ID: 956096300

View in Genome Browser
Species Human (GRCh38)
Location 3:65720347-65720369
Sequence ATGCCCATGGGGCATACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956096300_956096305 -1 Left 956096300 3:65720347-65720369 CCCAGTGTATGCCCCATGGGCAT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 956096305 3:65720369-65720391 TCTGACACTGAAGCCTACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 165
956096300_956096306 8 Left 956096300 3:65720347-65720369 CCCAGTGTATGCCCCATGGGCAT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 956096306 3:65720378-65720400 GAAGCCTACCCTGGAAGACTTGG 0: 1
1: 0
2: 1
3: 8
4: 124
956096300_956096311 27 Left 956096300 3:65720347-65720369 CCCAGTGTATGCCCCATGGGCAT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 956096311 3:65720397-65720419 TTGGCTCTGTTCTCCAGGCTTGG 0: 1
1: 0
2: 16
3: 251
4: 2678
956096300_956096310 22 Left 956096300 3:65720347-65720369 CCCAGTGTATGCCCCATGGGCAT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 956096310 3:65720392-65720414 AAGACTTGGCTCTGTTCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956096300 Original CRISPR ATGCCCATGGGGCATACACT GGG (reversed) Intronic
902271666 1:15309397-15309419 CTGCTCATGGGGCTCACACTTGG + Intronic
904361170 1:29972908-29972930 AAGCACATGTGGCATACGCTGGG + Intergenic
905917436 1:41695473-41695495 ATGTCCCTGGGGCCTACACTGGG - Intronic
910647955 1:89533352-89533374 GTGTCCATGGGACATGCACTGGG - Intronic
910688603 1:89942827-89942849 ATGCCCATCTGGCATACAGTCGG - Intergenic
918005646 1:180539900-180539922 AGGCCTATGGGGAAGACACTGGG + Intergenic
922051394 1:221993958-221993980 AAGCCCATAGGGCATATGCTTGG + Intergenic
923609089 1:235473552-235473574 ATGCCCATGGGACATTCAAGTGG + Intronic
923805475 1:237252531-237252553 ACACCCATGGAGCTTACACTTGG - Intronic
1068254983 10:54497815-54497837 ATGCCAATGAGTCATAGACTTGG - Intronic
1075447209 10:122521289-122521311 ATGCAGATGGGGCACACACAGGG + Intergenic
1076470956 10:130717801-130717823 ATGCCCATGAGGCTCTCACTGGG + Intergenic
1077944769 11:6884209-6884231 ACGCCCTTGGGGAAAACACTTGG - Intergenic
1081637797 11:44732255-44732277 ATTATCATGGGGCAGACACTTGG + Intronic
1084680892 11:70665783-70665805 CTGCTCATGGAGCATTCACTGGG - Intronic
1087893227 11:103558588-103558610 CTGCCCCTGGGGCACACACAGGG - Intergenic
1090789365 11:130077069-130077091 ATGCCCCTGTAGCAGACACTGGG - Intronic
1092060833 12:5548983-5549005 ATGCCCATGTGGCACAGGCTTGG - Intronic
1100926731 12:99557301-99557323 ATGCCAATGGGTCATAGATTTGG + Intronic
1102823287 12:115926256-115926278 ATGCCCATGTGGCGCACAGTAGG + Intergenic
1106290498 13:28356903-28356925 ATGGCCATGTGGCTTACATTTGG - Intronic
1107484767 13:40814990-40815012 ATGCCAATGAGTCATAGACTTGG - Intergenic
1118459022 14:65971503-65971525 ATTCCCATGGGGCATTGACAGGG + Intronic
1119708891 14:76806925-76806947 ATGCCTCAGGGGCATACACTGGG - Intronic
1119728334 14:76935733-76935755 AGGCCCATGGAGCAGGCACTGGG - Intergenic
1124462012 15:29900707-29900729 AAGCCCATGTGCCGTACACTGGG - Intronic
1127304613 15:57692638-57692660 GTGCCCAAGGGCCATAAACTTGG + Intronic
1130547838 15:84869475-84869497 TTCCCCATGGGGAGTACACTTGG + Exonic
