ID: 956074649

View in Genome Browser
Species Human (GRCh38)
Location 3:65491757-65491779
Sequence TTGGGATGTGACTGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956074649_956074653 -9 Left 956074649 3:65491757-65491779 CCAGCCACCCAGTCACATCCCAA 0: 1
1: 0
2: 3
3: 31
4: 325
Right 956074653 3:65491771-65491793 ACATCCCAACATGTAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956074649 Original CRISPR TTGGGATGTGACTGGGTGGC TGG (reversed) Intronic
900095198 1:937402-937424 GGGGGAGGTGACTGGGTGGGGGG - Intronic
900477473 1:2882672-2882694 TGGGGATGTGAGCGGGTGTCAGG + Intergenic
900721633 1:4179871-4179893 CTGGGATGTGGCTGGGAGGGTGG + Intergenic
900824902 1:4918671-4918693 TTAAGATTTGACTGTGTGGCTGG - Intergenic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901817105 1:11800628-11800650 GTGGGATGGGAGAGGGTGGCAGG - Intronic
902093188 1:13920707-13920729 TTGGGATGTCTCTGGTTGGAGGG + Intergenic
903213401 1:21830726-21830748 TGGGGGAGTGCCTGGGTGGCGGG + Intronic
903227905 1:21904210-21904232 TAGGGAGGTGGCTGGGAGGCTGG + Intronic
903845872 1:26279817-26279839 TGGGGAGGGGCCTGGGTGGCAGG - Exonic
903939507 1:26919669-26919691 GTGGGATATAGCTGGGTGGCTGG - Intronic
905910089 1:41647658-41647680 TAGGGATCTGACTGTGGGGCTGG + Intronic
906202394 1:43968367-43968389 TTGGGGGGTGGGTGGGTGGCAGG + Intergenic
907754325 1:57295717-57295739 TGGTGATGTGACTGGGTGCCAGG + Intronic
907940366 1:59081838-59081860 CTGAGATGTGACTGGATGGCAGG - Intergenic
908226357 1:62059921-62059943 TGGGCAGCTGACTGGGTGGCTGG + Intronic
908918538 1:69161992-69162014 TTGGCATGTGACTGGGTAGCAGG + Intergenic
909151441 1:72010782-72010804 CTGGAATATGACTGGGTGGATGG + Intronic
910298486 1:85677819-85677841 TTGGGATGTGAATGAGTGCTTGG - Intronic
910552794 1:88495799-88495821 TTGGGATGGAATTGGATGGCTGG - Intergenic
910562000 1:88600789-88600811 TTGGGTGATGACGGGGTGGCTGG - Intergenic
911198255 1:95017704-95017726 TTGGGATGTGTATGGGTGACAGG + Intronic
913004876 1:114619514-114619536 TTGGGGGGTGAGTGGTTGGCAGG - Intronic
915543525 1:156583186-156583208 TTGGGATGTGACTGGGACAGTGG + Intronic
918141314 1:181722248-181722270 TTGGGATCTTACTATGTGGCAGG - Intronic
918783535 1:188733228-188733250 TTGGGCTGTGTCTGAGTGACAGG + Intergenic
920295923 1:204956315-204956337 CTGGAATGGGACTGGGTGCCAGG - Intronic
920600503 1:207320185-207320207 TGGGGATGGGACTGGGTATCAGG - Intergenic
921056824 1:211548841-211548863 GAGGGATGAGAGTGGGTGGCAGG - Intergenic
922530737 1:226343030-226343052 TTGGGATGTGCCTGGATGCGGGG + Intergenic
923206412 1:231763080-231763102 TGTGGATGTGACTGGAAGGCAGG + Intronic
1063588322 10:7372940-7372962 TTAGGATGTGCCTGGGAGGGCGG - Intronic
1064074948 10:12261290-12261312 GTGGGATGTGGCTGGCGGGCTGG - Intergenic
1065598806 10:27347426-27347448 TAGGGATGTGAATGGGAGACTGG + Intergenic
1065969571 10:30795805-30795827 GTGGGATGTGACTGGATCACGGG - Intergenic
1066246118 10:33584870-33584892 TTGGAATGTCTCTGGGTGGAGGG - Intergenic
1066246586 10:33589365-33589387 TTGGAATGTCTCTGGGTGGAGGG + Intergenic
1067691597 10:48505527-48505549 TGGGGATGGGGCTCGGTGGCAGG - Intronic
1067808814 10:49411118-49411140 TTTGGATCTGACTGGGAGACAGG - Intergenic
