ID: 956085462

View in Genome Browser
Species Human (GRCh38)
Location 3:65604379-65604401
Sequence TAGCAAATACTGCTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956085462 Original CRISPR TAGCAAATACTGCTGGAGAA AGG Intronic
901659100 1:10787566-10787588 CAGCAATTAGTGCTGGGGAAGGG + Intronic
903459584 1:23511198-23511220 GAGCATAGAGTGCTGGAGAATGG - Intronic
903880000 1:26501648-26501670 TTGCAAAGACTGCACGAGAAAGG - Intergenic
905293107 1:36936597-36936619 GAGTAAATAAAGCTGGAGAATGG - Intronic
906004582 1:42457428-42457450 TAGCGAATACAGATGCAGAAAGG - Intronic
907265799 1:53260041-53260063 TAGCTTATACTACTGCAGAATGG + Intronic
908224484 1:62042198-62042220 TAGCATATGCTGTTAGAGAAAGG - Intronic
909758041 1:79252145-79252167 TAACAAATAATGGTGAAGAAGGG - Intergenic
909849495 1:80442474-80442496 TAGCAAACACTGCTGTCTAAAGG + Intergenic
911187924 1:94921939-94921961 TCCTGAATACTGCTGGAGAAGGG - Intronic
917513208 1:175685322-175685344 AAGCAAATCATGGTGGAGAAAGG - Intronic
919380928 1:196860154-196860176 TAGCATATACTGTATGAGAAAGG - Intronic
920229128 1:204458904-204458926 AAGCACAGGCTGCTGGAGAAGGG + Intronic
920361287 1:205418338-205418360 TAGAAACCACTGCAGGAGAATGG + Intronic
920710979 1:208294749-208294771 TAGGGAATACTTGTGGAGAATGG + Intergenic
921082838 1:211756833-211756855 AAGCAAACACTGTTGTAGAAGGG - Intronic
922199593 1:223390724-223390746 TCCCAAATGCAGCTGGAGAAAGG - Intergenic
1062867473 10:868163-868185 GAGTAATTAATGCTGGAGAAGGG + Intronic
1063075460 10:2712165-2712187 GAGCACATAATGTTGGAGAAGGG + Intergenic
1063975259 10:11410048-11410070 TAGAAAATGCTGCTAGAGAAAGG - Intergenic
1064489055 10:15830832-15830854 AAGGAAATTCTGCTGGTGAAAGG + Intronic
1067856532 10:49798359-49798381 TCTCATATACTGCTGGCGAAAGG + Intergenic
1068308310 10:55244610-55244632 TAGAAAATTCTGGTGGAGGATGG - Intronic
1073020082 10:100435999-100436021 CAGTAAATACCTCTGGAGAATGG + Intergenic
1073032897 10:100542047-100542069 TATCAGATACTGCAGGAAAAAGG + Intronic
1075361596 10:121841201-121841223 AAGCCAGTACTGCTGGTGAAAGG + Exonic
1079084995 11:17439030-17439052 GAGCATAAACTCCTGGAGAACGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1083020286 11:59499916-59499938 TAGCAAATATTGATGGAGTATGG - Intergenic
1083439565 11:62666797-62666819 TTCCAACTACTGCTGGACAAAGG + Exonic
1084981585 11:72831762-72831784 GAACAAATAATGCTGCAGAAAGG - Intronic
1087258222 11:95980725-95980747 GGGCAAATACTGCTGGAGAGAGG - Intronic
1087485699 11:98757725-98757747 AAACAAATATTACTGGAGAATGG - Intergenic
1087651192 11:100870428-100870450 TAGCAAATTCTTCTGCAGCAGGG - Intronic
1088489580 11:110373819-110373841 AAACAAATACTTCAGGAGAAAGG + Intergenic
1088841979 11:113635070-113635092 TTTCAAAGCCTGCTGGAGAAGGG - Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089379613 11:118018353-118018375 TAGGGAATGATGCTGGAGAAGGG + Intergenic
1092493664 12:8970074-8970096 TAGCCCAGACTGGTGGAGAATGG - Intronic
1095926284 12:47582852-47582874 TAGCACCAGCTGCTGGAGAATGG - Intergenic