1132891743 16:2208126-2208148 ATGCCCTGGGGGCCAACACTGGG - Intronic
1133332248 16:4982015-4982037 ATCCCCATGGTGCATTCTCTGGG + Intronic
1134199604 16:12187192-12187214 ATGCCCAGGGGACATGCACAGGG - Intronic
1134329588 16:13238312-13238334 ATGATCATTGTGCATACACTAGG + Exonic
1134409588 16:13993001-13993023 ATGGCCATGGGACATACATATGG - Intergenic
1138900467 16:61263211-61263233 ATGCACATGTGACATACACACGG + Intergenic
1142922181 17:3198479-3198501 ATGACCAAGTGGGATACACTTGG + Intergenic
1144763438 17:17720376-17720398 ATTCCCCTGGGGCAGACTCTTGG + Intronic
1148694954 17:49553178-49553200 ATCCCCATGGAGCATGCACAGGG - Intergenic
1152043000 17:77917182-77917204 AGGCCCATGGGCCACACACATGG + Intergenic
1153836497 18:8968964-8968986 ATGTCCATGGGGCAGGCAGTTGG + Intergenic
1153957266 18:10108271-10108293 ATGACCATGTGGCAAGCACTGGG + Intergenic
1157593984 18:48852639-48852661 ATGCCCATGTGGGCTACTCTGGG - Intronic
1159505376 18:69328691-69328713 ATGCCAATGAGTCATACATTTGG - Intergenic
1160400236 18:78605345-78605367 ATGGCCATGGGACAGACACATGG - Intergenic
1161909398 19:7181433-7181455 ATGCGTATGGGGTATCCACTGGG - Intronic
1163870689 19:19819127-19819149 ATGCACGTGGGGCACTCACTGGG - Intronic
1163874800 19:19858982-19859004 ATGCACCTGGGGCACTCACTGGG - Intergenic
1163919362 19:20274418-20274440 ATGCACCTGGGGCACTCACTGGG - Intergenic
1163983765 19:20925642-20925664 ATGCACTTGGGGCAGTCACTGGG + Intronic
1163993707 19:21023164-21023186 ATGCCCGTGGGACAGTCACTGGG + Intronic
1164070658 19:21765395-21765417 ATGCACCTGGGGCAGTCACTGGG - Intronic
1164374101 19:27670720-27670742 ATTCTTATGGGGCAAACACTTGG - Intergenic
1167338652 19:48902002-48902024 ATGGGCATGGGGCATGCACATGG - Intronic
926358826 2:12066130-12066152 CTGCCCATGGGCCAGACACTTGG - Intergenic
926515545 2:13840661-13840683 TTGCCCATGTTGCAGACACTGGG + Intergenic
927205090 2:20603938-20603960 ATGCCCAGTGGGCCTGCACTGGG + Intronic
928609176 2:32975514-32975536 ATGCCCATGAGTCATAGATTTGG + Intronic
933105180 2:78315920-78315942 ATGCTCATGGGGCCTCCACTTGG + Intergenic
944437652 2:199707178-199707200 TTGGCCATGGGGCATAGAGTTGG + Intergenic
945318214 2:208393042-208393064 ATCCCCAAGGTGCATCCACTAGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
948896775 2:240931313-240931335 ATGCCCAGGAGGCAGACACTGGG + Intronic
1173293576 20:41735354-41735376 ATGCCCATGGGCCATGCAGGTGG + Intergenic
1173397886 20:42697553-42697575 ACGGCCATGGGGCAGACACTGGG + Intronic
1174210965 20:48877618-48877640 ATGGACATGGGGCCTACACCAGG - Intergenic
1177033017 21:16006197-16006219 ATGCCCAGGGGGCATAAACAAGG - Intergenic
1177301255 21:19248132-19248154 ATGCATATGGAGCAAACACTCGG - Intergenic
1177740716 21:25149404-25149426 CTGCCCATGGAGAAAACACTTGG - Intergenic
1179303578 21:40134914-40134936 ATGCCCATGTGTCAGAAACTTGG + Intronic
1180207907 21:46273610-46273632 ATGCCCATGTGGCATACCTTGGG + Intronic
949419098 3:3846149-3846171 ATGTCCAAGGGGCAGACACTCGG + Exonic
950917949 3:16664693-16664715 ATGTGCATTGGGCATACACGTGG - Intronic
956096300 3:65720347-65720369 ATGCCCATGGGGCATACACTGGG - Intronic
960015553 3:112884168-112884190 ATGCCAATGGGTCATAGATTTGG + Intergenic
964422486 3:156518862-156518884 ATGCCCATGGGACTTCTACTTGG - Intronic