1068735378 10:60408284-60408306 TTGGGGTGTGGCTTGGTGGGAGG + Intronic
1070810302 10:79294209-79294231 TGGGGAAGTGACTGGAAGGCCGG + Intronic
1071620690 10:87116516-87116538 TGGGGAAGTGTTTGGGTGGCAGG + Intronic
1071672228 10:87619300-87619322 TTGGCAGGTGCCTGGGTGCCTGG - Intergenic
1073094549 10:100971721-100971743 ATGGGATGGGGGTGGGTGGCAGG - Intronic
1075022086 10:118959513-118959535 TAGGGATGTGGCCGGGTTGCTGG - Intergenic
1075788441 10:125066250-125066272 TTGGGATGTGGCTTGGTAGAGGG - Intronic
1076932052 10:133537976-133537998 TTGGGGTGTCAGTGGGTGCCTGG - Intronic
1077094939 11:795316-795338 TGAGCATGGGACTGGGTGGCAGG - Intronic
1077264265 11:1641320-1641342 CTGGGCTGTGGCTGGGTGGTTGG + Intergenic
1077297964 11:1834854-1834876 CTGGGAGGTGGCTGGGAGGCTGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077832649 11:5891636-5891658 TTGGGAGGTGATTGGATTGCAGG + Intronic
1078024409 11:7680983-7681005 TGAAGATGTGACTGGGTAGCAGG - Intergenic
1078901001 11:15642839-15642861 ATTTTATGTGACTGGGTGGCAGG - Intergenic
1079505852 11:21151053-21151075 TTGGGAGGTGACTGGATCACAGG - Intronic
1081549280 11:44096485-44096507 TAGGCAGGGGACTGGGTGGCCGG + Intronic
1081676251 11:44971574-44971596 TTGAGATGTGACTAAGTGCCTGG - Intergenic
1082097785 11:48145258-48145280 TTGAGATGTCACTGGGTCACCGG + Intronic
1084476520 11:69392396-69392418 TTGGGATGTTCCAGGGTGGACGG + Intergenic
1084553987 11:69865018-69865040 CATGGATGTGAGTGGGTGGCGGG + Intergenic
1085204448 11:74722251-74722273 GTGGGATGAGACTTGGTGGTGGG - Intronic
1086432023 11:86745289-86745311 TTGGGAAGTGACTAGGTTACAGG - Intergenic
1086891105 11:92259002-92259024 TTGGGCTGTGTGTGGGGGGCGGG + Intergenic
1087993586 11:104776546-104776568 TTGGAATGTTTCTGGGTGGAAGG - Intergenic
1088696592 11:112371240-112371262 TGTGGTTGTGACTGGGTGTCTGG - Intergenic
1088914800 11:114219406-114219428 TAGGGGTCTGAGTGGGTGGCTGG + Intronic
1089051467 11:115549454-115549476 TTGGGATGTAGCTTGGTGCCTGG + Intergenic
1090325377 11:125881809-125881831 TTGGGATGTGAAAGAGAGGCAGG - Intergenic
1090624277 11:128592326-128592348 TTGGTGTGAGACTGGGTGGAAGG - Intergenic
1096069091 12:48764835-48764857 TTGGGAACTGAATGGGTGGGGGG - Intergenic
1097358640 12:58631842-58631864 TGGGGATGTGGCAGGGTGGCTGG - Intronic
1097489101 12:60242035-60242057 TTGGGCTGTGTCTGAGTGACAGG - Intergenic
1099349985 12:81554362-81554384 CTGGGATGTGTCTGGGTCTCAGG + Intronic
1100396348 12:94189334-94189356 TAGGGATGTGAAAAGGTGGCAGG + Intronic
1101118318 12:101553500-101553522 TTGGGATGAGATTTGGAGGCTGG + Intergenic
1101478155 12:105071251-105071273 TTGGGATCTGCCTGTTTGGCAGG - Intronic
1101823390 12:108201507-108201529 TTGGGGTGTGGGTGGGGGGCGGG + Intronic
1102031471 12:109742330-109742352 TTGGAATGTGAGCAGGTGGCGGG - Intronic
1102810823 12:115822928-115822950 TTGGGATGTTATTGGGTGGGGGG - Intergenic
1104019364 12:124981347-124981369 GTGGGGTGGGACTGGGTGGGAGG + Intronic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105589056 13:21774451-21774473 TTGGAAAGTGAGTGGGTGGTGGG - Intergenic
1105638101 13:22235736-22235758 TGGGGCTGAGAGTGGGTGGCTGG + Intergenic
1107354715 13:39554731-39554753 TGGGGATGTGAATGGCTGGGGGG - Intronic
