ID: 956101072

View in Genome Browser
Species Human (GRCh38)
Location 3:65768883-65768905
Sequence ATTTTCCCCTTTAAACTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956101070_956101072 -7 Left 956101070 3:65768867-65768889 CCGTACAGAGAATAATATTTTCC 0: 1
1: 0
2: 1
3: 24
4: 269
Right 956101072 3:65768883-65768905 ATTTTCCCCTTTAAACTCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956101072 Original CRISPR ATTTTCCCCTTTAAACTCCA GGG Intronic
904723050 1:32525157-32525179 GCTTTCACCTTTAAACTCCTCGG - Intronic
905342841 1:37291106-37291128 ATTTCCCCCTTTATCCTACAGGG + Intergenic
905589701 1:39152379-39152401 TTTTTCTTTTTTAAACTCCATGG + Intronic
906644678 1:47465873-47465895 AGTTGCCCCTTAAAACTCCAAGG + Intergenic
908111410 1:60902281-60902303 ATTCTTGCCTTAAAACTCCAAGG - Intronic
910097607 1:83541369-83541391 ATATTCCCCTTACAATTCCAGGG - Intergenic
912109885 1:106328706-106328728 ATTTTTGCCTTTAAACTGGAAGG - Intergenic
912178789 1:107192543-107192565 ACTTTCCCCTTTCAACTCACAGG + Intronic
913120196 1:115732966-115732988 ATTTTTCCCCTTAGACTACAAGG - Exonic
913582591 1:120241379-120241401 GTTTTCCCCTTTACAATACAGGG - Intergenic
913625582 1:120656981-120657003 GTTTTCCCCTTTACAATACAGGG + Intergenic
914316791 1:146520837-146520859 ATCTTCCCCTGTGAACTCCTTGG + Intergenic
914497564 1:148212523-148212545 ATCTTCCCCTGTGAACTCCTTGG - Intergenic
915307316 1:154988084-154988106 ATCTTCCCCTTCAACCCCCAGGG + Exonic
918432825 1:184479989-184480011 ATTTACCTCTGTAATCTCCATGG - Intronic
918838596 1:189503959-189503981 ATTTTCTCCTTTAAGCTCAATGG - Intergenic
922171950 1:223162775-223162797 ATTCTCCCCTTTAAAGTTCATGG - Intergenic
922237558 1:223733487-223733509 AATGACTCCTTTAAACTCCAGGG - Intronic
922435466 1:225600822-225600844 ATTTTCCTCTTAAATCTCCCAGG - Intronic
923093328 1:230755630-230755652 ACTTTCCTCTGTAAACTCCGGGG - Intronic
924667870 1:246091821-246091843 ACTTTCAACTTTAAACTCAAAGG + Intronic
1064551929 10:16510441-16510463 ATTTGCCCCTTTGAAGTCTATGG - Intronic
1064622782 10:17231198-17231220 GTTTTCCATTTTAAACTGCAGGG - Intronic
1066928103 10:41722959-41722981 TTTTTCCCCTTAGACCTCCATGG - Intergenic
1067203673 10:44195936-44195958 ATTTTCCTCTGTAAACACCCAGG + Intergenic
1067284499 10:44897857-44897879 ATTGTCGTTTTTAAACTCCAAGG - Intergenic
1069215108 10:65810496-65810518 ATTTTCACCTTTATAATCCCTGG + Intergenic
1071978998 10:90984486-90984508 ATTTTCCCCTTTCCACTCTTGGG - Intergenic
1073153904 10:101331283-101331305 TTTTTCCTCTTTAAAATCCCTGG - Intergenic
1073619819 10:105035250-105035272 ATTCTCACCTTAAAATTCCATGG - Intronic
1073976847 10:109111859-109111881 ATTATCCCATTTAATCTTCATGG - Intergenic
1074083145 10:110183822-110183844 ATTTTCCCACTTAGACTCCTTGG - Intergenic
1075279194 10:121125067-121125089 ATTTTCCCCTCTAAAATCACTGG - Intergenic
1075335285 10:121604484-121604506 TTCTTCCCCTGTAAAATCCAGGG - Intergenic