1097916272 12:65023458-65023480 AAGCAGATACTCCTGGTGAATGG - Intergenic
1099256749 12:80323927-80323949 TAGCATATACAACTTGAGAATGG - Intronic
1100468253 12:94867895-94867917 GAGCATATACTGTTGGAAAATGG - Intergenic
1100912095 12:99376497-99376519 TAGGAAATGCTGCTGAGGAAAGG + Intronic
1103327630 12:120131927-120131949 CAGCAAGCACTGCTGTAGAACGG + Exonic
1104548985 12:129738738-129738760 AAGCAAATACTCCTTGAGCACGG + Intronic
1104703751 12:130927087-130927109 GAGAATATACTTCTGGAGAATGG - Intergenic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1105662140 13:22508344-22508366 TCACAACCACTGCTGGAGAATGG - Intergenic
1105821991 13:24087992-24088014 TACTAAATACAGCTGGACAAAGG - Intronic
1106156195 13:27159028-27159050 TAGCAATTACTTCTTGGGAAAGG + Intronic
1106283681 13:28300219-28300241 AAGCAAATGCTGCTGAAGAGAGG - Intergenic
1107060894 13:36158563-36158585 TGGCAAATAATGCTGGACCACGG - Intergenic
1108769570 13:53682302-53682324 TGGCAAATACTACTGGATGAAGG - Intergenic
1108809337 13:54202108-54202130 TAACCAAAACTGCTGGATAATGG + Intergenic
1109514164 13:63419570-63419592 AAGCAAATACTTCTGGATTAGGG + Intergenic
1113015477 13:105823860-105823882 GAGCAAATAGAGCTAGAGAAAGG - Intergenic
1113109893 13:106811908-106811930 TAGCAAGCATGGCTGGAGAATGG + Intergenic
1115300246 14:31877256-31877278 CAGCAAAAAGTGCTGAAGAAAGG - Intergenic
1122735481 14:103837415-103837437 TAGAAAATACTGCTTGAGAAAGG - Intronic
1126156493 15:45570327-45570349 TAGGAAATACTGCAGGAGCTGGG - Intergenic
1126456459 15:48867291-48867313 TAGGAAATGCTACTGGAGACAGG + Intronic
1127135673 15:55920666-55920688 TAGCAAATTCTCTTGGAAAATGG - Intronic
1127291012 15:57571193-57571215 TAGCATATAGAGCTGGACAAAGG + Intergenic
1127897066 15:63310543-63310565 TGTCAAATGCTGCTGGATAATGG + Intergenic
1128341673 15:66826656-66826678 TGGCAAATCCTGCTGGAAACTGG - Intergenic
1130376129 15:83330554-83330576 TAGCCATTACTTCTTGAGAAGGG + Intergenic
1131037530 15:89233414-89233436 TAGCAAATACTTATGAAGCATGG + Intergenic
1131488926 15:92845041-92845063 TACCAGGTACTACTGGAGAAAGG - Intergenic
1133716607 16:8455881-8455903 TAGCAAATGCTGGTGGAGGTAGG - Intergenic
1133952241 16:10405574-10405596 TATCACATCCTGCTGGACAAAGG + Intronic
1134816994 16:17213973-17213995 TGAGAAATACTGCTTGAGAAGGG - Intronic
1138684594 16:58713995-58714017 TAGAAAACACTGCTGTAGAAAGG - Intronic
1140607935 16:76563586-76563608 TACCATCAACTGCTGGAGAAGGG - Intronic
1140770403 16:78198477-78198499 CAATAAATACTGATGGAGAATGG + Intronic
1141374762 16:83520387-83520409 TAGGAAAGCCTGCTGGAGACTGG + Intronic
1141382225 16:83586708-83586730 GTGCAAATAATGCTGAAGAAAGG + Intronic
1142947992 17:3450880-3450902 GAGCACATACTGTTGGAAAATGG + Intronic
1143675603 17:8430291-8430313 TAGCAAAAAATGCTGGCCAAAGG + Intronic
1144406356 17:14956244-14956266 AAGAAAATATTGCTGAAGAAGGG + Intergenic
1144435887 17:15240337-15240359 AAGAAAATACTGATGAAGAAAGG + Intronic
1145373033 17:22323115-22323137 TATCACATCCTGCTGGGGAAAGG - Intergenic
1146381836 17:32336100-32336122 TAGAAGATACTGCAGGAGAGAGG - Intronic