1107710606 13:43146967-43146989 TTGGGATGTCACAGGGTTGGAGG + Intergenic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110393171 13:74999508-74999530 TTGGGATGAGGCTGGGAGGTTGG + Intergenic
1111533501 13:89571768-89571790 TTGGAATGTCTCTGGGTGGAGGG - Intergenic
1111878935 13:93931087-93931109 GTGGGAGGTGACTGGATCGCTGG - Intronic
1112885026 13:104159489-104159511 GTGGGAGGTGACTGGGTCGTGGG - Intergenic
1113422398 13:110180780-110180802 TTCAGTTGTGACTGGGTGGAAGG + Intronic
1113922517 13:113921340-113921362 TTAGGACGTGGCTGGGTGGGAGG - Intergenic
1114937982 14:27568460-27568482 TTGGAATGTCAGTGGGAGGCAGG - Intergenic
1115929063 14:38470591-38470613 TTGTGATGTCACTAGGTGGTAGG + Intergenic
1115976813 14:39005631-39005653 TGGGGCTGGGGCTGGGTGGCAGG - Intergenic
1118172417 14:63400791-63400813 TTGGAATGGGAATGGGTGGATGG - Intronic
1119128520 14:72150743-72150765 GTGGGAGGTGACTGGGTGGTAGG - Intronic
1119545339 14:75467790-75467812 CTGGGACGTGACTGGGAAGCTGG - Intronic
1120503680 14:85327410-85327432 CTGGCATGTGCCTGGTTGGCAGG + Intergenic
1121778356 14:96605889-96605911 TTGAGAAGTGGCTGGGTGGACGG - Intergenic
1122422572 14:101586868-101586890 CTGGCATGTGACGGGGTGGCGGG - Intergenic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1124632219 15:31344438-31344460 TTGGCAAATGTCTGGGTGGCTGG - Intronic
1124640550 15:31393493-31393515 CTGGGATGGGGCTGGATGGCCGG - Intronic
1125404874 15:39341751-39341773 TTTGGATCTAACTGGCTGGCAGG + Intergenic
1126299763 15:47183001-47183023 TTTGCATGTGGCTGGGTAGCTGG + Intergenic
1127755731 15:62090180-62090202 GTGGGAGGTGACTGGGTGATAGG + Intergenic
1129222323 15:74138323-74138345 TAGGGATGTGAATGGGAGACTGG + Intronic
1130386166 15:83414282-83414304 TTAGGATGAGACTGGTTGGAAGG + Intergenic
1130706043 15:86233862-86233884 TTGGGATTTTACTGGCAGGCAGG + Intronic
1131464422 15:92644234-92644256 TGGGAATGTGTCTTGGTGGCAGG - Intronic
1132662288 16:1066811-1066833 GTGGGGAGTGACTGGGTAGCAGG + Intergenic
1132759630 16:1502398-1502420 TCGGGAGGTGAGTGGGGGGCGGG + Exonic
1132847357 16:2006678-2006700 CTGGGGTGGGACTTGGTGGCTGG + Intronic
1133033202 16:3021313-3021335 CTGGGCTGTGAGTGGGGGGCAGG + Exonic
1135413329 16:22251042-22251064 GTCTGATGTGGCTGGGTGGCTGG - Intronic
1137619710 16:49868315-49868337 TTGGGGTGGGAATGGGCGGCGGG - Intergenic
1138062165 16:53903183-53903205 TTGGGAAGGGAATGAGTGGCTGG - Intronic
1138503621 16:57464669-57464691 TTAAGAAGTGACTGGGGGGCGGG - Intronic
1138757866 16:59510389-59510411 CTGGGCTGTGAGTGGGTTGCTGG + Intergenic
1138760778 16:59541133-59541155 TTTGGATGTCAGTGGGTGGCAGG - Intergenic
1141474948 16:84266606-84266628 TGGGGATCTTACTGGCTGGCAGG + Intergenic
1141553236 16:84819975-84819997 CTGGGATGCGAGTGGGTGCCGGG - Exonic
1141572973 16:84945515-84945537 TTGGGAGGTGATTGGATGGTGGG + Intergenic
1141647684 16:85376316-85376338 TGGGGAGGTGCCTGGGTGCCTGG + Intergenic
1142056329 16:87998644-87998666 TGGAGATGTGTCTGGGTGTCTGG - Intronic
1142196191 16:88740370-88740392 CTGGGAAGGGGCTGGGTGGCTGG - Intronic
1142782644 17:2193128-2193150 GTGGGAGGTGTCTGGATGGCAGG + Intronic
1143048244 17:4100354-4100376 GTGGGATGTGAATGGGTGTGGGG - Intronic
1143156549 17:4840929-4840951 GTGGGAGGAGCCTGGGTGGCTGG + Intronic
1143654589 17:8286525-8286547 GTAGGATGGGAATGGGTGGCAGG - Intergenic
