ID: 956086651

View in Genome Browser
Species Human (GRCh38)
Location 3:65618292-65618314
Sequence CATGTTTACAAGCATTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956086649_956086651 8 Left 956086649 3:65618261-65618283 CCAGATGGTTCTGAGGAATGAGA 0: 1
1: 0
2: 1
3: 27
4: 237
Right 956086651 3:65618292-65618314 CATGTTTACAAGCATTGCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956086651 Original CRISPR CATGTTTACAAGCATTGCAA AGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902806855 1:18866306-18866328 GATGTTTGAAAGCATTGCAGAGG - Intronic
903104561 1:21064306-21064328 CCTGTCCACAAGGATTGCAAGGG - Intronic
908949603 1:69544149-69544171 AATGTTTACAACCACTGCTATGG + Intergenic
910563090 1:88613458-88613480 CATGCTTGCATACATTGCAAGGG - Intergenic
914779870 1:150775598-150775620 CATCTTTAGTAGCATTGCATTGG + Intergenic
914792588 1:150891555-150891577 CATGTTTACAAGCTTTCCAATGG + Intergenic
918249452 1:182688718-182688740 CATGTTTGCTAGCTTTGAAATGG + Intergenic
918273519 1:182927253-182927275 GATCTTTACAAGCAGTGCAGTGG - Intronic
918286344 1:183058859-183058881 CATGTTTACATGTATTTTAAAGG + Intronic
920739409 1:208566109-208566131 CATGTTTATTTGCATGGCAATGG + Intergenic
922361947 1:224830733-224830755 CATTTTTACAAACATAGCCATGG + Intergenic
922389166 1:225120894-225120916 CATTTTAAAAAGAATTGCAAAGG - Intronic
924380175 1:243455800-243455822 CACGTTTATATGCATTACAAGGG - Intronic
1063402782 10:5763087-5763109 CATGTTCACAAGTTTTCCAAAGG - Exonic
1068418149 10:56752668-56752690 CATGTTTACAAGACTTGGAAAGG - Intergenic
1072069911 10:91906190-91906212 CATGCTTACAAGCAATTCACAGG + Intergenic
1074457561 10:113608751-113608773 CATGTTCACATTCATGGCAAAGG - Intronic
1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG + Intergenic
1080729365 11:34933590-34933612 CTTGTTTCCAGGCATTGCCAGGG - Intronic
1082610403 11:55289750-55289772 TAGTTTTACCAGCATTGCAAGGG + Intergenic
1087068938 11:94055637-94055659 CATCTTCACCAGCATTGGAAAGG - Intronic
1091557541 12:1586104-1586126 CATGTTTGCAAGCATTATATAGG - Intronic
1092090910 12:5803031-5803053 CATGTTATCTGGCATTGCAAAGG - Intronic
1092832100 12:12454286-12454308 CATGCTTACCAGCAATGCACAGG + Intronic
1093808028 12:23458642-23458664 CATGTTTACATACAGTGAAATGG - Intergenic
1095512789 12:42971827-42971849 CCTGTTTCCAAGGATTCCAAGGG - Intergenic
1097288210 12:57893739-57893761 CAGGTTTACAAGCTTTTTAATGG - Intergenic
1097349391 12:58531764-58531786 CATGTTTAATGGCATGGCAAAGG + Intergenic
1099635530 12:85206556-85206578 CATGTTAACCAGCAAAGCAATGG + Intronic
1100364526 12:93907362-93907384 CATGCCTACAGGCATGGCAAAGG - Intergenic
1104196182 12:126540851-126540873 CATGTTCAAAAGCATCCCAAGGG - Intergenic
1104279878 12:127366715-127366737 CATGGCTACAACCATTGCAGTGG + Intergenic
1104289083 12:127452095-127452117 CATGTTAACCAGCATGGCAAAGG - Intergenic
1107096580 13:36544059-36544081 CATTTTCACAAGCAAAGCAAAGG - Intergenic