965361935 3:167752289-167752311 GTGCCCATGAGACATCCACTTGG - Intronic
967322724 3:188210502-188210524 ATACCAATGGGGCAGGCACTGGG + Intronic
967989174 3:195118645-195118667 ATGCCCCAGGGGCATACACAAGG + Intronic
969304967 4:6320476-6320498 ATGCCCATGGGCTTTGCACTGGG - Intergenic
969328361 4:6457350-6457372 ATGTCCATAGGGAATGCACTGGG + Intronic
979517819 4:121631277-121631299 AAGCTCGAGGGGCATACACTTGG + Intergenic
980408057 4:132379931-132379953 ATGACCATGGGGTGAACACTAGG + Intergenic
985353984 4:189097032-189097054 ATGACGATGGGGAATACACGTGG - Intergenic
986970073 5:13323101-13323123 ATGCCAATGTGGCATACTTTGGG - Intergenic
988091669 5:26549320-26549342 ATGCACATGGGACATTCTCTAGG + Intergenic
988306189 5:29497645-29497667 ATGCCAATGAGTCATAGACTTGG + Intergenic
994144746 5:96382432-96382454 ATGCCCAGGGAGGATCCACTGGG - Intergenic
996294795 5:121898947-121898969 GTGCCCATGGGACATCCATTTGG + Intergenic
996478854 5:123950385-123950407 CTGCCCACTGGGCCTACACTGGG + Intergenic
997668599 5:135651964-135651986 ATGCCCTTTGGGCATTCACACGG - Intergenic
998563225 5:143191775-143191797 AGGCACATTGGGCATAAACTTGG - Intronic
1001932071 5:175680348-175680370 ATGCACAATGGGCACACACTGGG - Intronic
1006340702 6:33445016-33445038 ATGCCCATGGGACAGTGACTGGG - Intronic
1008056031 6:46946834-46946856 ATGTGCATGGTGCACACACTGGG + Intronic
1012374164 6:98540940-98540962 TTGTCCATGGGCCATACACCTGG - Intergenic
1015069908 6:129079490-129079512 ATTCCCATCGGCCATACACAAGG + Intronic
1018161343 6:161046073-161046095 GTGCCTATGGGACATACACGTGG - Intronic
1021813357 7:24424750-24424772 CTGCCCATGGGGCATCCCCAGGG + Intergenic
1025767142 7:64466080-64466102 ATGCACCTGGGGCACGCACTGGG + Intergenic
1026654734 7:72247091-72247113 GTGGCCACAGGGCATACACTGGG - Intronic
1032429086 7:131846340-131846362 ATTCCCATGGTACATCCACTAGG + Intergenic
1033580909 7:142734401-142734423 ATGCCGATGAGGCATAGATTTGG - Intergenic
1034269694 7:149797589-149797611 ATGCCCACGGGGCAGGCACCAGG + Intergenic
1039398963 8:37252401-37252423 ATCCCCACGAAGCATACACTTGG - Intergenic
1041006921 8:53504280-53504302 ATGAGCATGGGACACACACTTGG + Intergenic
1042314967 8:67416248-67416270 ACTCCCATTGGGCATCCACTGGG + Intergenic
1042758643 8:72246651-72246673 AGGCCCAGGGGACATCCACTTGG - Intergenic
1042788366 8:72575051-72575073 TTTCCCATGGGGCATATACCTGG + Intronic
1042941675 8:74114595-74114617 TGGCCCATGGAGCAAACACTGGG + Intergenic
1048102734 8:131371830-131371852 ATGCACATGGAGCATTCACCTGG + Intergenic
1048904973 8:139078823-139078845 TTGCCCATGTGGCAGACAATTGG + Intergenic
1049395706 8:142399319-142399341 ATCCCCATCGGGCATTCACTGGG + Intronic
1056296044 9:85193973-85193995 ATGGCCATGTGGCCTACTCTGGG + Intergenic
1058916234 9:109568556-109568578 ATGCACATGGGCAATGCACTAGG - Intergenic
1060722476 9:125988268-125988290 ATTCCCATGGGGGATAGGCTGGG + Intergenic
1187558127 X:20372611-20372633 AGCCCCATGGGGCATAAACTTGG + Intergenic
1193731313 X:85107407-85107429 ATGCCCATTTGGCTCACACTTGG + Exonic
1193851603 X:86544159-86544181 ATGCCAATGAGTCATACATTTGG - Intronic
1196617706 X:117786309-117786331 AAACCCATAGGGCATACACTTGG + Intergenic
1196757344 X:119169588-119169610 ATGCCCATGGGACATCCAGGTGG - Intergenic