1143756687 17:9072656-9072678 ATGGGAAGTGAGTGGGAGGCAGG + Intronic
1144217486 17:13069132-13069154 TTAGGATGTGGATTGGTGGCCGG - Intergenic
1144309125 17:13996501-13996523 TTCAGTTGTGACTGGGAGGCTGG - Intergenic
1144320320 17:14110983-14111005 TTGGGATGTCAGAGGGTGGTGGG + Intronic
1144477039 17:15597291-15597313 TGGGGATGAGAGTGGGTGGGTGG + Intronic
1144807919 17:17979765-17979787 TTGGGAGGTGGCCGGGAGGCTGG + Intronic
1144921201 17:18766063-18766085 TGGGGATGAGAGTGGGTGGGTGG - Intronic
1146681857 17:34814268-34814290 TTGGCATGTGATTGGGTGTTAGG - Intergenic
1146757446 17:35445832-35445854 TTAGGAGCTGACTGGCTGGCAGG + Intronic
1147579175 17:41618828-41618850 TGGGAATGTGAGTGGGAGGCTGG - Intergenic
1147612130 17:41808085-41808107 CTGGGAGGTGGCTGGGTAGCAGG - Intronic
1148341395 17:46875536-46875558 CTGGGCTGTGACTGGGTGCCAGG + Intronic
1148865916 17:50628535-50628557 TTGGGAGGTGGCTAGGTGACAGG - Intergenic
1150720800 17:67612644-67612666 TTGGGGTGTGGCTGGGTGGATGG + Intronic
1151679073 17:75614464-75614486 TTGGGAGGAGGCTGGGTGGGAGG - Intergenic
1151700343 17:75739587-75739609 TTGGCATGGGGCGGGGTGGCTGG + Intronic
1151858983 17:76744861-76744883 TTGTGGTGTGAGTGAGTGGCAGG + Intronic
1152179234 17:78807465-78807487 TTGGCATGTGTGTGGGTGTCTGG + Exonic
1152744864 17:82033956-82033978 TGGGGATGAGGCTGGGTGGCAGG + Exonic
1154169949 18:12044192-12044214 TGTGGATGTGACTGGCTGTCAGG + Intergenic
1155464342 18:26119402-26119424 TTGGAATGTTTCTGGGTGGAAGG + Intergenic
1157298939 18:46465809-46465831 TTGGGATGTCTATGGGTGGTTGG + Intergenic
1157698871 18:49746736-49746758 TGGGGATGGGACTTGGTGGGAGG + Intergenic
1159264699 18:66065247-66065269 TTTTGATGTGACTTGATGGCTGG + Intergenic
1160586750 18:79917461-79917483 GTGGGAGGTGCCTGGGTGCCAGG - Intronic
1161049642 19:2156336-2156358 TTGATATGTGGCTGGGTGGATGG - Intronic
1162535431 19:11261052-11261074 GAGGGATGAGACTTGGTGGCTGG - Intronic
1163621602 19:18364061-18364083 CTGGGATATGGCTGGCTGGCTGG + Exonic
1164036472 19:21460191-21460213 TTGAAATGTGACTAGGAGGCTGG - Intronic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1164526755 19:29018683-29018705 TTGGGAAGGCACAGGGTGGCAGG + Intergenic
1165315992 19:35055719-35055741 GTGGGATATGATTGGGGGGCAGG - Intronic
1167254416 19:48418697-48418719 TGGGCCTGTGACTGGGTGGATGG + Intronic
1167302340 19:48685487-48685509 CCAGGATGGGACTGGGTGGCTGG - Intergenic
1168449002 19:56448475-56448497 CTGGTATGTCACTGGGTAGCAGG - Intronic
925732027 2:6926084-6926106 TTGGGATGTTACTGAGAGCCAGG + Intronic
927576690 2:24207036-24207058 TAGGGATGGGGCTGGGTGGCAGG + Intronic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
929674437 2:43911405-43911427 TTGTGATGTGAAAGGATGGCAGG + Intronic
930418699 2:51121770-51121792 TTGGGTGATGACAGGGTGGCTGG - Intergenic
930766535 2:55090943-55090965 TTGGGATGTGTCTTGGAGGAGGG - Intronic
931232151 2:60383926-60383948 TTGGGAGGTGACTGGTAGGAAGG + Intergenic
932307908 2:70716830-70716852 TTGGTATATAACTGAGTGGCTGG + Intronic
932692150 2:73922071-73922093 TTGGGTGGTAACTGTGTGGCAGG + Intergenic
934793532 2:97082528-97082550 TTGGGTTGTCACTGTCTGGCAGG - Intergenic
935828721 2:106977119-106977141 TGAGGATGGGACTGGGTGTCAGG + Intergenic