1077988997 11:7384924-7384946 ATTTTCCCCAATTAACTGCATGG + Intronic
1078240262 11:9524722-9524744 ATTTCCCATTTTAGACTCCATGG - Intronic
1080042590 11:27774602-27774624 ACTTTCCCCTCAAAAATCCAGGG - Intergenic
1080327346 11:31092014-31092036 ATATTCCCCTTTAATTTCCTTGG - Intronic
1082144657 11:48652299-48652321 TTTTTCACCATTGAACTCCATGG - Intergenic
1084615011 11:70229946-70229968 ATTTTATCTTTTAAACACCAAGG + Intergenic
1085137828 11:74109755-74109777 ATTTACCAGTTAAAACTCCATGG - Intronic
1086558276 11:88137897-88137919 AATTTCCCCTTTTAACTTTAAGG - Intronic
1087702539 11:101452024-101452046 TTTTTCCCCTTTACATTCAATGG + Exonic
1087705119 11:101481453-101481475 ATTTCCACCTTGAAATTCCATGG + Intronic
1088731738 11:112689749-112689771 ATCTTGCCCTTTAAACTCATAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091237497 11:134031840-134031862 ATTATCCCCTTACAACTCCGTGG - Intergenic
1093157999 12:15711232-15711254 TTTGTCACCTTAAAACTCCAAGG + Intronic
1093416738 12:18928947-18928969 ATTTTCCCAGTTCATCTCCAAGG + Intergenic
1093800975 12:23373004-23373026 AATTTCACGTTTGAACTCCAAGG + Intergenic
1093823541 12:23652733-23652755 ATCTTTTCCTTTAAACTCCTAGG + Intronic
1094131784 12:27082480-27082502 ATTTGTGCCTTTGAACTCCATGG - Exonic
1094181183 12:27594036-27594058 ATTTGTGCCTTTGAACTCCATGG - Intronic
1094529637 12:31261893-31261915 TGTTTCACCCTTAAACTCCAAGG - Intergenic
1095600195 12:44004486-44004508 AATTTCCCCTTTTAATTTCAAGG + Intronic
1097709107 12:62899162-62899184 CTTTTTCCCTTAAAACTCCTAGG + Intronic
1097952885 12:65452245-65452267 ATTTTCCTTTTTAACCTTCAAGG - Intronic
1098292307 12:68968374-68968396 ATTTTCTCCTTTACCCTCCCAGG + Intronic
1099669927 12:85677621-85677643 ATTTTCAGCTTTATACTCAATGG - Intergenic
1100125577 12:91420825-91420847 CTTTTCCCCATTTAATTCCATGG - Intergenic
1101357451 12:103993729-103993751 ATTTTGCCATTTTAACTCCCAGG + Intronic
1103842309 12:123875120-123875142 ATTTTTCCCGTTACTCTCCAGGG - Intronic
1104053214 12:125210249-125210271 ATTTGCCCCTTTAAGTTCCCTGG - Intronic
1104798722 12:131538394-131538416 ATCTTTACCTTTAATCTCCACGG - Intergenic
1106199203 13:27522472-27522494 ATTTTCCTCTATAAACACTAAGG - Intergenic
1106404934 13:29465245-29465267 ATTATCCCATTTAAACCTCACGG + Intronic
1107108372 13:36671062-36671084 ATTTTCACCTTTTCACTCAAAGG - Intergenic
1108050477 13:46431298-46431320 ATTTTCCTGTATAAACTGCAAGG - Intronic
1108981963 13:56525120-56525142 ATTTTCACATTTAAGCACCATGG - Intergenic
1109991470 13:70063640-70063662 AATCTCACCTTTTAACTCCAAGG + Intronic
1110701835 13:78557640-78557662 ATTTTCCCCCATAAACTAAATGG - Intergenic
1110777204 13:79421844-79421866 ATTATCCCCATTAAACTTCTTGG - Intergenic
1112820291 13:103326499-103326521 CTCTTCCCCTTGAATCTCCATGG + Intergenic
1112886598 13:104181331-104181353 ATTTTACAGTTTAATCTCCAAGG - Intergenic
1113196778 13:107817715-107817737 ATTTCACCCTTTTCACTCCAGGG + Intronic
