ID: 956094912

View in Genome Browser
Species Human (GRCh38)
Location 3:65706149-65706171
Sequence AACCACTAGTAGATGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956094912 Original CRISPR AACCACTAGTAGATGGTACA CGG Intronic
905414801 1:37796467-37796489 AACCACTTGGAGCTGGCACAAGG + Intronic
906764524 1:48415544-48415566 ACTCACTATTAGATGGGACATGG + Intronic
907300121 1:53481776-53481798 ATCTACTGGCAGATGGTACAAGG + Intergenic
916604984 1:166332937-166332959 AAACACTTATAGAAGGTACATGG + Intergenic
916986156 1:170193132-170193154 AACCACTAGAAGAAGATATAGGG - Intergenic
918859598 1:189805619-189805641 AACCTCTAGGAGAAGGTAAAAGG + Intergenic
1063939558 10:11113350-11113372 TACCACCACTAGATGGTGCATGG + Intronic
1064588403 10:16863241-16863263 AATCACCAGTAAAAGGTACAGGG + Intronic
1079417549 11:20253589-20253611 ATCCATTTGTAGAAGGTACAGGG + Intergenic
1080585212 11:33675609-33675631 AACCACTGGTAAAGTGTACACGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1099321540 12:81156903-81156925 AAACATTAGTAGATGGCACATGG - Intronic
1114485840 14:23061248-23061270 ACCCACTAGTAGGTGGGAAAGGG - Intronic
1117691106 14:58307355-58307377 TACTACTAATAGAAGGTACAGGG - Intronic
1120003390 14:79329417-79329439 AACCAAGAGCAGGTGGTACAGGG + Intronic
1126510448 15:49465935-49465957 AACCCCCAGTACTTGGTACAGGG - Intronic
1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG + Intergenic
1130919904 15:88335274-88335296 TACCAATAGGAGGTGGTACAGGG + Intergenic
1134296946 16:12954732-12954754 AAACAGTTGTAGAGGGTACATGG + Intronic
1144750055 17:17642307-17642329 AGCCAAGAGTAGATGTTACACGG - Intergenic
1149273498 17:55009091-55009113 AAACACTAATAGGTGCTACAGGG - Intronic
1150911623 17:69393876-69393898 AACCACTAGTAATGGTTACAAGG + Intergenic
1166640506 19:44491130-44491152 AGCCACTAGGAGAAGGGACATGG + Intronic
930293364 2:49524030-49524052 AACTACTCGTATATGGGACAAGG - Intergenic
931122651 2:59237278-59237300 AACCATTATTAGATGGCACTTGG + Intergenic
931918186 2:66982448-66982470 AGCCACTAGAAGCTGGTAGACGG - Intergenic
943689712 2:190857221-190857243 AATCACTATTAAATGGTAAATGG + Intergenic
944880018 2:204003228-204003250 AACCATGAGTAGATGGTCAAAGG - Intergenic
1170259648 20:14389708-14389730 TAACACTAATAGATTGTACATGG - Intronic
1171777998 20:29388636-29388658 AACCACAAGTAGTGGCTACATGG - Intergenic
1176950326 21:15037560-15037582 AACCACTAGGAGAAAGTAGATGG + Intronic
950716217 3:14849419-14849441 AACCACAAGCAGATGGCCCATGG - Intronic
951195317 3:19817171-19817193 AACCACGTGAAGCTGGTACATGG + Intergenic
951926409 3:27913347-27913369 AACCACTAGAATGTGGTAGATGG - Intergenic
951926478 3:27913888-27913910 AACCACTAGAATGTGGTAGATGG + Intergenic
952827051 3:37532649-37532671 AAGCACTGGGAGATGGTCCATGG + Intronic
956094912 3:65706149-65706171 AACCACTAGTAGATGGTACACGG + Intronic
957087169 3:75691924-75691946 AACCACCAGTAGTGGCTACATGG + Intergenic
958063464 3:88512492-88512514 AACTACTAGAAGATAGCACAGGG + Intergenic
963211577 3:142698513-142698535 AACAACTACAATATGGTACATGG + Intronic
