ID: 956097881

View in Genome Browser
Species Human (GRCh38)
Location 3:65736621-65736643
Sequence ACCAAGAGCTCCAATGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 2, 1: 10, 2: 42, 3: 101, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097876_956097881 1 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097881 3:65736621-65736643 ACCAAGAGCTCCAATGTCCAAGG 0: 2
1: 10
2: 42
3: 101
4: 306
956097878_956097881 -9 Left 956097878 3:65736607-65736629 CCGAAGACCCAGAAACCAAGAGC 0: 1
1: 0
2: 2
3: 26
4: 286
Right 956097881 3:65736621-65736643 ACCAAGAGCTCCAATGTCCAAGG 0: 2
1: 10
2: 42
3: 101
4: 306
956097877_956097881 -2 Left 956097877 3:65736600-65736622 CCAGAGACCGAAGACCCAGAAAC 0: 1
1: 0
2: 0
3: 47
4: 143
Right 956097881 3:65736621-65736643 ACCAAGAGCTCCAATGTCCAAGG 0: 2
1: 10
2: 42
3: 101
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097881 Original CRISPR ACCAAGAGCTCCAATGTCCA AGG Intronic