1147795829 17:43042118-43042140 TATCAAAGACTACTGGAAAATGG - Intergenic
1149360484 17:55889807-55889829 AACCAAATACTGCTAGAGACTGG - Intergenic
1150134016 17:62685570-62685592 TCTCAAAAACTGCTGGAGTATGG + Intronic
1150431809 17:65124265-65124287 AAGCAAATAATGCAAGAGAAAGG + Intergenic
1150661459 17:67083838-67083860 TAGTAAATGCTTGTGGAGAAAGG - Intronic
1150781549 17:68127053-68127075 GAGCAAATACTTCTGGAAAAGGG + Intergenic
1153564323 18:6404533-6404555 TAGCATATCCTTCTGTAGAATGG - Intronic
1155698312 18:28711236-28711258 TAGTGATTACTGCTGGAGAGGGG - Intergenic
1158923870 18:62229841-62229863 AAGCAAATAATGCTAGTGAAAGG + Intronic
1159174911 18:64819804-64819826 TAGCAAATAATGCAGGATCAGGG - Intergenic
1159250991 18:65876198-65876220 TAGGAAATAGTGCTGGATATTGG - Intronic
1159488346 18:69095482-69095504 AAGCAAATACTGCAGCAGAAAGG - Intergenic
927384211 2:22514568-22514590 TGACAAATACTGTTGGAAAATGG - Intergenic
928734844 2:34276249-34276271 CAGCAAAAACTGCTAAAGAAAGG + Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
930754024 2:54958007-54958029 TAGCAGATACTCCCTGAGAAGGG + Intronic
934057409 2:88263239-88263261 CAGGAAATACTTCTGCAGAAAGG + Intergenic
934060485 2:88287787-88287809 TAGCAAGAACAGCTGGAGGAAGG - Intergenic
934544820 2:95206126-95206148 TTGGAGATTCTGCTGGAGAAAGG + Intergenic
935216871 2:100981671-100981693 TAGCAAGTAAGGCTGGAGAGGGG + Intronic
935525573 2:104162724-104162746 TATCAAGTACTGCTGGGGAGAGG - Intergenic
936710679 2:115127376-115127398 TAGCAGCTACTGCTGCAGTATGG + Intronic
937940216 2:127279445-127279467 AAGCTAATTCTGCTAGAGAAAGG - Intronic
939684330 2:145179390-145179412 TAGCAAATTCTGCTAAAGAGTGG + Intergenic
940053304 2:149487040-149487062 TAGCAGTTATTGCTGAAGAATGG - Intergenic
941069978 2:160944868-160944890 TAGCACATAAGGCTGGAGAAGGG + Intergenic
941265533 2:163357008-163357030 TAGGAAAGACTGCAGGAAAATGG + Intergenic
941435900 2:165471716-165471738 TAGGAAATGCTGATTGAGAAAGG - Intronic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945246895 2:207726501-207726523 TAAAAAATACTGCTGGATGATGG + Intronic
947446374 2:230166708-230166730 TAAATAATACTGTTGGAGAAGGG + Intergenic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1171547082 20:26010753-26010775 TATCACATCCTGCTGGGGAAAGG - Intergenic
1173672502 20:44808747-44808769 CAACAAATTCTTCTGGAGAAAGG + Intronic
1175311564 20:58015291-58015313 TAGCAAATACTGGTGTGGGATGG - Intergenic
1176902645 21:14461889-14461911 TAGCAAATACAGCCAGAGCAAGG - Intergenic
1180025222 21:45156960-45156982 TGGCAGACACTGCTAGAGAATGG - Intronic
1182111186 22:27724945-27724967 CAGCAAATGGTGCTGGACAAAGG - Intergenic
1182270808 22:29152193-29152215 CAGCAAAGACTGCAGGAGGATGG - Intronic
951507070 3:23458803-23458825 GAGCATGTACTGCTGGAAAATGG + Intronic
951514097 3:23538987-23539009 TAGGAAATACTGAATGAGAAAGG + Intronic
952028060 3:29108004-29108026 TAACAGATGCTGGTGGAGAAAGG + Intergenic
952304309 3:32132111-32132133 GAGAAAATACTTGTGGAGAAAGG - Intronic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