1108238782 13:48439033-48439055 CATGGTTAAAAGCATGACAATGG + Intronic
1109924502 13:69118960-69118982 CACATTTACAAGCATATCAAAGG - Intergenic
1111257684 13:85694011-85694033 ATTGTTTACAGGCATAGCAATGG + Intergenic
1111283705 13:86061910-86061932 TATGTTTGTAACCATTGCAAGGG + Intergenic
1112267256 13:97936068-97936090 CACGTTTACAAGCATTTTACAGG - Intergenic
1112374489 13:98825927-98825949 CATGTTTAGAAGCAGTCCAGTGG - Exonic
1115860472 14:37680609-37680631 AATTGTTAAAAGCATTGCAAGGG + Intronic
1119253268 14:73176034-73176056 AAAGTTCACAAGCATTGAAAAGG - Intronic
1120773270 14:88405137-88405159 CAAGTTTAAAAGCCTTGAAATGG + Intronic
1122469148 14:101954411-101954433 CATGTTTAGAAGCACTGCTCAGG - Intergenic
1123452589 15:20379860-20379882 CATCTTTACAATCATTATAAGGG - Intergenic
1131292338 15:91117674-91117696 CATGTTTGCTAGCATTTCATTGG + Intronic
1132307199 15:100825165-100825187 CATATTTTAAATCATTGCAACGG - Intergenic
1134477357 16:14586834-14586856 CATTTTTACTAACATTTCAAAGG - Intronic
1135337295 16:21613863-21613885 CATGTTTTCAAGCATTCCTAAGG + Intronic
1139192257 16:64878471-64878493 CATTTTTACAAGGATTTGAAAGG + Intergenic
1140600747 16:76472067-76472089 CAAGTTCACAAGCAATGGAAAGG + Intronic
1140840149 16:78830931-78830953 CATGTTTGCAATGATTGCTATGG - Intronic
1143529862 17:7496503-7496525 CATGTCTACGACCTTTGCAAGGG + Exonic
1150847179 17:68671146-68671168 CATGTTTATTAGCATTGTATAGG + Intergenic
1151340899 17:73470150-73470172 CATGAATACATGCAATGCAAGGG + Intronic
1151676536 17:75601663-75601685 CAGGTGTCCAAGCCTTGCAAGGG - Intergenic
1159672065 18:71233227-71233249 CATATTTAAAAGAATGGCAAAGG - Intergenic
1167010932 19:46807081-46807103 CACGTTTACAGGCATTGCACTGG + Intergenic
1167319372 19:48786681-48786703 CAAGTTTACAAACATCTCAAGGG - Intergenic
1168720061 19:58549931-58549953 CATTTCTACAAACATTGTAAGGG - Exonic
926482608 2:13418453-13418475 CATCTTTACAATCATTATAAGGG + Intergenic
926553138 2:14324597-14324619 CATTTTTACCAGAATTGAAATGG - Intergenic
928004846 2:27555025-27555047 CATGATAAAGAGCATTGCAATGG - Intronic
929035713 2:37689481-37689503 CCTCTTTAAATGCATTGCAAAGG + Intronic
929618711 2:43333600-43333622 CAAGTTTCCAGGCATTGCTAGGG - Intronic
931684164 2:64779269-64779291 CCTGTGTATAAGCATTGCCATGG - Intergenic
932822946 2:74916750-74916772 CATGTTTAAAAGAATTGCTCTGG + Intergenic
933234996 2:79855025-79855047 CATGTTGATAAGGATTCCAAAGG - Intronic
937480918 2:122258542-122258564 AATGTTTGCAATCCTTGCAAAGG - Intergenic
945006133 2:205408966-205408988 CATTTTTACCAGCATTTTAAGGG - Intronic
1168767299 20:390381-390403 AATGCTGATAAGCATTGCAAAGG - Intronic
1171433477 20:25102234-25102256 CATTTATACAAGCATGGCACGGG + Intergenic
1172151645 20:32795184-32795206 CATGTTTACAAGGTTTTAAATGG - Intronic
1173113829 20:40221389-40221411 TATGTTTACTAGCATGGCACTGG + Intergenic
1178102388 21:29283747-29283769 CACGATTACAAGAATAGCAAGGG + Intronic
1178165659 21:29972948-29972970 CATGTTTTCATTCATTTCAAGGG - Intergenic
