093556131 12:20476248-20476270 ACCTATAATGTCCTTAGACTGGG + Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095353251 12:41240345-41240367 ACCCATTATGTTTTGAGACAGGG - Intronic
1095876874 12:47089027-47089049 GGCAATAGGGTCTTCAGACAGGG + Intronic
1099985045 12:89652388-89652410 ACATATACTTTCTTCAGACATGG - Intronic
1100394249 12:94170982-94171004 ACCAATTATCTCTTCAGATTTGG + Intronic
1100944159 12:99761017-99761039 ACCAATAATGAATTCCGAAATGG + Intronic
1101168878 12:102067351-102067373 ACCAATAATCTGTTGAGACTTGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102765497 12:115429402-115429424 ACAAATAATGTTTACTGACATGG + Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108224869 13:48278543-48278565 TCCAATAAGGACATCAGACAGGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109598782 13:64595020-64595042 ACCAATAATGTGTTCTGAAATGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115137283 14:30126104-30126126 AGCAAGAATCTCTTCAAACATGG + Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117155047 14:52930789-52930811 GCCAATAATGTGTAAAGACAGGG + Intronic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1117496417 14:56310041-56310063 ACAAATAATGGCTTAACACATGG - Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1123895174 15:24821448-24821470 ACCAATACTTTCTTCTGACTGGG - Intergenic
1127003338 15:54536304-54536326 ACCAATAATGAGTTCTGAAATGG + Intronic
1127277009 15:57455367-57455389 ACCAATAAAATGTTCACACAAGG - Intronic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1128959301 15:71984504-71984526 AACCATTATGTCTTCAAACACGG + Intronic
1129583259 15:76834874-76834896 ACCAATAATGAGTTCTGAAATGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130458856 15:84142900-84142922 TCCAATGATGGCTTCAGAGAGGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133463713 16:6009621-6009643 AGCAATCATGTTTTCAGAGAAGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134804584 16:17113782-17113804 ACCAATGAAGTCTTCATAAAAGG + Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1139136498 16:64211153-64211175 ACAAATAATGTCTTTGGAGACGG - Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1139769734 16:69264289-69264311 ACCACTCATGTCTTCAGGTAGGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151603776 17:75123602-75123624 AAAAATAATGTCTTCAGGCTGGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153348881 18:4057341-4057363 ACCAATAAAGTGTTCCTACAAGG - Intronic
1153748050 18:8200408-8200430 AACAACAATGTCTTGTGACAAGG - Intronic
1154278994 18:12983611-12983633 ACCTATCATGTCTTCTGAAATGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1154494946 18:14948793-14948815 ACACATAATGTCTTCAGTAAAGG + Intergenic
1155051075 18:22148388-22148410 CCCAATTATGACTACAGACACGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158837106 18:61342607-61342629 ACCAATAATATCTTCCCACTTGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163792934 19:19318836-19318858 GACAATGATGTCTTCAGACTAGG + Intronic
1164412052 19:28014305-28014327 ACCAACACTGGCTTCAGAGAAGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925997166 2:9302810-9302832 AGCTATAATGTCTTCTGACCAGG - Intronic
927267757 2:21172145-21172167 ACAAATAATGGCTTAATACAAGG + Intergenic
928255783 2:29721079-29721101 ATCAATAATGCCTTCAGTCCAGG - Intronic
928902918 2:36340417-36340439 CAAAAGAATGTCTTCAGACATGG + Intergenic
929164532 2:38868033-38868055 TCCCATCATGTCTTCAGAAAAGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930884742 2:56312661-56312683 ACCAATCATGTCTTCCTACTGGG - Intronic
932929893 2:76022233-76022255 ATCAATGATGTCTTCAACCAGGG - Intergenic
933518096 2:83331585-83331607 AACATTAATCTCTTCAGACCTGG + Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938828457 2:135030539-135030561 ACCAACAGTGTCTTCAGAGCTGG + Intronic
938898691 2:135778481-135778503 ACCATTTATGCCTTGAGACAAGG + Intronic
939718760 2:145620287-145620309 TCCAATATTTCCTTCAGACAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940385926 2:153071697-153071719 AGAAATAATTTCTTCAGAAAGGG - Intergenic
942203026 2:173591290-173591312 TCCAATAATGTCTTCAAAGTGGG + Intergenic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
943912712 2:193588998-193589020 AAAAATAATGTCTTCCGGCATGG - Intergenic
946105503 2:217365908-217365930 CACAATAATGTCCTCAGAGATGG + Intronic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1170469672 20:16655864-16655886 ACCAATTCTGTCTTTAAACAGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1178340632 21:31783165-31783187 ACAAATTATGTTTTCACACAAGG - Intergenic
1178497976 21:33102923-33102945 ACCAATAATTTCACCAGCCAGGG - Intergenic
1178587230 21:33880696-33880718 ACAAATACTCTCTTCAGAGAGGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181918744 22:26302487-26302509 TCCAATATTCTCTTCACACATGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949295528 3:2517840-2517862 ACAAATCATGTGTTCAAACATGG + Intronic
949963359 3:9333591-9333613 AACAATTATTTCTTCAGACAGGG + Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952246176 3:31595005-31595027 ACCAATAAAGTCTCCATAAAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
955102643 3:55866723-55866745 ACCAATAATGTCTTCCTTAATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956788065 3:72659182-72659204 ATTTATAATGTCTTCAGGCAAGG + Intergenic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963208696 3:142663794-142663816 ACGAATAATGTCTACAAAAAAGG - Intronic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
