ID: 956094514

View in Genome Browser
Species Human (GRCh38)
Location 3:65702126-65702148
Sequence GTGGGCTCGCTCGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956094514_956094522 19 Left 956094514 3:65702126-65702148 CCTGTGTTTACGAGCGAGCCCAC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 956094522 3:65702168-65702190 CATTAAATCCAAATATCAAGTGG 0: 1
1: 0
2: 1
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956094514 Original CRISPR GTGGGCTCGCTCGTAAACAC AGG (reversed) Intronic
918373729 1:183887509-183887531 GTGTACTCACTTGTAAACACTGG + Intronic
1062922478 10:1290466-1290488 GTGGGCTGGCTCGCTGACACAGG + Intronic
1077891811 11:6423741-6423763 CTGTGCTGGCTCCTAAACACTGG - Intergenic
1086427780 11:86703873-86703895 ATGGGCACTCTTGTAAACACAGG - Intergenic
1093392828 12:18643742-18643764 CTGGGCTCTCTAGTAAGCACTGG - Intronic
1119643172 14:76329832-76329854 CTCGGCTCCCTCGTAAAGACAGG - Intronic
1127353089 15:58171883-58171905 GTGGCCTTGGTCGTAAACAAAGG - Intronic
1140826490 16:78711759-78711781 GTGCGCTCACTCTTTAACACTGG - Intronic
1142559875 17:803552-803574 GTGGGCTCTCTCAGAAGCACAGG + Intronic
1152104868 17:78323069-78323091 GTGGGCTCCCTCCCAATCACGGG + Intergenic
1160952190 19:1673043-1673065 GTGTGCTCACTCCTATACACAGG + Intergenic
937537242 2:122905435-122905457 GTGTGCTAGGTCGAAAACACTGG - Intergenic
948805251 2:240451134-240451156 GAGGGATGGCTCATAAACACTGG - Intronic
950504997 3:13389077-13389099 GTGGGCTCGTTTGTAAATGCAGG - Intronic
953999553 3:47544966-47544988 TAGGACTCGCTCCTAAACACAGG + Intergenic
956094514 3:65702126-65702148 GTGGGCTCGCTCGTAAACACAGG - Intronic
961782143 3:129326579-129326601 GTGGGCTCGTTTGTAAATGCAGG - Intergenic
965012775 3:163116541-163116563 GTGGACTGCCTTGTAAACACTGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
1000559229 5:162765353-162765375 GAGGGCTCTGACGTAAACACAGG - Intergenic
1004308061 6:14519078-14519100 GAGCGATCGCTCGTAAACACTGG + Intergenic
1005605509 6:27473127-27473149 CGGGGCTCGCTCGTAACGACCGG - Intergenic
1011547848 6:88500426-88500448 GTGGGCTCCCTCCTTCACACAGG - Intergenic
1012552042 6:100471868-100471890 GTGAGCTCACTGGTCAACACTGG + Intergenic
1034478448 7:151302318-151302340 ATGGACTGGCTCGGAAACACAGG + Intergenic
1045322803 8:101094809-101094831 GAGCGCTTGCTGGTAAACACTGG + Intergenic
1047909188 8:129508868-129508890 TTGGGCTCCCTAGTAATCACTGG - Intergenic
1061202073 9:129143694-129143716 GTGGGCTGGAACCTAAACACAGG - Intronic
1062395953 9:136352896-136352918 GTGGGCTCGCACTCACACACAGG - Intronic