955085190 3:55695725-55695747 TAAAAAATACTGCTGGAAACTGG + Intronic
955124126 3:56093126-56093148 TCTCAAATACTCCTGGAGGATGG + Intronic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
960254271 3:115494974-115494996 GAGCAAATGCTGCTGGGAAAGGG - Intergenic
963547633 3:146680855-146680877 ATGCTAATACTGCTTGAGAATGG + Intergenic
964807064 3:160621942-160621964 TAGCTACTAGTGCTGGAGCAAGG - Intergenic
965436817 3:168662769-168662791 CGGCGAATAGTGCTGGAGAAAGG + Intergenic
968793755 4:2688150-2688172 TAGCAAGGACTGGGGGAGAAGGG + Intronic
969946580 4:10789338-10789360 TAGCACATCCTTCTGGGGAAAGG - Intergenic
971240347 4:24882882-24882904 GGGCAATTACTGTTGGAGAAAGG - Intronic
972021318 4:34317859-34317881 TCGGAAATATTGCTGGAAAAAGG - Intergenic
975448877 4:74501041-74501063 TAGCAAAGACTGCAGGTGCAGGG + Intergenic
976577962 4:86698293-86698315 TAGGAAAGACTGGGGGAGAATGG + Intronic
976671564 4:87660337-87660359 TAGCAATTCCTGCTTGAGAAAGG + Intronic
976901629 4:90184449-90184471 TAAAAAATATTGCTGGAGCATGG + Intronic
978272613 4:106908873-106908895 TATCAAAGACTGGAGGAGAAGGG - Intergenic
979383146 4:120032440-120032462 TAACAAATATTGTAGGAGAATGG - Intergenic
979525433 4:121711587-121711609 TACCAAATCCAGCTGGAGAGAGG - Intergenic
979547692 4:121956001-121956023 TAGCAAATACTATTATAGAATGG - Intergenic
980758456 4:137196581-137196603 TGTCAAATACTGGTGGTGAAAGG + Intergenic
980778859 4:137470974-137470996 TTGCAAATACTGTAGGGGAAAGG + Intergenic
981116442 4:140996119-140996141 TAGCAAATACTGATGAGGATGGG - Intronic
981557612 4:146012272-146012294 TAGCGAATTCTGTTGAAGAAGGG - Intergenic
983235529 4:165175048-165175070 TACCAAATACTGCTATAGATTGG + Intronic
984072994 4:175139479-175139501 TACCAAATAATGCTTGTGAATGG - Intergenic
985530236 5:429694-429716 TAGCAAATACTGAGTGGGAAAGG + Intronic
986361778 5:6985347-6985369 TACCAAATGCTGCTGAGGAATGG - Intergenic
988022852 5:25646000-25646022 TAGAAAACACTGCTGGCAAATGG + Intergenic
991225846 5:64270677-64270699 TAAAAAATACTGCTTCAGAAAGG - Intronic
992771557 5:80053651-80053673 TTGCAAATGTTGCTGGATAAGGG - Intronic
993629823 5:90272411-90272433 TTGGAAGTACTGTTGGAGAAGGG + Intergenic
994604695 5:101953047-101953069 GAGGAAATACTCCTGCAGAAAGG - Intergenic
998678344 5:144435966-144435988 TACCAGAAAATGCTGGAGAATGG - Intronic
1000139547 5:158388660-158388682 TAGCAAATAATTTTGGTGAATGG - Intergenic
1000795748 5:165662371-165662393 TAGAAAATAGTGTTAGAGAAGGG + Intergenic
1001121390 5:168983511-168983533 TAGCACACAGTGGTGGAGAAGGG + Intronic
1002271907 5:178078006-178078028 TAGCAGAGACAGCTGGATAAAGG - Intergenic
1010068032 6:71708963-71708985 TAGGAAATGATGCTGAAGAATGG - Intergenic
1012681563 6:102188994-102189016 TACCAAATCCAGCTGGAGTAGGG - Intergenic
1014265314 6:119270086-119270108 TAACAAAGACTGCTAGAGTAAGG - Intronic
1016271470 6:142295179-142295201 TAAAAATTAATGCTGGAGAAAGG - Intergenic
1016597407 6:145816862-145816884 TAGGAGATACTGCAGGAGAAAGG - Intergenic