937785093 2:125886935-125886957 TTGGGCGATGACAGGGTGGCTGG + Intergenic
938775524 2:134538171-134538193 TTGGGAGGTGACTAGGTCACGGG + Intronic
939269640 2:139921113-139921135 GTGGGAGGTGACTGGATGGTGGG + Intergenic
942755678 2:179338327-179338349 TTTGGATGTGACTGAGGTGCAGG + Intergenic
944243605 2:197509425-197509447 CAAGGATGGGACTGGGTGGCTGG - Intronic
945775122 2:214097386-214097408 TTGTGATGTGAGGGGCTGGCAGG + Intronic
945818871 2:214638552-214638574 TTGGGAGGTGACTGGGAGTTTGG - Intergenic
947334191 2:229064344-229064366 TGGGGATTTGACTGAGTGGGGGG + Intronic
947749672 2:232525733-232525755 TTGGGATGGGACCTGGTGGGTGG + Intergenic
947924704 2:233911223-233911245 CTGGGAGGTGACTGGGGGACAGG - Intergenic
947931336 2:233967794-233967816 TCGGGGTGTGCCTGGGAGGCTGG + Intronic
948200206 2:236124247-236124269 TTGGGGTGAGAGTGGGTGGGCGG - Exonic
948602709 2:239116393-239116415 TTGGGGTGTGACTGGACAGCTGG - Intronic
948610390 2:239162790-239162812 TTGGGATGTGTCGGGGTAGCGGG + Intronic
948819284 2:240530337-240530359 GTGGGAGGTGACTGGGTCACAGG + Intronic
948853990 2:240721593-240721615 TGGGGATGTGAGTGAGGGGCCGG - Intronic
948897885 2:240935621-240935643 CTGGGATGCGGCTGGGTGGCAGG + Intronic
1169682426 20:8230707-8230729 TTGAAATGTGACTGGCGGGCTGG - Intronic
1169691888 20:8341312-8341334 TTGGGGTGAGACTGGGAGGAGGG - Intronic
1171824108 20:29878834-29878856 TTGGGAGGCGCCTGGATGGCTGG + Intergenic
1172132220 20:32663673-32663695 TTGGGCTGGGGCTGGATGGCAGG + Intergenic
1172435849 20:34928501-34928523 TTGGGATAGGACTGAGTGGTAGG - Exonic
1172950855 20:38722813-38722835 TTGGGATGGGAGGAGGTGGCAGG + Intergenic
1173438705 20:43056288-43056310 GTGGGATGAGAGTGGGTGGAAGG - Intronic
1173469081 20:43308681-43308703 TTGAGATGTGACAGTGTGGATGG - Intergenic
1175712621 20:61233063-61233085 TTGGGATGTGCCTGGGCTGTTGG - Intergenic
1175789477 20:61732460-61732482 ATGGGAGGAGACTGGGGGGCAGG - Intronic
1178305130 21:31484856-31484878 TTCGGAGGTGACTGGGTAGGAGG + Intronic
1179382685 21:40914050-40914072 GTGGGCTGTGGCTGGGTGGAAGG + Intergenic
1179445961 21:41430452-41430474 TGGGAATGGGACTGGGTGGGTGG + Intronic
1179807792 21:43851067-43851089 GTGGGAGGTGACTGGGTCCCGGG - Intergenic
1179906884 21:44427149-44427171 TTGGGGTTTGCCTGGGGGGCAGG + Intronic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1181938063 22:26453058-26453080 TTGGGATGTGTTTTGGGGGCAGG - Exonic
1184158523 22:42684591-42684613 ATGTGATGTCCCTGGGTGGCAGG - Intergenic
1185095333 22:48803275-48803297 TGTGGATGTGTGTGGGTGGCGGG + Intronic
1203223370 22_KI270731v1_random:61716-61738 GTGGGAGGTGACTGGGTCACAGG - Intergenic
949526929 3:4913849-4913871 GTGGGATGTGACTGGCTCACGGG - Intergenic
952700236 3:36320014-36320036 TTAGGATGTGACTGAGGGGGTGG + Intergenic
953628216 3:44588372-44588394 TTGGGAGGTGACTGGATCGTGGG - Intronic
953879780 3:46685699-46685721 TTGGGAGGTGGCAGAGTGGCAGG - Intronic
954452931 3:50581408-50581430 CTGGGAAGTGCCAGGGTGGCAGG - Exonic
954464374 3:50645994-50646016 CTGGGATGTGCCTGGGAGTCCGG + Intronic
955102031 3:55859676-55859698 TGGGGATGTGGGTGGGTGGGAGG - Intronic
955521230 3:59777525-59777547 TTGGGATGTGCCTTGGAAGCAGG - Intronic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
