ID: 956081755

View in Genome Browser
Species Human (GRCh38)
Location 3:65564734-65564756
Sequence CAGCTAGGGTCTTTAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956081749_956081755 4 Left 956081749 3:65564707-65564729 CCGATGTCCTAACAGTACTCTAA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 956081755 3:65564734-65564756 CAGCTAGGGTCTTTAGCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 99
956081750_956081755 -3 Left 956081750 3:65564714-65564736 CCTAACAGTACTCTAACCTGCAG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 956081755 3:65564734-65564756 CAGCTAGGGTCTTTAGCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956081755 Original CRISPR CAGCTAGGGTCTTTAGCAGA GGG Intronic
901936572 1:12630891-12630913 CAGACAGGTTCCTTAGCAGAAGG + Intergenic
902825813 1:18973466-18973488 CAGGGAGGGTTTTCAGCAGAAGG - Intergenic
903196159 1:21689864-21689886 TGCCTTGGGTCTTTAGCAGAGGG - Intronic
905855912 1:41313786-41313808 AAACTAGGTTCTTCAGCAGACGG - Intergenic
907455501 1:54572754-54572776 CAGATTTGCTCTTTAGCAGAAGG + Intronic
908083032 1:60600783-60600805 GAGATAGGGTCATAAGCAGATGG - Intergenic
912975316 1:114324262-114324284 GAGCTAGGGTCGTTTGCTGAAGG - Intergenic
916340751 1:163731053-163731075 CAGCTTGGGTGATTAGTAGAAGG + Intergenic
922932794 1:229403355-229403377 CTGGTAAGGTCTTGAGCAGAAGG + Intergenic
1063434808 10:6021195-6021217 CATCTAGGGTGCTTAGGAGAGGG + Intronic
1065212683 10:23419507-23419529 CACATAGGATCTTAAGCAGAAGG + Intergenic
1066707749 10:38200133-38200155 CAGCTAGAGTCTAGAGGAGAAGG + Intergenic
1072664025 10:97380991-97381013 CAGCTAGCGTCTGTAGCTCAGGG - Intronic
1073432707 10:103496934-103496956 TGGCTAGGGTCTTTGGCAGAAGG + Intronic
1076741462 10:132487885-132487907 CAGCTCTGGTTTATAGCAGAGGG + Intergenic
1086215953 11:84381754-84381776 CAGAAAGAGTCTTTATCAGAAGG + Intronic
1087013592 11:93535425-93535447 CTGCTAGGGGCTTAAGCAGAGGG + Intronic
1088775178 11:113075552-113075574 TAGCTGGGGTCTTTAGAGGAAGG + Intronic
1089018098 11:115183481-115183503 CAAATAGGGACTTTGGCAGAAGG + Intronic
1096786965 12:54022356-54022378 CATATAGGATCTTTAGCAAAGGG - Intronic
1097815393 12:64068307-64068329 CAGATAGGGTCTGTTGCAGGTGG - Intronic
1098522943 12:71454145-71454167 CAGCTTGCCTCTTTTGCAGAAGG - Intronic
1101228429 12:102713547-102713569 GAGGTAGGGTCTTTAGGAGAAGG - Intergenic
1104791647 12:131486115-131486137 CATCTAAGGCCTTTAGCACAAGG + Intergenic
1105837980 13:24227148-24227170 CAGGTAGGGTGTTTAGTGGAAGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1112428767 13:99331005-99331027 CAACTAGAGTCTCTAGCACATGG - Intronic
1112646551 13:101339603-101339625 CAGCTGGGGCATTGAGCAGAAGG - Intronic
1114646783 14:24260422-24260444 CAGCTGGGGTCTGGAGCAGAGGG - Intronic