1114232656 14:20798281-20798303 ATCTGCCCTTTTAAAATCCAGGG - Intergenic
1114810254 14:25890826-25890848 TTTTTCCCCTTAAATCTACAGGG - Intergenic
1116213929 14:41986027-41986049 GTTTTCTCCTTTAAACTCTCTGG + Intergenic
1116900441 14:50357571-50357593 CTCCTCCCCTTTCAACTCCAAGG + Intronic
1118063659 14:62167359-62167381 ATTTCCCTTTTTCAACTCCACGG + Intergenic
1118688674 14:68316756-68316778 ATTTTTCATTTTAACCTCCAAGG - Intronic
1126122211 15:45263686-45263708 AGTTTTCTCTTTAAACTCTAAGG - Intronic
1127937897 15:63660826-63660848 ATTTTCCCTTAAAAACTCAAGGG - Intronic
1128814693 15:70599093-70599115 ATTTTCCTCTTTAGACCCTATGG + Intergenic
1130665405 15:85865173-85865195 ACTTACACCTTTAACCTCCAGGG + Intergenic
1133605265 16:7380909-7380931 ATTTTCCCCTTTACACTTTACGG - Intronic
1135249972 16:20892622-20892644 ATTCTCCTCTTCAAATTCCAGGG + Intronic
1135498980 16:22977474-22977496 ATTATCTCATTTAAACTTCACGG - Intergenic
1135802388 16:25510077-25510099 ATTTTCCCCCTGACACACCAGGG + Intergenic
1136872160 16:33817025-33817047 ATTTCTTCCTTTTAACTCCATGG + Intergenic
1137346222 16:47663834-47663856 ATTTTTACTTTTAACCTCCAAGG + Intronic
1139959680 16:70710419-70710441 ATTTTCCCCTGCAAACCGCAGGG + Intronic
1140035616 16:71369221-71369243 ATTATCCTCTTTAATCTTCATGG + Intronic
1140248065 16:73269194-73269216 ATTCTCCCCTTTAAAGTGTATGG + Intergenic
1140653381 16:77113509-77113531 ATTTGCTTCTTCAAACTCCACGG - Intergenic
1141968024 16:87460167-87460189 ATTGTCCCCTATTAACTCCGTGG - Intronic
1203100012 16_KI270728v1_random:1299043-1299065 ATTTCTTCCTTTTAACTCCATGG - Intergenic
1142974065 17:3632842-3632864 ATTTGCCCATTTAAAATACAAGG - Intronic
1143889635 17:10092728-10092750 ATTTTCCCCTAGAGCCTCCAAGG - Intronic
1146130888 17:30274072-30274094 ATGTTCCCTGTAAAACTCCAAGG + Exonic
1147178707 17:38672249-38672271 CTTTGCCCCTTCAAACCCCAGGG + Exonic
1147680886 17:42244624-42244646 ATTTTCCCTATTAAAGTTCATGG + Intronic
1148179524 17:45594147-45594169 ATTTTGCCCCTGAAACTGCATGG + Intergenic
1148269383 17:46251756-46251778 ATTTTGCCCCTGAAACTGCATGG - Intergenic
1148347036 17:46910215-46910237 ACTCTCCCCTTGAAACCCCAAGG + Intergenic
1149758861 17:59210847-59210869 CTTTTCCTCTTTCAACTCAATGG + Exonic
1149957991 17:61075088-61075110 ATTCTCCCCTTTTACCTCTAAGG - Intronic
1150718554 17:67594201-67594223 ATTTTCCCCTTTACACAGCTGGG - Intronic
1153351528 18:4085725-4085747 TTTTTCCCCTTTAAACACAGAGG + Intronic
1153852686 18:9111069-9111091 ATTTTCTTCCTTAAACTCCTTGG + Intronic
1154130944 18:11736656-11736678 ATTTTCCCATGTCAACTGCAGGG + Intronic
1155546345 18:26919757-26919779 AAATTCCCCTTTAATCTCCAGGG + Intronic
1155576249 18:27250525-27250547 TTTTTCCTTTTTACACTCCATGG + Intergenic
1156008910 18:32473677-32473699 ATTTTGCCCTTTAAAGCCAATGG - Intergenic
1156154107 18:34281232-34281254 TTTTTCTCCTGTAAACTTCAGGG + Intergenic
1156365873 18:36426450-36426472 ATTTTCCACTGACAACTCCATGG - Intronic
