ID: 956078368

View in Genome Browser
Species Human (GRCh38)
Location 3:65530867-65530889
Sequence ATGGAGAGAGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10167
Summary {0: 2, 1: 6, 2: 133, 3: 1470, 4: 8556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956078368 Original CRISPR ATGGAGAGAGAGAAAGAGGA GGG Intronic
Too many off-targets to display for this crispr