ID: 956097884

View in Genome Browser
Species Human (GRCh38)
Location 3:65736626-65736648
Sequence GAGCTCCAATGTCCAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 7, 1: 27, 2: 69, 3: 192, 4: 618}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097877_956097884 3 Left 956097877 3:65736600-65736622 CCAGAGACCGAAGACCCAGAAAC 0: 1
1: 0
2: 0
3: 47
4: 143
Right 956097884 3:65736626-65736648 GAGCTCCAATGTCCAAGGGCAGG 0: 7
1: 27
2: 69
3: 192
4: 618
956097876_956097884 6 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097884 3:65736626-65736648 GAGCTCCAATGTCCAAGGGCAGG 0: 7
1: 27
2: 69
3: 192
4: 618
956097878_956097884 -4 Left 956097878 3:65736607-65736629 CCGAAGACCCAGAAACCAAGAGC 0: 1
1: 0
2: 2
3: 26
4: 286
Right 956097884 3:65736626-65736648 GAGCTCCAATGTCCAAGGGCAGG 0: 7
1: 27
2: 69
3: 192
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097884 Original CRISPR GAGCTCCAATGTCCAAGGGC AGG Intronic