ID: 956082360

View in Genome Browser
Species Human (GRCh38)
Location 3:65571148-65571170
Sequence CAAATGCACCTGCCTGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956082357_956082360 -6 Left 956082357 3:65571131-65571153 CCAGAAAATGAAAAACCCAAATG 0: 1
1: 1
2: 4
3: 56
4: 530
Right 956082360 3:65571148-65571170 CAAATGCACCTGCCTGCATTAGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956082360 Original CRISPR CAAATGCACCTGCCTGCATT AGG Intronic
900276259 1:1830874-1830896 CCATTGCACCTGGCTGCATCAGG - Intronic
901533456 1:9867618-9867640 CAAATGCTCCAGGCTGCTTTAGG - Intronic
901740284 1:11337751-11337773 AAAAAGCACCTGCTTGCATGGGG - Intergenic
902180618 1:14685531-14685553 CAAATGCTCTTGGCGGCATTCGG + Intronic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
905863581 1:41365340-41365362 CAATTTCACCTCCCTGCCTTTGG - Intronic
905964305 1:42078539-42078561 TAACTGCTCCTGCTTGCATTAGG + Intergenic
908052165 1:60245274-60245296 CAAAGTCACCTTCATGCATTTGG - Intergenic
908261680 1:62344066-62344088 GAATTGCAACCGCCTGCATTCGG - Intergenic
908509626 1:64841105-64841127 CGAAAGCACCTTACTGCATTTGG - Intronic
910866240 1:91790726-91790748 CATATGCACAGGACTGCATTAGG + Intronic
911446257 1:97996568-97996590 CAAACTCACCTGCCAGCAATTGG + Intergenic
914938802 1:152003953-152003975 CCAGTGCTCCTCCCTGCATTTGG - Intergenic
915102427 1:153509947-153509969 CAAATGCACCGGCCTCCCTGCGG - Intergenic
916027734 1:160849144-160849166 GAAATCCACCTCCCTGCATTTGG + Intronic
917231059 1:172838654-172838676 CAAATGCACATTCTTGCTTTGGG - Intergenic
918310618 1:183282741-183282763 CAAATGCTCCTGCCTGTTTTGGG + Intronic
1064422912 10:15205674-15205696 CAAAAGAACTTGCCTGGATTTGG + Intergenic
1068226852 10:54117307-54117329 CAGATGCAGGTGCCTGCATCTGG - Intronic
1069412958 10:68171626-68171648 CAAATGAACCTTGCTGCTTTAGG - Intronic
1069779882 10:70948574-70948596 GAAATGTACCTGCATGCATAGGG - Intergenic
1069838849 10:71326780-71326802 CATCTGCACCTGCCAGCAGTTGG - Intronic
1071213272 10:83368932-83368954 CAAAGGCAGGTGCCTGTATTTGG - Intergenic
1072683715 10:97524571-97524593 GAAATGCACCTGCCTTCATAGGG - Intronic
1075118940 10:119650886-119650908 CAAACTCACCTGCCTTCCTTTGG - Intergenic
1077787559 11:5401112-5401134 GAAAACCACCTGCCTGGATTGGG - Intronic
1081422312 11:42883367-42883389 CAGGTGCACATGCCTTCATTGGG + Intergenic
1087423756 11:97965113-97965135 CAAATGCAACTACCTACACTGGG - Intergenic
1090947675 11:131446317-131446339 CAAATTCACCAGCCTGCAGATGG + Intronic
1093672566 12:21894957-21894979 CAAATGTACCAGCATACATTTGG + Intronic
1095802233 12:46281312-46281334 CACCTGCACATGCCTGCAGTGGG + Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1097619212 12:61919892-61919914 AAAATGCATTTGCCTGAATTAGG - Intronic
1099948398 12:89271942-89271964 CAAATTAATATGCCTGCATTTGG + Intergenic