1119435311 14:74594551-74594573 CAGCTAGAGGCCTTCGCAGACGG + Intronic
1125474699 15:40039138-40039160 CTGCTAGGGGCTTAAGCGGAGGG - Exonic
1128047222 15:64629229-64629251 TAGATAGGGTCTGTAGCAGCTGG + Intronic
1128839292 15:70836691-70836713 CAACTAGGGTCCTTACCAAAGGG + Intronic
1128920246 15:71603681-71603703 CAGGTAGGGTCTTTGGAAGGGGG + Intronic
1134110524 16:11512820-11512842 CAGCTAGTTTCTGTAGCTGAGGG + Intronic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1143630248 17:8135143-8135165 CAGCTAGGGTCTACAGCCAAAGG - Intergenic
1143768377 17:9152275-9152297 CAGCAGGGGGATTTAGCAGAGGG - Intronic
1144826301 17:18107548-18107570 CAGCCAGGGCCTAAAGCAGATGG + Exonic
1144864568 17:18326874-18326896 CAGCCAGGGGGTTTATCAGAAGG + Intergenic
1150238640 17:63613900-63613922 CAGCCAGGGCCTCTAGCAGAGGG - Intergenic
1151595609 17:75076525-75076547 CAGCCAGGGTCTCTGGCAGCTGG - Intergenic
1161614096 19:5260541-5260563 CAGGTAGGGTCCTTCCCAGAGGG + Intronic
1164905946 19:31968179-31968201 CAGCTTGTGTCTTTTGCAGAGGG - Intergenic
930061347 2:47291660-47291682 CAGCAAGGGTCTTTAGATAAAGG + Intergenic
930222182 2:48755904-48755926 TAGCTAGGGCCATTTGCAGATGG - Intronic
931743956 2:65275201-65275223 AAACTAGGGCTTTTAGCAGATGG + Intergenic
933048399 2:77569057-77569079 CAGCTAGGGTGTTTACCATTAGG + Intronic
937431987 2:121846530-121846552 CCCCTAGAGTCTTTGGCAGATGG - Intergenic
937668290 2:124512103-124512125 CAGCAAGGGTCTTTGGCTGTGGG + Intronic
942426770 2:175868429-175868451 CAGCACGTGTCTTCAGCAGAGGG + Intergenic
944863926 2:203842039-203842061 CAGCTAGGGTCCTTTGCTCATGG + Intergenic
1172208791 20:33182971-33182993 GAGCTGAGGTCTTCAGCAGAGGG - Intergenic
1177086000 21:16704752-16704774 TAACTTGGGTCTTTAGCAGTAGG - Intergenic
1178846485 21:36178115-36178137 AAGGTAGGATCTTTGGCAGATGG + Intronic
1182905250 22:33930362-33930384 CAGCAAGGATGTTAAGCAGAAGG + Intergenic
951616180 3:24547313-24547335 CAGTTAGTGTCATTTGCAGAAGG - Intergenic
951845872 3:27083560-27083582 CACCTCTGGTCTTTACCAGACGG + Intergenic
952323009 3:32295725-32295747 CTGCTAGGGGTTTAAGCAGAGGG - Intronic
954276759 3:49547202-49547224 TGGATAGGGTTTTTAGCAGAGGG - Intergenic
956081755 3:65564734-65564756 CAGCTAGGGTCTTTAGCAGAGGG + Intronic
962462023 3:135622942-135622964 GAGCTATGGTCTTTAGTAGAAGG + Intergenic
964662030 3:159130879-159130901 CAGCTTGGATCAATAGCAGAAGG - Intronic
968939295 4:3629821-3629843 CAGCCAGGCTCTGGAGCAGAGGG - Intergenic
972142425 4:35977211-35977233 CAGCCAGTTTCTTTATCAGATGG + Intronic
977979073 4:103301625-103301647 CACCTAAGGTATTTAGCACACGG + Intergenic
981044953 4:140256425-140256447 CAGCCAGTGTCTTGAGCAGGAGG - Intergenic
984621944 4:181963696-181963718 CTGCTAGGGGCTTTTGAAGATGG - Intergenic
985589520 5:757348-757370 CACGTAGGGATTTTAGCAGAAGG + Intronic
987862961 5:23508701-23508723 CAGCTAGGCTCATTTGGAGAAGG - Intronic