967757837 3:193190343-193190365 AAGAACCAGCAGATGGTACAAGG - Intergenic
972761810 4:42113642-42113664 TACCACTAGTTGATGGGACATGG + Exonic
977022559 4:91775134-91775156 AACCACTGGGATATGGTCCAGGG - Intergenic
978686953 4:111457382-111457404 AACCAGAAGTAGAAGATACAAGG + Intergenic
980884399 4:138746436-138746458 AACCACTATCAGAAGCTACAAGG + Intergenic
981098694 4:140807679-140807701 AACAACCAGGAGGTGGTACACGG - Intergenic
984181568 4:176489515-176489537 AGCCCCTAGAAGATGGTAAAGGG - Intergenic
993078953 5:83271925-83271947 AAGCACTAGAAAATGTTACATGG - Intronic
995104171 5:108354365-108354387 ATACATTAGTAGATGGGACATGG + Intronic
995237378 5:109844672-109844694 AACCACTAGAAGCTGGGAAAGGG - Intronic
995590230 5:113692232-113692254 AACAACTAGTAGAATGGACAAGG + Intergenic
998832306 5:146173004-146173026 AACCTCTAGTATTTGTTACAAGG - Intronic
1000857156 5:166412826-166412848 CACCACTGGTAGCTGCTACAAGG - Intergenic
1001969838 5:175946728-175946750 AACCAGAAGTAGATTGTACTGGG - Intronic
1002247600 5:177897040-177897062 AACCAGAAGTAGATTGTACTGGG + Intergenic
1005037815 6:21573100-21573122 TTCCACTAGTAAATGGTGCAGGG - Intergenic
1009489026 6:64264180-64264202 AATCACTATTAGCTAGTACATGG - Intronic
1011104434 6:83763654-83763676 AACTACTAGTATATGCAACAAGG - Intergenic
1012446489 6:99312219-99312241 AACCATTAGAAGAGGGTGCAAGG + Intronic
1012447997 6:99326442-99326464 AACCAATACTAGATTGTACAAGG + Intronic
1012867461 6:104635085-104635107 AGCCCTGAGTAGATGGTACATGG + Intergenic
1017188611 6:151627711-151627733 ATCCTCTAGTAAAAGGTACAAGG - Intergenic
1021579207 7:22134526-22134548 AACCACTAATATATGGCAGAAGG + Intronic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1024378983 7:48672505-48672527 AACCACAACTACTTGGTACAAGG - Intergenic
1025212444 7:57027723-57027745 AACCACCAGAAGCTGGGACAGGG - Intergenic
1025659512 7:63549104-63549126 AACCACCAGAAGCTGGGACAGGG + Intergenic
1027966132 7:85010986-85011008 AACCAGAAGGATATGGTACAAGG + Intronic
1028330553 7:89585373-89585395 AACCAATAATAGATGGGAGACGG + Intergenic
1029675578 7:102066165-102066187 AACCACCAGAAGCTGGGACAGGG - Intronic
1036674047 8:10814595-10814617 ATCCACAAGTAGATTGTGCATGG + Intronic
1040023216 8:42758985-42759007 AACCAGTTGGAGATGGAACAAGG + Intronic
1041461289 8:58114653-58114675 AACCACGAGCTGAAGGTACAAGG + Intronic
1041841174 8:62273429-62273451 AAAAACTAGTATATGGTATAGGG - Intronic
1055474259 9:76645912-76645934 ACCAACTAGTACCTGGTACAAGG - Intronic
1188927612 X:36064662-36064684 AAGTACTAGTAGATGATAGATGG + Intronic
1189095908 X:38139244-38139266 AACCAGTAATAAATGGTGCAGGG + Intronic
1190565673 X:51728250-51728272 AACCACTAAAAAAAGGTACAAGG - Intergenic
1190938504 X:55018088-55018110 AACCACAAGCAGATGCTACCTGG - Intronic
1191152892 X:57240329-57240351 AACCATGGGTAGATGGTACCAGG + Intergenic
1198456670 X:136824050-136824072 CACCTCTGGTAGATGGTATATGG + Intergenic
1202342858 Y:23887925-23887947 ACTCACTACTAGATGGTAGAGGG + Intergenic
1202527910 Y:25782160-25782182 ACTCACTACTAGATGGTAGAGGG - Intergenic