1156864116 18:41869455-41869477 TTTTCCCCCTTTAAACTGAAGGG - Intergenic
1157805443 18:50654580-50654602 AGTTTCCCCTTGAATCTACAAGG + Intronic
1158208158 18:55017084-55017106 TTTTTTCACATTAAACTCCAAGG - Intergenic
1159270483 18:66142718-66142740 ATTTTCCCAGTTATACTCAATGG - Intergenic
1159441839 18:68490405-68490427 ATTTTCTCTTTTAAAATTCATGG - Intergenic
1160132991 18:76246298-76246320 TTTTCCCCCTTTAAACTTCCTGG + Intergenic
1164651225 19:29892263-29892285 GATTTCCCCTTTATACTCCAAGG - Intergenic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
1165504327 19:36215227-36215249 ATCCTCCCCTTTAACCTCCCCGG - Intronic
927406516 2:22776169-22776191 ATTTTCCCCAATAAAATACAAGG + Intergenic
927626426 2:24725208-24725230 AGCTTTCCCTTAAAACTCCAAGG + Intronic
928280185 2:29939575-29939597 ATTTTGCCCTTTAAACAGGAAGG - Intergenic
929040683 2:37741772-37741794 ATTTTTTCAGTTAAACTCCAGGG - Intergenic
930417713 2:51109855-51109877 ATTTTTCTCTTTAAATTCTAGGG + Intergenic
930773735 2:55152819-55152841 ATTTCCCCCTTGAGACTGCAGGG + Intergenic
931472094 2:62548595-62548617 TTTTTCCCCTTAAAATTCCATGG - Intergenic
933862889 2:86487692-86487714 TTTTCCCCCTTAAAAGTCCATGG + Intronic
935540503 2:104342138-104342160 ATTTTCCTCTTTAAAATGAAGGG - Intergenic
936279873 2:111129148-111129170 TTTTACCTCTTTAAATTCCATGG + Intronic
941182442 2:162276025-162276047 ATTTTCCACTTGATACTACATGG + Intronic
941728593 2:168890529-168890551 ATTTTCCCCTCGAGAATCCAAGG - Intronic
942506826 2:176650847-176650869 ACTTTCACCTGGAAACTCCATGG - Intergenic
945717254 2:213373896-213373918 ATTTTCCCCTTCAAATTCCAGGG - Intronic
946445221 2:219733682-219733704 CTCTTCCCCTTCAAACTCCCAGG - Intergenic
947698561 2:232213495-232213517 ACTTTCCCTTTTCAACTCCTTGG - Intronic
1168736596 20:145140-145162 ATTTTCCCATTTAAAATCATGGG + Intronic
1173366056 20:42386337-42386359 ATTTTCTTTTTTAAACTCCTGGG - Intronic
1173723596 20:45280938-45280960 ATTTTCCCCATTAAACAGCCAGG - Intergenic
1175398702 20:58686500-58686522 AATTTCCTCTTTAGAATCCATGG - Intronic
1177280091 21:18970794-18970816 ATTTTCCCCTTTCAATTCTCAGG + Intergenic
1177448699 21:21236299-21236321 ATTTTTCCCTCTATTCTCCATGG + Intronic
1177716904 21:24850602-24850624 ATTTTCACCTTTAGGCACCAGGG + Intergenic
1177738897 21:25129108-25129130 ATTTTCCCAATAAAACTCAATGG + Intergenic
1179475742 21:41642573-41642595 ATTTTCCACTTAAAACCACAGGG + Intergenic
949937609 3:9128330-9128352 ATTTTTTCCTTTGAACTCTAAGG - Intronic
950285047 3:11738248-11738270 ATTTTCTTTTTTTAACTCCACGG - Intergenic
950357831 3:12426500-12426522 GTTTTCCCCTTTCCACTCCTGGG - Intronic
950795409 3:15506534-15506556 ATTTTCCCCCTTTTACTCAAAGG + Intronic
951192139 3:19783449-19783471 ATTGTCTCCTTGAAACCCCATGG - Intergenic
951316566 3:21194289-21194311 ATTCTCCCCTAAAACCTCCAGGG + Intergenic
951405713 3:22294871-22294893 ATTTTTCCTTTTAAACACAAAGG - Intronic