1101659426 12:106752812-106752834 CCATTGCACTTGGCTGCATTTGG + Intronic
1104479464 12:129095245-129095267 CAAATGAATCTGACTGTATTTGG + Intronic
1104750392 12:131234752-131234774 CAAATGCAGCTGCTTCCATTTGG - Intergenic
1104782328 12:131429710-131429732 CAAATGCAGCTGCTTCCATTTGG + Intergenic
1106224755 13:27776404-27776426 CAAATTAACCTCCCTCCATTAGG - Intergenic
1107016660 13:35712957-35712979 AAAATCCTCCTGGCTGCATTTGG + Intergenic
1115581347 14:34761955-34761977 CAAATACATCTGCTTGCAGTGGG + Exonic
1117872084 14:60211674-60211696 AAAATGCACCTGCCAGTTTTTGG + Intergenic
1118673863 14:68161435-68161457 CACATGCACATCCCTGCACTAGG + Intronic
1120543960 14:85786477-85786499 CAAGTGCACCTTCCTGAATAAGG - Intergenic
1121660218 14:95629530-95629552 CTAATTAACCTGCCTGTATTTGG - Intergenic
1122429167 14:101629039-101629061 CAAATGCACGTGCCTGGAACAGG - Intergenic
1124394272 15:29287301-29287323 CAAATAGCCGTGCCTGCATTCGG + Intronic
1128674871 15:69601076-69601098 CAAATGCCAAGGCCTGCATTTGG - Intergenic
1128797100 15:70474084-70474106 CAAAAGCCCCTGCCAGCCTTTGG - Intergenic
1129288188 15:74541909-74541931 CAATGCCACCTGCCTACATTTGG - Intronic
1135809946 16:25577944-25577966 CAAATGATCCTGCCTGCCTCAGG + Intergenic
1145112525 17:20176377-20176399 GAGAAGCACCTGTCTGCATTTGG - Intronic
1145294727 17:21579068-21579090 CAAATGCCCCTTCCTGCTTCTGG - Intergenic
1145369107 17:22294106-22294128 CAAATGCCCCTTCCTGCTTCTGG + Intergenic
1147833220 17:43311769-43311791 CCACCGCACCTGGCTGCATTTGG + Intergenic
1147903725 17:43808726-43808748 CAAAGCCACCTGCCTGGTTTGGG + Intronic
1148251009 17:46080341-46080363 TAAATACACCTACCTCCATTTGG + Intronic
1148527011 17:48348726-48348748 CCAAAACACCTGCCTGGATTTGG + Intronic
1149129550 17:53281688-53281710 CAAAAGCACATGCCCTCATTAGG - Intergenic
1151194968 17:72424847-72424869 CATATACTCCTGCCTGCTTTGGG + Intergenic
1153994240 18:10425993-10426015 AAAATGCAGCTGCCTTCATCAGG + Intergenic
1155620030 18:27767939-27767961 CAAAGGGACCTGCCTGTCTTTGG + Intergenic
1156222161 18:35063641-35063663 CAGATGAACTTGCCTGAATTTGG + Intronic
1156252290 18:35362265-35362287 CAATTCCACTTGCCTGCTTTTGG - Intergenic
1156306090 18:35879349-35879371 CAAATGCAACTGCCTACGCTGGG + Intergenic
1156731525 18:40199149-40199171 CAAATGCATTTGCCTTGATTTGG + Intergenic
1159252026 18:65891894-65891916 CAAATGCACCTCCCAGAATCAGG + Intergenic
1159585888 18:70283408-70283430 CAAATGCAGCTGCCTGATATTGG + Intergenic
1159953766 18:74505309-74505331 CCACTGCACCTGGCTGGATTTGG - Intronic
1160265394 18:77337353-77337375 CACATGCACCTGCCTGGAGGAGG + Intergenic
1161116808 19:2501787-2501809 CAAATGCATCTCCTTGGATTTGG + Intergenic
1163249674 19:16119045-16119067 CAAAGGCACTTGCCTGGTTTGGG - Intronic
1167210542 19:48131408-48131430 CACATGCACCTTGCTGCATGTGG + Intronic