956957652 3:74359064-74359086 CTGGGATGTCACTGGGAGGCAGG + Intronic
957084965 3:75669962-75669984 TTGGGAGGCGCCTGGATGGCTGG - Intergenic
959505592 3:107153039-107153061 CTGGGATGTGTTTGGCTGGCAGG - Intergenic
962482710 3:135811379-135811401 TTGGGAGGTGTCTGGGAGGTGGG + Intergenic
963510001 3:146235231-146235253 GTGGGAGGTGACTGGGTGATGGG + Intronic
964343750 3:155735202-155735224 CTGCGATGTGACTGGGTGGCGGG + Intronic
965744974 3:171915634-171915656 TTTGGATGGAACTGGGAGGCAGG - Intronic
965759766 3:172063337-172063359 TTGGGAGGAGAATGGGTAGCAGG - Intronic
967777995 3:193404510-193404532 ATGGGAGGTGACTGGGTCGTAGG + Intronic
967831892 3:193926781-193926803 TTGGGCGATGACGGGGTGGCTGG - Intergenic
967884105 3:194321807-194321829 TTGGGAAGTGACTGGTAGCCTGG + Intergenic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
967970902 3:194998947-194998969 CAGGGAGGTGTCTGGGTGGCTGG - Intergenic
968044561 3:195616803-195616825 CAGGGATGAGACTGGGTGCCCGG + Intergenic
968589508 4:1450376-1450398 TTGGGCTTTGACTGGGCTGCAGG + Intergenic
971078145 4:23174375-23174397 TTGGGAGGTGACTGGATCACAGG + Intergenic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
971924547 4:32990415-32990437 TTGGGTTGTGACTCGGTGCATGG + Intergenic
973143091 4:46793202-46793224 TTGGAATGTCTCTGGGTGGAAGG + Intronic
973551863 4:52043617-52043639 TTGGGAACTGAGTGGGAGGCAGG - Intergenic
974239262 4:59224680-59224702 TTGGGGTGGGATTTGGTGGCAGG - Intergenic
974486469 4:62512425-62512447 TTGGAATGTGTCTGGGTAGAGGG + Intergenic
974877212 4:67715027-67715049 TGGGGCTGTCACTGGGGGGCTGG - Intergenic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
976003831 4:80403648-80403670 GTAGTATGTGACTGGGTGGCTGG - Intronic
976186732 4:82449624-82449646 GTGGGAGGTGACTGGATCGCGGG - Intronic
977175781 4:93817889-93817911 TTGGGATGCGTCAGGGTGTCTGG - Intergenic
982568289 4:157015075-157015097 TTGGAATGTGGCTGTGTGGTAGG + Intergenic
983369398 4:166839827-166839849 TTGGGCTGTGTCTGAGTGACAGG - Intronic
985185469 4:187310279-187310301 TGAGGATGTGACTGAGTTGCTGG - Intergenic
985445973 4:190021604-190021626 TTGGGAGGCGCCTGGATGGCTGG + Intergenic
985590538 5:762209-762231 CTGGGCTGTGAGTGGCTGGCCGG - Intronic
987374374 5:17219269-17219291 TCGGGAGGGGAGTGGGTGGCTGG - Intronic
987725280 5:21690522-21690544 TTGGGATTGGACTAGGTGGATGG - Intergenic
989138710 5:38181331-38181353 TTGGGATGTGACTGAGTCATGGG + Intergenic
991189456 5:63852575-63852597 ATGGGATGTGACTGGGTCATGGG + Intergenic
992451362 5:76879198-76879220 TTGGGATGTGGATGTGAGGCTGG + Intronic
993787400 5:92160169-92160191 TTGGGAGGTGACTGGATCACGGG - Intergenic
994291266 5:98031161-98031183 TTGGGCGATGACGGGGTGGCTGG + Intergenic
996004829 5:118407056-118407078 TTGGGAGGTGACTGGGTTAGGGG - Intergenic
997774468 5:136588410-136588432 TGGGGATGTGAGTGGGTGGGAGG + Intergenic
997877991 5:137566129-137566151 TGGGGATGTGCGTGGGAGGCTGG - Intronic
998133612 5:139663350-139663372 TTGGGATGTGCCTTTGTGGCAGG + Intronic
998787777 5:145730905-145730927 TTGGAATGTCTCTGGGTGGAGGG - Intronic
999090650 5:148933121-148933143 TTGGGTTGTGACAGTGTGGCTGG - Intronic
999304696 5:150511968-150511990 TGGGGGTGTGACTGGCTGGGAGG + Intronic