951451578 3:22845549-22845571 ATCTTCACCTTTAAACTCTCTGG - Intergenic
952042782 3:29280612-29280634 TTTTTCCCCTTTAACCAGCAAGG + Intergenic
954928783 3:54261767-54261789 ACTTTCCCCTCTACACACCAAGG - Intronic
955345148 3:58155694-58155716 TTTTTCCCCATTGAAGTCCATGG + Intronic
955945581 3:64190651-64190673 ATTTTCCCCATGAGAGTCCAAGG - Intronic
956101072 3:65768883-65768905 ATTTTCCCCTTTAAACTCCAGGG + Intronic
956125476 3:66007277-66007299 ATTGTCTCCTTTAAGCCCCACGG + Intronic
957352581 3:79045422-79045444 ATTTTCCAGTTTAAACTTCTTGG + Intronic
957980199 3:87499146-87499168 TTTTTCCCCTTTATACCTCAAGG - Intergenic
958725342 3:97898701-97898723 ATTTTTTCCTTTAAACTATATGG + Intronic
960481840 3:118201069-118201091 ATTTTCCCTTTTAAAGTCTCTGG - Intergenic
960594245 3:119393326-119393348 AAATTCCCCTCTAAAATCCAAGG - Intronic
962237547 3:133719397-133719419 ATTTTCCCCTATAATTCCCAGGG + Intergenic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
963722704 3:148881351-148881373 TTTTTCCCCTTTAAACTATATGG + Intronic
964321126 3:155498287-155498309 ATTTTCACCTTTTCACTTCAAGG - Intronic
964374226 3:156033921-156033943 ATTTTCCTCTATTAACTTCAAGG - Intergenic
964883080 3:161445912-161445934 AATTTACCCTTGAATCTCCATGG - Intergenic
964887180 3:161497770-161497792 ATTTTCTCCATTGAACACCATGG + Intronic
965856555 3:173095695-173095717 ATTTTCCTATTTGAAATCCATGG + Intronic
966634031 3:182112348-182112370 ATCTTCTCCTTCAAAATCCAAGG + Intergenic
967467546 3:189824708-189824730 ATTTTCCTCTTAAAGCACCAGGG + Intronic
967726243 3:192864934-192864956 ATATTCCCATTGAAACTGCAAGG - Intronic
970324051 4:14904707-14904729 CTTTTCCCCTTTCTTCTCCAAGG + Intergenic
970331901 4:14995192-14995214 GTTTTCCCCCTTGTACTCCAGGG + Intergenic
973988336 4:56377780-56377802 TTTTTTCCCTTTAAAATACAAGG + Intronic
974563506 4:63553319-63553341 ATTTTCCTCCTAAACCTCCAGGG + Intergenic
974809768 4:66930898-66930920 TTTTTCCACCTTAAACTCCAGGG - Intergenic
975105121 4:70559168-70559190 ATTTTCTCCTTTAAACTTTCTGG + Intergenic
975516037 4:75249428-75249450 ACTTTCCCCTTTTTACTCAAAGG - Intergenic
976217653 4:82730163-82730185 ATTTTCCCCCTTATTCTCCTAGG - Intronic
978224085 4:106313697-106313719 ATTTTCCCCTTAAAGCCCAATGG - Intronic
978884238 4:113747018-113747040 TTTACCCCCTTTAAACTACAAGG + Intronic
980942476 4:139287616-139287638 ATTATGCCCCTTTAACTCCAGGG - Intronic
981887786 4:149698219-149698241 TTTTCCCCCTATAACCTCCATGG - Intergenic
982303346 4:153902616-153902638 CTTTTCCTCTCTAAACTTCATGG - Intergenic
982657071 4:158163115-158163137 ATTATCCACTATAAGCTCCAAGG + Intronic
983043010 4:162953056-162953078 ATTTTCTCCCTTAAACTTGAAGG - Intergenic
983102369 4:163640906-163640928 ATTTTCCATTTCAAACACCAAGG + Intronic
983542204 4:168923747-168923769 ATTGCCCCCTTTAAATTCTATGG + Intronic
985324993 4:188756649-188756671 ACTTTCCTCTTTAAATTCAATGG - Intergenic