1168116271 19:54222738-54222760 CAGACTCACCTGCCTGCATGCGG + Exonic
1168181085 19:54663554-54663576 CAGACTCACCTGCCTGCATGTGG - Exonic
1168185317 19:54696626-54696648 CAGACTCACCTGCCTGCATGCGG - Intronic
926267088 2:11333506-11333528 AAAAAGCACCTGCATGTATTAGG + Intronic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
939207529 2:139126642-139126664 CAAATTCACTTGCATGCTTTTGG - Intergenic
940620324 2:156104586-156104608 TTTATGCACCTGCCTGTATTAGG + Intergenic
941761103 2:169244511-169244533 CAAAGGCACGTGCCTGCACATGG - Intronic
946223480 2:218248953-218248975 GAAATGCAGCTGCCTGTCTTAGG - Intronic
946755760 2:222945806-222945828 CAAAAGCAACTTCCTGCATTTGG + Intergenic
948358417 2:237399179-237399201 CAAGTTCACCAGCCTGAATTTGG + Intronic
1169637438 20:7707907-7707929 CAACTACACCTGTCTGCAGTAGG + Intergenic
1169777156 20:9268024-9268046 CAGATGCAGCTGCCTGACTTGGG + Intronic
1170115001 20:12848031-12848053 CAAAAGCTCCTGCCTCCATCTGG - Intergenic
1170599875 20:17833603-17833625 CCACTGCACCTGGCTGAATTGGG - Intergenic
1172263304 20:33588121-33588143 CATATACACCTCCATGCATTTGG + Intronic
1177027177 21:15934145-15934167 CCACTGCACCTGGCTGGATTGGG - Intergenic
1179813315 21:43885983-43886005 CAAAAACCCCTGCCTGTATTTGG - Intronic
1182108749 22:27707721-27707743 CGAACCCACCTGCCTGCCTTCGG + Intergenic
1183666114 22:39246809-39246831 CAAAGGCAGGGGCCTGCATTAGG - Intergenic
955329156 3:58032664-58032686 AAAATGGACCTGCTTGAATTTGG - Intronic
955724272 3:61916093-61916115 CAAATGTAACTGACTGCATTTGG - Intronic
956082360 3:65571148-65571170 CAAATGCACCTGCCTGCATTAGG + Intronic
956088041 3:65634501-65634523 CAAATTCACCAGCTTGCCTTGGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
959781147 3:110234682-110234704 CAAATGCACTTGTCACCATTTGG - Intergenic
960287402 3:115844998-115845020 CAAATGCACTTCCCTGCCTTGGG - Intronic
961158377 3:124700375-124700397 TAAATGTACCTCCCTGCATGAGG + Intronic
966063854 3:175793007-175793029 CAAATGTACGTGCCAACATTTGG + Intronic
971224198 4:24736234-24736256 CAAATGCAAATGCCTCCAGTAGG + Intergenic
971485492 4:27156148-27156170 CAAATGCATGTGCCTTCATCAGG - Intergenic
977327970 4:95601414-95601436 CGCATGCACCTGCCTGAATTAGG + Intergenic
979919463 4:126479453-126479475 CAAATGCGCCTGCGGCCATTGGG - Intergenic
980685619 4:136224002-136224024 CAAAATCACCTGCCTTCATTGGG - Intergenic
982073819 4:151719257-151719279 CAGGGGCACCTGCCTGCATCAGG + Intronic
985323335 4:188738884-188738906 GACATGCATCTGCCAGCATTGGG + Intergenic
985752994 5:1693166-1693188 CAAATACACATCCCTGCATGAGG + Intergenic
986625557 5:9720617-9720639 GAACTGCACCTGTCTGCAGTAGG + Intergenic
987884383 5:23794722-23794744 AAAATCCACCTGCCTGTCTTTGG + Intergenic
993706077 5:91172342-91172364 CAAATGCAGGTGCTGGCATTGGG - Intergenic
