ID: 956097883

View in Genome Browser
Species Human (GRCh38)
Location 3:65736622-65736644
Sequence CCAAGAGCTCCAATGTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 2, 1: 11, 2: 38, 3: 88, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097877_956097883 -1 Left 956097877 3:65736600-65736622 CCAGAGACCGAAGACCCAGAAAC 0: 1
1: 0
2: 0
3: 47
4: 143
Right 956097883 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 2
1: 11
2: 38
3: 88
4: 286
956097878_956097883 -8 Left 956097878 3:65736607-65736629 CCGAAGACCCAGAAACCAAGAGC 0: 1
1: 0
2: 2
3: 26
4: 286
Right 956097883 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 2
1: 11
2: 38
3: 88
4: 286
956097876_956097883 2 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097883 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 2
1: 11
2: 38
3: 88
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097883 Original CRISPR CCAAGAGCTCCAATGTCCAA GGG Intronic