999672247 5:153968042-153968064 TTGGGGTGTGACAGGGAGGCAGG + Intergenic
1001339013 5:170826489-170826511 TTGGAATGTCTCTGGGTGGAGGG + Intergenic
1001589282 5:172854530-172854552 TTGGGATGTGGGTAGGTGGGTGG - Intronic
1001902170 5:175441722-175441744 TTGGGATGAGCATGTGTGGCAGG + Exonic
1002442190 5:179270293-179270315 TGGGCATCTGTCTGGGTGGCAGG - Intronic
1002634583 5:180600783-180600805 CTGGGGTGTGAAAGGGTGGCTGG + Intergenic
1004381664 6:15137950-15137972 CTGGGATGTGACCGGGTCTCAGG + Intergenic
1004866779 6:19860423-19860445 TTGAGATGTGACTGTGTGAGGGG - Intergenic
1004919784 6:20365813-20365835 TTGCCATTTGATTGGGTGGCTGG + Intergenic
1005005262 6:21281588-21281610 CTGGGTTGTGACTGGTTGGGAGG - Intergenic
1005010022 6:21327081-21327103 CTACGATGTCACTGGGTGGCAGG + Intergenic
1006390527 6:33755534-33755556 TTCAAATGTGACTGGGTGTCTGG - Intergenic
1006442415 6:34060656-34060678 TTGGGATGGGAGTAGGGGGCAGG + Intronic
1007507534 6:42347605-42347627 TTGGTATTTGCCTCGGTGGCTGG - Intronic
1008063904 6:47027097-47027119 TTGGGATGTTACTATGTGGCAGG - Intronic
1008441946 6:51541845-51541867 TTGAGGTCTGAATGGGTGGCAGG - Intergenic
1009983128 6:70749290-70749312 TTGGGAAGGGACTTGGTGGGAGG - Intronic
1010628574 6:78168925-78168947 TTGGGATGTGATTGGGTCAAGGG + Intergenic
1011806938 6:91082498-91082520 GTGGGCTGTGACTGGGAGGCAGG + Intergenic
1011880446 6:92017369-92017391 TTGGGATGTGAAGGGAGGGCAGG - Intergenic
1013033630 6:106360384-106360406 TTGGCCTGTGACAGGCTGGCAGG - Intergenic
1013487021 6:110607028-110607050 GTGGGAGGTGATTGGGTGGAGGG - Intergenic
1015235943 6:130971191-130971213 TTAGGATGTAACAGGGTGGCCGG - Intronic
1016144399 6:140650198-140650220 TTGGGTGATGACAGGGTGGCTGG - Intergenic
1016404493 6:143716097-143716119 TTGGGATGTCACAGGCTGTCAGG + Intronic
1017774966 6:157673263-157673285 TTAGGATGGCACAGGGTGGCTGG + Exonic
1018050568 6:160005330-160005352 TTGGGAGCTGACTGGGGGCCTGG + Intronic
1019347766 7:539083-539105 TGGGGAGGTGACTGTGTGGCAGG - Intergenic
1020180043 7:5915200-5915222 TTGGGCTGTGACAGACTGGCAGG + Intronic
1020302891 7:6809682-6809704 TTGGGCTGTGACAGACTGGCAGG - Intronic
1023590914 7:41779694-41779716 AGGGGATGTGAGTGGATGGCTGG - Intergenic
1023780500 7:43650937-43650959 TTGGGGTGTGAGTGGTGGGCAGG + Intronic
1024538380 7:50457433-50457455 GAGGGAGGAGACTGGGTGGCAGG - Intronic
1024599213 7:50964708-50964730 GTGGGATGGGAGTGGGGGGCGGG - Intergenic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1025006716 7:55361394-55361416 TTGGGAGGAGACTGGTTTGCAGG - Intergenic
1025007058 7:55363308-55363330 GTGGGAGGTCACTGGGGGGCGGG - Intergenic
1028141836 7:87282776-87282798 TTGGGAGATGACAGGGTGGCTGG - Intergenic
1029417879 7:100454877-100454899 ATGGGATGTGCCTTGGTTGCTGG + Intergenic
1031192465 7:118571413-118571435 TTGGAATGGGACTTGGTGGGAGG - Intergenic
1031267268 7:119597000-119597022 TTGGGATGAGAATAAGTGGCAGG - Intergenic
1031709755 7:125030824-125030846 TTGAGATTTGACTGGGTGCAGGG + Intergenic
1032122580 7:129167970-129167992 CTGGGCTGTCACTGGGGGGCTGG - Exonic
1033365811 7:140672095-140672117 CTGGGCTGTTACAGGGTGGCCGG - Intronic
1034421335 7:150992615-150992637 TTGGGGTGGGCCTGGGTGGGGGG - Intronic