996985556 5:129558766-129558788 AAAATGCAGTTGCCTGTATTTGG + Intronic
998441906 5:142169668-142169690 CAAATCCACCTGGCTCCAGTCGG + Intergenic
999267710 5:150277651-150277673 AAAATGCACTTGCTTACATTGGG - Intronic
1000704127 5:164489880-164489902 AAAATGCCCCTGCATGCCTTAGG - Intergenic
1002304206 5:178273851-178273873 CAGATGCACCTACCTGGCTTGGG + Intronic
1007122948 6:39398636-39398658 TAGAAGCACCTACCTGCATTTGG - Intronic
1007356898 6:41326838-41326860 TAAATGTATCTGACTGCATTGGG + Intergenic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1013237449 6:108209829-108209851 GAAAAGCACCTTCCTCCATTAGG + Intergenic
1017312895 6:152994645-152994667 GACATGCATCTGCCAGCATTGGG - Exonic
1023030537 7:36086873-36086895 TAACTTCACCTGCCTGCATGGGG + Intergenic
1025123486 7:56326851-56326873 CAAGTGCACTTCACTGCATTTGG + Intergenic
1026844462 7:73690290-73690312 CCAATGCACCTGGCTGCTTGAGG + Intronic
1028447715 7:90944148-90944170 CAGATGCAGCTGCCTGATTTTGG + Intronic
1032027267 7:128453868-128453890 CAAATGTAGCTACCTGCATCAGG - Intergenic
1032898327 7:136277565-136277587 CAAATTCTCCTGCCTGCCTGAGG - Intergenic
1038235849 8:25753908-25753930 CAAATGCACATGGTAGCATTGGG - Intergenic
1038529908 8:28310111-28310133 CAATTTCACATGCATGCATTGGG - Intergenic
1041798746 8:61774972-61774994 CAGATGCCCCTGGCAGCATTGGG + Intergenic
1041869882 8:62620559-62620581 CAAATGCACTTGCCTCTTTTGGG - Intronic
1043353153 8:79385791-79385813 CTAATGCAGCTGACTTCATTTGG + Intergenic
1044263855 8:90160019-90160041 CCACTGCACCTGACTGCATCAGG - Intergenic
1044449117 8:92313537-92313559 GAAAGGCACCTGCCTGTATGAGG + Intergenic
1047216701 8:122881860-122881882 CAAAAGTACCTGCATTCATTTGG + Intronic
1048434679 8:134405154-134405176 AAATTGCACCTGCCAGCAATAGG + Intergenic
1049854007 8:144850305-144850327 CAAAAGCACCTGGCTACATGGGG + Exonic
1057806364 9:98222608-98222630 CAAATTCACATCCCTGCTTTGGG - Intronic
1060210158 9:121705428-121705450 CATATGCAATTGCCTGTATTTGG - Intronic
1060600976 9:124877209-124877231 CAGATGCACCTGTGTGCACTGGG + Exonic
1062496105 9:136832516-136832538 CTACTGCACCTGCCTGCTCTGGG + Intronic
1187062529 X:15801114-15801136 CAAATGCACATTTCTGAATTAGG + Intronic
1187275266 X:17811282-17811304 CAAGTGCCCATCCCTGCATTGGG + Intronic
1188001121 X:24983151-24983173 CAAAAGTGCCTGCCTTCATTAGG - Intronic
1190415576 X:50177220-50177242 CTAATGCACTTGTCTCCATTGGG - Intergenic
1191134575 X:57049707-57049729 CAAATGCTGCTGCCTGCCTCTGG - Intergenic
1193206641 X:78756081-78756103 CAAATGTATCTGACTGGATTTGG - Exonic
1195220871 X:102745015-102745037 AAAAAGCACATGCATGCATTAGG + Intronic
1198400269 X:136262060-136262082 CAAATCCCTCTGCCAGCATTTGG - Intergenic
1199238124 X:145513589-145513611 CAAATGCACTGGGCTGAATTGGG - Intergenic
1199689924 X:150301528-150301550 CAAATGCACCTGTCTGGTGTAGG - Intergenic