963794905 3:149622077-149622099 ACCAATCATGTCATAAGACTGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967685680 3:192412956-192412978 ACTCATAATGTCTTCAGAATAGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970668735 4:18370937-18370959 ACCAATAATGAGTTCTGAAATGG + Intergenic
972980083 4:44687282-44687304 TTCAATAATTTCTACAGACAAGG - Intronic
973129513 4:46633184-46633206 ACCAATAATGACTTCCAAAATGG - Intergenic
975052476 4:69883080-69883102 ACCAATCATGTCTTCCCAAAAGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978460220 4:108943058-108943080 ACCAATAATTTCTTAAAGCATGG + Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983397910 4:167226076-167226098 ACCATTAATGCCTTAACACAAGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985352832 4:189084534-189084556 CAGAATAATATCTTCAGACATGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989330787 5:40255710-40255732 ATCAATTTTGTCTTCAGAAATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990496551 5:56353937-56353959 ACCAATAGGGTCTTCAGTCTTGG - Intergenic
990507260 5:56456942-56456964 ACAAATAATGTTCTCAGAAATGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992205081 5:74423243-74423265 TACTGTAATGTCTTCAGACAAGG - Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993992230 5:94672765-94672787 ACCCATAAAGACTTCAGATATGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994133628 5:96260499-96260521 AACAATAATGTATTAAGAAATGG - Intergenic
994814661 5:104569779-104569801 CCAAAGAATGCCTTCAGACAGGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995953877 5:117750864-117750886 GCCAATATTGTTTTCAGATAAGG + Intergenic
996376588 5:122815114-122815136 ACCAATCATGACTTCATAAAAGG - Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
999891614 5:155984061-155984083 GCCAACAAGGTCTTCAAACAAGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008021124 6:46578765-46578787 ACCAATAATGAGTTCTGAAATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009406350 6:63318198-63318220 ACAAAGAATTTCTTCAGACTGGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009915756 6:69993624-69993646 ACCAATAATGAGTTCTGAAATGG - Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014801511 6:125783395-125783417 AGCAATAATTGATTCAGACAAGG - Intronic
1015229018 6:130892382-130892404 AGCAATAATCTGTTCAGAAATGG - Intronic
1018344740 6:162888660-162888682 ACCAAGTGTGTCTTCAGAAAGGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020868693 7:13599998-13600020 TAAAATAAGGTCTTCAGACATGG + Intergenic
1021180917 7:17504792-17504814 ATCAATAATGTCCTAAGAAACGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021558244 7:21943707-21943729 GCCAATTAGGTCTTCAGAAAAGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022471881 7:30686772-30686794 AGCAATTATGACTTCAGGCAGGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024516514 7:50263831-50263853 ACCTATGATGTGTGCAGACATGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032175679 7:129623259-129623281 ACCAATGCTATCTTGAGACAAGG - Intronic
1035328323 7:158079677-158079699 TCCAATAATCACTTCTGACAGGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038309336 8:26434065-26434087 ACCAACAATCTCTTAAAACACGG - Intronic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1038520011 8:28223506-28223528 ACCAATAATGACTTCTGAAATGG - Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039346012 8:36706465-36706487 ATCCATTATGTCTTCAAACATGG + Intergenic
1041356963 8:57011438-57011460 ACCAGTAATCTCTTCAGAATAGG + Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047280937 8:123444938-123444960 TCCAATAATATCTTCAATCAGGG - Intronic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048730035 8:137428457-137428479 TCTAATAATGTCTTCAGATGGGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052332744 9:27286720-27286742 AATAATAATCTCTTCAGACATGG - Intronic
1052756986 9:32551435-32551457 TCCTATAAAGTCTTCAGAGAGGG + Intronic
1055393458 9:75848058-75848080 AAAAATAATGTCTTCAGGCCGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1059510669 9:114842711-114842733 ACCAATAATGAGTTCTGAAATGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060502066 9:124165844-124165866 ACCAATAGTGTCTTTAAAAAAGG + Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061362094 9:130150069-130150091 AGCAACAATGCCTTCAGGCAAGG - Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061702474 9:132426434-132426456 AACAGTAATGTCTTCAAACAGGG + Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187247485 X:17565938-17565960 ACCAAGAATTTCTTCACAAATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187409563 X:19038427-19038449 AACAATAATGTGGACAGACAGGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188660759 X:32755294-32755316 AAAAATATTGTCTTCAGACAAGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189550506 X:42087645-42087667 ACCAATCATGTCACCAAACAAGG - Intergenic
1193512737 X:82425469-82425491 ACCAATCATGTGCTGAGACAAGG - Intergenic
1194498915 X:94655887-94655909 ACCAAGAATGTAATCAGACCTGG - Intergenic
1194499684 X:94666192-94666214 TGCAATAATTTCTTCAGAGAAGG + Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195906050 X:109845552-109845574 ACCAATGATGTCCTCAGCCCAGG - Intergenic
1195935145 X:110118248-110118270 ATCAGTAATCTCTTCAGGCATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196647441 X:118133111-118133133 ACCAATCCTGACTTTAGACAGGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1202245476 Y:22815903-22815925 AACAATGATGTCTTCAGGCATGG - Intergenic
1202398465 Y:24449651-24449673 AACAATGATGTCTTCAGGCATGG - Intergenic
1202472316 Y:25220435-25220457 AACAATGATGTCTTCAGGCATGG + Intergenic