1182065163 22:27425826-27425848 CATGTATCCAAGGATTGCCATGG - Intergenic
949104792 3:191045-191067 TTTTTTTACAAGCATTGCATTGG - Intergenic
950500053 3:13358126-13358148 CATGGTCCCGAGCATTGCAACGG - Intronic
951440745 3:22720760-22720782 CATGTTTACAGCAATGGCAATGG - Intergenic
951494035 3:23305652-23305674 CATGGTTATAAGCCTTGCAGAGG + Intronic
951806357 3:26648412-26648434 CATTTTTACAAGAAATGAAAAGG + Intronic
951924370 3:27891393-27891415 CATGTTTACCAGCTTTCCAGGGG - Intergenic
951946007 3:28137141-28137163 CATGTTAAAAAACATTGCCAAGG + Intergenic
952654125 3:35763500-35763522 CATGGTGACAAGCATGGCAGAGG - Intronic
953070926 3:39518769-39518791 CATGTTTACATGCAGATCAAAGG + Intronic
953276388 3:41503372-41503394 CATGGCTACAAGGAGTGCAAAGG + Intronic
954762342 3:52885020-52885042 CATTTTTACCAGCAATGCATAGG + Intronic
956086651 3:65618292-65618314 CATGTTTACAAGCATTGCAAAGG + Intronic
956800523 3:72753764-72753786 CATTTTTAAAAGCATAGCTATGG + Intronic
959330307 3:104996659-104996681 CATGGTGAAAAGCATTGGAAAGG - Intergenic
961837279 3:129673192-129673214 CATGCTAACAAGCAGTGGAATGG + Intronic
962494965 3:135929989-135930011 CCTGTCTCCAAGCATTGGAAAGG + Intergenic
962887825 3:139643941-139643963 GAGGTTGACAAGCAATGCAATGG - Intronic
965404461 3:168251910-168251932 CATGCCTACAACAATTGCAAAGG - Intergenic
965472082 3:169106572-169106594 AATGTTTCAAAGCATTGCAACGG + Intronic
965603789 3:170480350-170480372 GATGTTCACCAGCATGGCAAAGG + Exonic
971976569 4:33696793-33696815 CCTGTTGACAAGTATTTCAACGG - Intergenic
974671997 4:65043787-65043809 AATATTTACAAGCCTTGGAAGGG + Intergenic
976421219 4:84846691-84846713 TACGTTTACAAGCATTTTAATGG - Intronic
978020370 4:103802671-103802693 CATGTTAACTTGCATGGCAAAGG - Intergenic
979593368 4:122505834-122505856 CATGTTCACAGACATTCCAAAGG - Intergenic
982472347 4:155808390-155808412 AATGTTTACATGCTTTGCTAAGG - Intergenic
982914177 4:161184374-161184396 AATAATTACAAGCATTGTAATGG - Intergenic
984033263 4:174632144-174632166 CTTATTTACAAGCAATGAAATGG - Intergenic
984678308 4:182576675-182576697 CATGTTTATCTGCATTGCCAGGG + Intronic
987807696 5:22791690-22791712 GAAATTTACAATCATTGCAAAGG + Intronic
989234896 5:39135404-39135426 CAATTTTACAAACAATGCAAAGG - Intronic
989274181 5:39567742-39567764 CCTATTTACAATCAGTGCAAAGG + Intergenic
989396126 5:40958958-40958980 CTTATATACAAGCATTACAAAGG + Intronic
990992773 5:61701614-61701636 CATGATTACATTCATTGCCACGG + Intronic
994137281 5:96302371-96302393 AATGTTAACAGCCATTGCAATGG - Intergenic
994411995 5:99418286-99418308 CCTGGTTACCAGCATTGCAGTGG - Intergenic
995057254 5:107773649-107773671 AATCTTTATAATCATTGCAATGG - Intergenic
995509294 5:112892266-112892288 CATGTTTACAACGTTTGGAATGG + Exonic
996673376 5:126146310-126146332 AATGTTTACAAGGTATGCAATGG + Intergenic
998383882 5:141744916-141744938 CATTTTCACAAGCATTTCACAGG + Intergenic
1004277297 6:14249600-14249622 CATGTTAAAAAGAATAGCAATGG + Intergenic
