ID: 956097876

View in Genome Browser
Species Human (GRCh38)
Location 3:65736597-65736619
Sequence TCTGGGTCTTCGGTCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097876_956097883 2 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097883 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 2
1: 11
2: 38
3: 88
4: 286
956097876_956097881 1 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097881 3:65736621-65736643 ACCAAGAGCTCCAATGTCCAAGG 0: 2
1: 10
2: 42
3: 101
4: 306
956097876_956097886 15 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097876_956097884 6 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097884 3:65736626-65736648 GAGCTCCAATGTCCAAGGGCAGG 0: 7
1: 27
2: 69
3: 192
4: 618
956097876_956097887 16 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097876 Original CRISPR TCTGGGTCTTCGGTCTCTGG AGG (reversed) Intronic