1018151875 6:160947228-160947250 TAGAAAATGCTGCTGGGGAGTGG + Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1021196984 7:17684998-17685020 AAGCAAATACTGCTGCTGAAAGG + Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1022998735 7:35785726-35785748 TAGCAAATACTTCTGACTAATGG + Intergenic
1025280718 7:57625163-57625185 TAAGAAATTCTGCTGTAGAATGG - Intergenic
1025304012 7:57840344-57840366 TAAGAAATTCTGCTGTAGAATGG + Intergenic
1032396174 7:131591704-131591726 TGGGAAAGACTGCTGGAGACGGG + Intergenic
1036574743 8:10016677-10016699 TAGGAAATACTACTAAAGAAGGG + Intergenic
1036603743 8:10287877-10287899 AAGCAATTACTGCTGGAGAAGGG - Intronic
1037280034 8:17230320-17230342 TAGCTAAAACTCCTGCAGAATGG + Exonic
1037697653 8:21240009-21240031 TAACAAATGCTAATGGAGAAAGG - Intergenic
1038158748 8:25016455-25016477 TAGCAAACACTGGTAAAGAAGGG + Intergenic
1039231441 8:35453194-35453216 TAGAAAATGCTACTGGAGACAGG - Intronic
1039882473 8:41633533-41633555 TAGCAAATTCTGCTAAAGCAGGG + Intergenic
1041741269 8:61159453-61159475 TTGCAAAAACTGCTGGATATGGG + Intronic
1043215419 8:77580562-77580584 TAACAAATAAAGCTGGAGAGGGG - Intergenic
1044186859 8:89263791-89263813 TAGTAAATATTGCCTGAGAAAGG + Intergenic
1045471879 8:102519979-102520001 TAGCAAATGTTGCTGGAGGTTGG + Intergenic
1045661553 8:104443225-104443247 TTGCCAATACTGGTAGAGAAAGG - Intronic
1047916545 8:129590211-129590233 TACCAAATGCTGATGGAGAAAGG - Intergenic
1048229976 8:132629033-132629055 TAGCAAATAATCATGGACAAAGG + Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1053797724 9:41741421-41741443 TATCACATCCTGCTGGGGAAAGG + Intergenic
1054147464 9:61573536-61573558 TATCACATCCTGCTGGGGAAAGG - Intergenic
1054186137 9:61953474-61953496 TATCACATCCTGCTGGGGAAAGG + Intergenic
1054467211 9:65504574-65504596 TATCACATCCTGCTGGGGAAAGG - Intergenic
1054652366 9:67635049-67635071 TATCACATCCTGCTGGGGAAAGG - Intergenic
1058354706 9:104070560-104070582 TAGAAAAAACTTCTAGAGAAAGG - Intergenic
1058968462 9:110058503-110058525 CAGCATATCCTGCTTGAGAACGG - Intronic
1059079157 9:111229774-111229796 TTGCAAATATTGCTGAAGTATGG - Intergenic
1060705503 9:125795135-125795157 TAGAAAATGCTTCTGGAGCATGG - Intronic
1185661880 X:1734972-1734994 TAGCAAATGCTGCCTGAGAACGG - Intergenic
1186915210 X:14211662-14211684 TGGAAAAAACTGCTGGGGAAGGG + Intergenic
1188147955 X:26637779-26637801 CAGCAAATACTTTTGGAGAAAGG + Intergenic
1188250017 X:27881827-27881849 AAGAAAATACTGCAGGAAAAAGG - Intergenic
1188508450 X:30908475-30908497 TTGCAAAGACTTCTGGTGAAAGG - Intronic
1192303818 X:69936719-69936741 TAGCTAAAACTCCTGCAGAATGG + Intronic
1192616068 X:72624065-72624087 GATCAAAGACTGTTGGAGAAAGG + Intronic
1194497614 X:94636398-94636420 TATCAAGAACTGCTGGGGAATGG - Intergenic
1196326036 X:114404029-114404051 TATTAAATACTACAGGAGAAGGG + Intergenic
1199531278 X:148850423-148850445 AAGCAAATAATGCTGGTGGAAGG + Intronic
1199675099 X:150182052-150182074 AAGCAGTTACTGCTGCAGAAGGG - Intergenic
1202202751 Y:22371482-22371504 TAGCAAATACTACTCTGGAATGG + Intronic