985993013 5:3578813-3578835 ATTTTACCATAGAAACTCCATGG + Intergenic
988981389 5:36572781-36572803 ATTTTAGCATTTAGACTCCATGG - Intergenic
989181953 5:38587201-38587223 CTGTTCCCCATTAGACTCCATGG - Intronic
990443300 5:55868159-55868181 ATTTTCCCCATTTAAGTTCATGG + Intronic
991239663 5:64442925-64442947 GTTTTCCTCATGAAACTCCAGGG + Intergenic
992175176 5:74142819-74142841 ATTTTCCCCTTTCCAATCCATGG - Intergenic
994167781 5:96626045-96626067 CTCTTCCCCTTTATCCTCCACGG + Intronic
994534484 5:101010197-101010219 ATTTTCCCTTTTAAACACCCAGG - Intergenic
995222058 5:109659869-109659891 TTTTTTCCTTTTAATCTCCAAGG + Intergenic
996385357 5:122904822-122904844 TTTTTCCCAGTTAAACTCCATGG - Intronic
996833410 5:127764904-127764926 ATTTTCTCCCTGAAGCTCCAGGG - Intergenic
998983314 5:147727986-147728008 ATTTTCCTCATGAAACCCCAGGG + Intronic
999574584 5:152961775-152961797 ATTCTCTCCTGTAAACTCCAGGG - Intergenic
1000402942 5:160851436-160851458 GTTTTCTCCTTTGAACTCAAAGG + Intronic
1001665547 5:173430895-173430917 ACTTTAACCTCTAAACTCCATGG + Intergenic
1005008123 6:21310580-21310602 TTTTGGCCCTTTAAATTCCAAGG + Intergenic
1006260124 6:32860947-32860969 ATTTTTTTCTTTACACTCCAGGG - Intergenic
1010814507 6:80341737-80341759 ATTTTGCCCTTAATTCTCCATGG + Intronic
1011172360 6:84519892-84519914 TTTTTCCACTTTACAGTCCATGG - Intergenic
1011897600 6:92251007-92251029 ATTCTCCCATTTTAACACCAAGG + Intergenic
1013527151 6:110985080-110985102 ATTTCCCCCTTTAATCAGCATGG - Exonic
1014437413 6:121436423-121436445 ATTTTCCCCATTAAACAAAAAGG + Intronic
1015699436 6:136019512-136019534 TTTGTCCCCTATATACTCCATGG + Intronic
1016872151 6:148829042-148829064 ATTTTCCACTTCTTACTCCAAGG - Intronic
1018151374 6:160943023-160943045 ACTTTCCCCTGCAATCTCCATGG + Intergenic
1021960027 7:25861707-25861729 AATTTTCCCTCTAAACTTCAAGG + Intergenic
1024756249 7:52536387-52536409 ATTTTGTCCTTTCAACTACAAGG + Intergenic
1026662410 7:72313827-72313849 ATACTCCCCTGTAAACTACAAGG + Intronic
1026664068 7:72326905-72326927 CTCTTCTCCTTTAAATTCCATGG + Intronic
1027967893 7:85037363-85037385 ATATTCCTCTTTATCCTCCAGGG - Intronic
1028712330 7:93923427-93923449 TTTTTCCCCTTTAAACGCGTTGG - Intronic
1030856255 7:114561317-114561339 ATTTTACTCTTTCAACACCAAGG + Intronic
1031620206 7:123926283-123926305 CTTTTCCCCTTTAAATACCGAGG + Intronic
1032576112 7:133056793-133056815 ATTTTCTCATTTAGTCTCCATGG + Intronic
1032763876 7:134972341-134972363 ATATTCCCATTGAAACTCAAAGG - Intergenic
1032912396 7:136448440-136448462 ATTTTCCCCTTCACAGTCAAAGG + Intergenic
1033363086 7:140651635-140651657 TTTTTCCCCCTTAAACTCAATGG - Intronic
1034697195 7:153064385-153064407 ATATTCCACTTAAAACACCAAGG + Intergenic
1035211630 7:157332851-157332873 ATATTACCATTTAATCTCCAAGG + Intergenic
1035679278 8:1476405-1476427 TTCTTCCCCTCTACACTCCAAGG + Intergenic
1036553048 8:9832136-9832158 TTTTTCCTCTTTAAGCACCAAGG + Intergenic