1034685994 7:152972047-152972069 TTGGGATGGGACTGGGTGTGAGG + Intergenic
1035025791 7:155824584-155824606 TTAGGAGGTGACGGAGTGGCTGG + Intergenic
1036810180 8:11862596-11862618 GTGGGTTGGGAATGGGTGGCAGG + Intronic
1037124204 8:15325580-15325602 TTGGGCTGTGCCTGGGAGGAAGG - Intergenic
1037384979 8:18329304-18329326 TTTGGGTGTGAGTGTGTGGCGGG - Intergenic
1037894362 8:22641920-22641942 GTGGGAGGGGACTGGGTGGAAGG + Intronic
1038154066 8:24970912-24970934 TTGGGAGGTGACTGGATGATGGG - Intergenic
1041467124 8:58168012-58168034 TGTGTATGTGACTGGGTGGGGGG - Intronic
1041478483 8:58292277-58292299 TAGGGATCTCACTGGGTGGCAGG + Intergenic
1043329631 8:79099211-79099233 ATGGGAAGTGACTGGGTGTGGGG + Intergenic
1044171724 8:89061520-89061542 TCGGGATGGGACTGGGAGGAAGG - Intergenic
1047339232 8:123964402-123964424 CTGGGTTGTGACAGGATGGCAGG + Intronic
1047659077 8:127012991-127013013 ATGGGAAGTGACTAGGTGCCCGG - Intergenic
1047991615 8:130292402-130292424 CTGGGATGGGATTGGGGGGCAGG - Intronic
1048593372 8:135842185-135842207 TAGGGAGGGGACTGAGTGGCAGG - Intergenic
1049757906 8:144318936-144318958 TGGGGGTCTGAGTGGGTGGCAGG + Intronic
1049795348 8:144494802-144494824 GTGGGCTGTGAGTGGCTGGCAGG + Intronic
1050770615 9:9194498-9194520 CTGTGATGTCACTGGGTGACAGG + Intronic
1051063899 9:13078360-13078382 CTATGATGTCACTGGGTGGCAGG + Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1052528235 9:29649522-29649544 TTGGCCTGTGACTTGGGGGCAGG + Intergenic
1052815436 9:33099608-33099630 TTGGGACGTGACATGGTGGTTGG - Intergenic
1054337272 9:63817943-63817965 TTGGGAGGTGCCCGGTTGGCTGG + Intergenic
1054465071 9:65488445-65488467 TTGGTAGGTGAATGGGTGGATGG - Intergenic
1055785634 9:79866308-79866330 TTGTGCTGTCACTGGGTGGCTGG - Intergenic
1057383539 9:94589209-94589231 TTGGAACGTGAGAGGGTGGCGGG - Intronic
1057975690 9:99603483-99603505 TTGAGATGTGACAGGGAGGAGGG + Intergenic
1058747570 9:108006959-108006981 ATGGCATGTGCTTGGGTGGCTGG + Intergenic
1058923145 9:109637400-109637422 TTTGGATGTGACTGGGGGCAAGG + Intergenic
1060385763 9:123226755-123226777 TTGGGGAGTGAGGGGGTGGCGGG + Intronic
1060586071 9:124786853-124786875 TTGGGATGAGAGTGTTTGGCAGG - Intronic
1061512179 9:131068120-131068142 TTGGCCTGTCACTGGGTCGCAGG - Exonic
1062543646 9:137052448-137052470 TTGGCACATGACTGGGTGGGGGG - Intronic
1203787472 EBV:135993-136015 TTGGGGTATGTCTGGGTGGAGGG - Intergenic
1185610201 X:1389765-1389787 CTGGGATGTTTCTGGGTGGTTGG - Intronic
1186822131 X:13300306-13300328 TTGGGATGGGGGTGGGTGGAAGG - Intergenic
1187686385 X:21819707-21819729 ATGGGAGGTGACTGGGTCACAGG + Intergenic
1187883160 X:23864899-23864921 GTGAGAAATGACTGGGTGGCAGG - Intronic
1190718290 X:53123627-53123649 TTGGGATGGGACTGGGTGCAGGG - Intergenic
1190721328 X:53151206-53151228 TGGGGGTGTTCCTGGGTGGCAGG - Intergenic
1191109717 X:56794900-56794922 TTGTGATGGGACTGGATGGGAGG + Intergenic
1193649876 X:84117951-84117973 TTGGCATGTGTGTGTGTGGCAGG - Intronic
1196652827 X:118186123-118186145 CTGGGAGGTGACAGGGTGGAGGG + Intergenic
1197537376 X:127707272-127707294 TTAGGCTATGACAGGGTGGCTGG - Intergenic
1197746224 X:129933261-129933283 TTGGCATGTGGGTGGGTGGCTGG - Intergenic
1200223850 X:154405700-154405722 TCGGGAGGTCACTGGGAGGCTGG - Intronic