ID: 956097887

View in Genome Browser
Species Human (GRCh38)
Location 3:65736636-65736658
Sequence GTCCAAGGGCAGGAGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 9, 1: 30, 2: 70, 3: 135, 4: 358}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956097880_956097887 -2 Left 956097880 3:65736615-65736637 CCAGAAACCAAGAGCTCCAATGT 0: 1
1: 1
2: 4
3: 34
4: 195
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358
956097879_956097887 -1 Left 956097879 3:65736614-65736636 CCCAGAAACCAAGAGCTCCAATG 0: 1
1: 1
2: 4
3: 33
4: 239
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358
956097882_956097887 -9 Left 956097882 3:65736622-65736644 CCAAGAGCTCCAATGTCCAAGGG 0: 1
1: 11
2: 31
3: 112
4: 374
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358
956097878_956097887 6 Left 956097878 3:65736607-65736629 CCGAAGACCCAGAAACCAAGAGC 0: 1
1: 0
2: 2
3: 26
4: 286
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358
956097877_956097887 13 Left 956097877 3:65736600-65736622 CCAGAGACCGAAGACCCAGAAAC 0: 1
1: 0
2: 0
3: 47
4: 143
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358
956097876_956097887 16 Left 956097876 3:65736597-65736619 CCTCCAGAGACCGAAGACCCAGA 0: 1
1: 0
2: 2
3: 7
4: 141
Right 956097887 3:65736636-65736658 GTCCAAGGGCAGGAGAAGATGGG 0: 9
1: 30
2: 70
3: 135
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956097887 Original CRISPR GTCCAAGGGCAGGAGAAGAT GGG Intronic