ID: 956097886

View in Genome Browser
Species Human (GRCh38)
Location 3:65736635-65736657
Sequence TGTCCAAGGGCAGGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1573
Summary {0: 66, 1: 148, 2: 252, 3: 392, 4: 715}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097882_956097886 -10 Left 956097882 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 1
1: 11
2: 31
3: 112
4: 374
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097878_956097886 5 Left 956097878 3:65736607-65736629 CCGAAGACCCAGAAACCAAGAGC 0: 1
1: 0
2: 2
3: 26
4: 286
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097880_956097886 -3 Left 956097880 3:65736615-65736637 CCAGAAACCAAGAGCTCCAATGT 0: 1
1: 1
2: 4
3: 34
4: 195
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097879_956097886 -2 Left 956097879 3:65736614-65736636 CCCAGAAACCAAGAGCTCCAATG 0: 1
1: 1
2: 4
3: 33
4: 239
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097877_956097886 12 Left 956097877 3:65736600-65736622 CCAGAGACCGAAGACCCAGAAAC 0: 1
1: 0
2: 0
3: 47
4: 143
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715
956097876_956097886 15 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097886 3:65736635-65736657 TGTCCAAGGGCAGGAGAAGATGG 0: 66
1: 148
2: 252
3: 392
4: 715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097886 Original CRISPR TGTCCAAGGGCAGGAGAAGA TGG Intronic