990169781 5:53035124-53035146 CAACTAGGTGCTTTGGCAGATGG - Intronic
990667273 5:58087314-58087336 CTGCTAGGGCCTTTCACAGAAGG + Intergenic
993729986 5:91410927-91410949 CTGCTAGGGTCTTCAGGAGTTGG + Intergenic
995020260 5:107359461-107359483 CAGCTGTGTTCTTTAGCAGAGGG + Intergenic
996131421 5:119785846-119785868 CAGCTAGGCTCTCTAGAAAAAGG - Intergenic
998097173 5:139402690-139402712 CAGCCAGGCTCTGTTGCAGATGG - Exonic
1003525034 6:6890413-6890435 CAGCCTAGGTCTTCAGCAGAGGG + Intergenic
1007275893 6:40673440-40673462 GAGAAAGGGTCTTTAGGAGAAGG - Intergenic
1007983177 6:46179985-46180007 CAGCAAGCCTCTTTTGCAGAAGG + Intergenic
1008780884 6:55103346-55103368 CAGGTAGGGCCTTTAGGAGGTGG - Intergenic
1012051398 6:94349648-94349670 CAGTCAGGGTCTTTATCAGCAGG - Intergenic
1014109265 6:117602309-117602331 CGGCGAGGGTCTTCAGCAGTCGG - Exonic
1015966543 6:138699741-138699763 CAGCTATGTTCTCTAGTAGAAGG + Intergenic
1019190532 6:170248224-170248246 CAGCCAGGGTCTTTACAACACGG + Intergenic
1020498116 7:8882121-8882143 CAGCTAAGGGCTTTAACAGCTGG - Intergenic
1021932108 7:25591645-25591667 CTGCTAGGCTCTTTAACAGGAGG - Intergenic
1032954493 7:136954896-136954918 GAGCTGTGGTCTTTAGCAGAGGG - Intronic
1036563296 8:9916306-9916328 CAGCTATGGTCTTTTTCAGGTGG - Intergenic
1041271596 8:56114142-56114164 CAGCAAGAGTTTTTATCAGATGG + Intergenic
1042107835 8:65347990-65348012 CAGCAGGGGTCTCTAGGAGAGGG + Intergenic
1043050359 8:75377586-75377608 CAGGTAGGCTCTATAGCAGCAGG - Intergenic
1045725948 8:105173884-105173906 CATCTAGAGTTTTTAACAGAAGG - Intronic
1047532427 8:125689116-125689138 GAGGTAGGATCTTTAGGAGATGG - Intergenic
1050431770 9:5569398-5569420 GACCTATGGTCTTTAACAGAGGG + Intronic
1050925241 9:11256190-11256212 CAGCTTTGTTCTTTAGCACAGGG + Intergenic
1051833871 9:21312088-21312110 GAGCTAGGGCCTCTGGCAGAGGG + Intergenic
1052980871 9:34448342-34448364 CTGCTATGGTCTTCAGCAGGGGG - Intronic
1054451462 9:65405503-65405525 CAGCCAGGCTCTGGAGCAGAGGG + Intergenic
1056692737 9:88822196-88822218 CAGCTAGAGGCTTTGGCAGCTGG - Intergenic
1057900188 9:98942710-98942732 CAGCTAAAGCATTTAGCAGAGGG + Intergenic
1058585640 9:106503843-106503865 TAGCAAGGGTCTGTAGCTGATGG - Intergenic
1191668484 X:63727190-63727212 CAGATAGTGTCCTGAGCAGAAGG - Intronic
1192545480 X:72009232-72009254 GAGCTATGGCCTTTGGCAGAGGG + Intergenic
1194275510 X:91875864-91875886 CAGCTAAAACCTTTAGCAGATGG - Intronic
1197596068 X:128465540-128465562 CAGCTATGGTCTATATCACATGG + Intergenic
1199578891 X:149341915-149341937 CAGCCAGAGTCATTGGCAGATGG + Intergenic
1199618391 X:149677386-149677408 CAGCTTTGTTCTTTAGCACAGGG + Intergenic
1199624251 X:149725863-149725885 CAGCTTTGTTCTTTAGCACAGGG - Intergenic
1200592756 Y:5097294-5097316 CAGCTAAAACCTTTAGCAGATGG - Intronic