1005286128 6:24328749-24328771 AATGTTGATAAGCATTTCAAGGG - Intronic
1005607766 6:27492491-27492513 TATGTTCACAAGCATTGTCATGG + Intergenic
1006147024 6:31965802-31965824 CATGTTTACTCCCATGGCAAAGG - Exonic
1008577640 6:52876550-52876572 CATGTTTACAAACTTTGCTGTGG + Intronic
1011361992 6:86537069-86537091 CATGATGACAAGCATTGCAGAGG + Intergenic
1012545345 6:100412917-100412939 CCTGTTTACAAGATTTGCAGAGG - Intronic
1014442700 6:121491751-121491773 CATGGATTCAAGCATTCCAAGGG + Intergenic
1015835171 6:137413028-137413050 TATGTTTACAGACATTGGAAAGG - Intergenic
1015846919 6:137530554-137530576 CATGTTTCCAAGAACTGCCATGG - Intergenic
1016201353 6:141413504-141413526 CAGGGTTACAAGCATGGAAAAGG + Intergenic
1017447434 6:154519761-154519783 GATGTTAAGCAGCATTGCAATGG - Intergenic
1017622696 6:156315354-156315376 CATGCTTACAAGCAATGCTGGGG - Intergenic
1020472729 7:8557469-8557491 CAAGATTAAAAGGATTGCAAAGG - Intronic
1024522241 7:50315537-50315559 CATGTTCATAAGAATTGCACAGG + Intronic
1025156414 7:56611126-56611148 CAGGTTTACAAGTATTGAGAGGG + Intergenic
1026587564 7:71668853-71668875 CATCATTACAAGCTTTGCAATGG + Intronic
1027895665 7:84040607-84040629 CATGGTTACATGCATTGTCATGG + Intronic
1028060116 7:86301886-86301908 CATGTTTAAGAGCATAGCTATGG + Intergenic
1028441324 7:90865526-90865548 CATGTTTTGAAGCAGTGGAAAGG + Intronic
1032448007 7:132001227-132001249 CCTGTTTAGAAGGATTTCAAAGG - Intergenic
1032878355 7:136062270-136062292 CATTTTTACAAGCAAGGAAATGG + Intergenic
1034111383 7:148541034-148541056 CATGTTTTCAAACATGCCAAGGG - Intergenic
1035908825 8:3543059-3543081 CAAGTTGACAACCAGTGCAAAGG + Intronic
1036524653 8:9523753-9523775 CATGTTTACAAAAATTAAAAAGG + Intergenic
1036739911 8:11350602-11350624 CTTGTTTACTTTCATTGCAAGGG - Intergenic
1040857507 8:51963280-51963302 CATGTTTATAATCAAAGCAATGG - Intergenic
1045109161 8:98923547-98923569 CATGTTCACAAGTAGTGCTAGGG - Intronic
1047802871 8:128328441-128328463 CATGTTACAAAGCATTACAATGG - Intergenic
1048632577 8:136260222-136260244 CATGTTTACATGCCTTTGAATGG + Intergenic
1050885404 9:10758555-10758577 AATGTTAACAAGGAATGCAATGG + Intergenic
1051169847 9:14309925-14309947 CATTTTAAAAAGCATGGCAAGGG - Intronic
1053251263 9:36575830-36575852 CATGTTTACATTCCATGCAAAGG - Intronic
1061959694 9:133981761-133981783 CGTGTTTCCAAGCATTTCCAAGG + Intronic
1186227404 X:7414621-7414643 CATTTATACAAGCATTGTAAAGG - Intergenic
1188678674 X:32974938-32974960 CATGTTTACAGGCATGGGAGAGG + Intronic
1189686319 X:43567475-43567497 CATGGTCACATGTATTGCAAGGG + Intergenic
1193087303 X:77458227-77458249 CATGTTAACAAGCCTTGCAGGGG + Intergenic
1193951969 X:87810637-87810659 CATGTTTCTTAGCATTGCCAAGG + Intergenic
1194872538 X:99150707-99150729 GATTTTTACCAGCAATGCAAAGG + Intergenic
1195426471 X:104738260-104738282 TATTTTTAGAAGCATTTCAAAGG - Intronic
1201742380 Y:17337652-17337674 CAGGTTGACAATCATTGCATTGG + Intergenic
1201750592 Y:17427655-17427677 CATGTTAATATGCATTGTAAAGG + Intergenic