1036712942 8:11093743-11093765 AATTTACCCTTTATACTTCAGGG + Intronic
1037508442 8:19556441-19556463 ATTTCCCCCTTTAAAATAAAAGG - Intronic
1037659075 8:20911804-20911826 ATCTTCCCCTCTAAACTGGAAGG + Intergenic
1038689157 8:29745747-29745769 ATTTCCCCATTTATCCTCCAAGG + Intergenic
1038702000 8:29857505-29857527 ATTTTCCCCATTGTAGTCCATGG - Intergenic
1039287327 8:36056208-36056230 CTTTTCACCTTTCAACCCCAGGG - Intergenic
1040129550 8:43778797-43778819 TTTTTCCCCTTTGACCTCAATGG - Intergenic
1040275241 8:46010389-46010411 ATTTTCCCCTAAAATCTCAAGGG - Intergenic
1042188831 8:66165044-66165066 CTTTTCCCCCTTGAACCCCAGGG + Intronic
1042634827 8:70862364-70862386 GTTTTCCATTTTAGACTCCATGG + Intergenic
1044948704 8:97415144-97415166 ATTTTTACCTCTAAACTACAGGG + Intergenic
1045468517 8:102490516-102490538 ATTCTCCCCTAGAAACTTCAGGG + Intergenic
1045924823 8:107571604-107571626 ATATTACCCTTAAAACTGCAAGG + Intergenic
1047140383 8:122132304-122132326 ATTTTCCCCTTAAACCATCATGG + Intergenic
1047795661 8:128252902-128252924 ATTTTGGCCTTTACTCTCCATGG - Intergenic
1047979987 8:130171141-130171163 ATTTTCCCTTAAAAACTCCAAGG + Intronic
1048961197 8:139579847-139579869 ATTTTTCCTTTTAAACTGTAGGG + Intergenic
1050084321 9:1948946-1948968 ATTTTACTCTTTAAATCCCAAGG - Intergenic
1050873594 9:10608046-10608068 AATTTCCTCTTTAAAATGCAAGG + Intronic
1051608181 9:18936907-18936929 TTTTTCCCCTTTTCACTCTATGG - Intronic
1052388576 9:27851274-27851296 ATTTTCATCTCTAAACTCCAAGG + Intergenic
1056110999 9:83394717-83394739 ATTTACCCCTTTACACCCTATGG + Intronic
1056482185 9:87016716-87016738 GTTTTACCCTTTGGACTCCATGG + Intergenic
1059179084 9:112195040-112195062 ATTTTCTCTGTGAAACTCCAAGG + Intergenic
1060035348 9:120250847-120250869 ATTTTCCCCTTGAAACAGCCAGG + Intergenic
1060712670 9:125884994-125885016 ATTTTTCTCTTTGAACTTCAGGG + Intronic
1061240615 9:129369461-129369483 ATTGTCCACTTGAAAATCCAAGG + Intergenic
1203397624 Un_KI270519v1:40903-40925 ATTTTCCCCCTTAAGCCTCAAGG + Intergenic
1186407408 X:9316266-9316288 ACTTCCCCCATTAAACTCTAGGG - Intergenic
1187996289 X:24930572-24930594 AATTTCCACTTTAAACTCAAAGG - Intronic
1188885140 X:35540463-35540485 TTTTTCCCCTTTGAAATCCATGG - Intergenic
1189097666 X:38157355-38157377 ATTCTCCCCTAGAACCTCCATGG - Intronic
1189710776 X:43809425-43809447 ACTTTACCCTTTAACCTCCTTGG + Intronic
1190021169 X:46877517-46877539 ACCATCCCCATTAAACTCCAAGG - Exonic
1190421754 X:50291623-50291645 ATTTTCAAGTTTAAGCTCCAGGG - Intronic
1193753848 X:85382025-85382047 ATTTTACACTTGAAAATCCAAGG + Intergenic
1193864161 X:86709002-86709024 ATATTCCCCATCAAAATCCAAGG + Intronic
1196695986 X:118612412-118612434 AACTTCAACTTTAAACTCCATGG - Intronic
1198051213 X:132955416-132955438 ATGTTCCCCTTAAATCTCAATGG + Intronic
1199734695 X:150674597-150674619 AATTTCTCCTTTAAAATCGAAGG + Intergenic
1201058475 Y:10019203-10019225 TTTTTCCTCTTTAGACTCCTGGG + Intergenic