ID: 956104829

View in Genome Browser
Species Human (GRCh38)
Location 3:65806849-65806871
Sequence ATGTCCCCCTTGAAGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956104821_956104829 19 Left 956104821 3:65806807-65806829 CCCCATAGTTTGTGACTATAAAA 0: 1
1: 0
2: 1
3: 16
4: 282
Right 956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 116
956104822_956104829 18 Left 956104822 3:65806808-65806830 CCCATAGTTTGTGACTATAAAAA 0: 1
1: 0
2: 0
3: 19
4: 322
Right 956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 116
956104824_956104829 -10 Left 956104824 3:65806836-65806858 CCAGACATTCCAAATGTCCCCCT 0: 1
1: 0
2: 6
3: 19
4: 186
Right 956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 116
956104820_956104829 30 Left 956104820 3:65806796-65806818 CCAGTAGCACACCCCATAGTTTG 0: 1
1: 0
2: 2
3: 5
4: 70
Right 956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 116
956104823_956104829 17 Left 956104823 3:65806809-65806831 CCATAGTTTGTGACTATAAAAAC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956104829 Original CRISPR ATGTCCCCCTTGAAGAGGGG AGG Intronic
901036096 1:6337139-6337161 ATGTCCCCAGGGAGGAGGGGTGG + Intronic
901154700 1:7127761-7127783 ATGTCACCCTTGATGAGGCTAGG - Intronic
903585239 1:24410219-24410241 ATATCCCCCTTGAATAAGGGAGG + Intronic
904866113 1:33580150-33580172 ATGCCCACTTTGAAGAGAGGTGG - Intronic
905785943 1:40757654-40757676 CTGTCCCCCTTGAAGTGGTGGGG + Intronic
915358215 1:155269194-155269216 AGGTCCCCATTAAAGAGTGGAGG + Intronic
915808466 1:158879792-158879814 ATGTTCTCCGTGAACAGGGGAGG + Intergenic
919540274 1:198836945-198836967 ATGTTCTCCTGGAAGAGGTGGGG - Intergenic
919834968 1:201567238-201567260 CTGTTCCCCATGAAGAGGGTGGG - Intergenic
922664049 1:227453926-227453948 ATTTCCCCCAGGAAGAGTGGGGG + Intergenic
924433972 1:244022253-244022275 TTGTGCCCCTTGAAGATGTGGGG - Intergenic
1068809675 10:61241817-61241839 ATGTCCCCATGGCAGGGGGGTGG - Intergenic
1069957776 10:72062213-72062235 CTGTCCCCATTGCAAAGGGGAGG - Exonic
1073113033 10:101073954-101073976 AGCTCCCCCAGGAAGAGGGGTGG - Intergenic
1073474324 10:103742946-103742968 GTGTCACCCTTGAGGGGGGGAGG - Intronic
1075227680 10:120644422-120644444 ATGTCCCTCATGAAGGGGAGGGG + Intergenic
1076588736 10:131569097-131569119 AAGTCCCCCATGCTGAGGGGTGG + Intergenic
1077141169 11:1025573-1025595 ATGTCTCCCGGGCAGAGGGGAGG - Intronic
1077285251 11:1762728-1762750 CTGTCCTCCTTGGAGAGGGGAGG + Intronic
1077396773 11:2327803-2327825 ATGTTCCCCTTGACGTGGGCAGG + Intergenic
1079358379 11:19749319-19749341 ATGACAGCCTTGAAGAGGTGAGG - Intronic
1079460929 11:20677208-20677230 CTGTCCCTGTTGAAGAAGGGTGG - Intronic
1085387972 11:76168013-76168035 AAGGCCCCCTTGAAGAGCAGTGG + Intergenic
1087645712 11:100806038-100806060 AAGTCCATCTTGAATAGGGGTGG - Intronic
1088813053 11:113404493-113404515 ATGTCCTCCTTGAGGTGGGCTGG - Intergenic
1089042383 11:115464466-115464488 ATTTCCCCATTGATGAGGGAAGG + Intronic
1090448072 11:126781239-126781261 ATCTCCCCCTTGTAGAGATGAGG - Intronic
1091124091 11:133081164-133081186 ATGTCCCTGGTGGAGAGGGGAGG + Intronic
1091219653 11:133922501-133922523 ATGCCCCCCATCAAGAGAGGTGG - Intronic
1092194017 12:6538292-6538314 GTAGACCCCTTGAAGAGGGGAGG + Exonic
1100345689 12:93727868-93727890 GTTTCCCCCTTGAACAGGTGTGG - Intronic
1102056131 12:109897956-109897978 GTGTCCCCAGTGCAGAGGGGTGG - Intergenic
1106705001 13:32270818-32270840 CTGTCTCCCGTGAAGAGGGCAGG + Intronic
1111644179 13:91009480-91009502 ATGTCCCACTTGAACAAGTGTGG - Intergenic
1112201128 13:97276019-97276041 ATGTCCCACTTAAAGATGGTAGG - Exonic
1112307705 13:98290145-98290167 ATTTCCCCCTTGTAGAGGGCTGG + Intronic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1115598390 14:34931636-34931658 TTATCACCTTTGAAGAGGGGAGG - Intergenic
1120825901 14:88955051-88955073 ATGCTCCCTTTGAAGAGGGGAGG - Intergenic
1122159648 14:99773934-99773956 ATCTCCCCTTGGAGGAGGGGCGG + Intronic
1123956310 15:25338954-25338976 ATGTCCCCAATAAAGAAGGGAGG + Exonic
1124140541 15:27073259-27073281 ATGTCTGCCTGGAAGAGGAGGGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130899939 15:88199616-88199638 CAGTCTCCCTAGAAGAGGGGCGG - Intronic
1132589571 16:720799-720821 AAGTCTGCCTTGGAGAGGGGCGG - Intronic
1135623665 16:23977108-23977130 ATTTCTTCCTGGAAGAGGGGAGG - Intronic
1138338004 16:56268013-56268035 ATGCTCCCCTGGGAGAGGGGAGG - Intronic
1138393187 16:56684755-56684777 ATGTTCCGTTTGGAGAGGGGAGG + Intronic
1140723590 16:77791967-77791989 ATGTGGCCCTTGAAGAGAGAGGG + Intronic
1140974474 16:80045715-80045737 GTGTCCCCAGTGAAGAGGGTGGG + Intergenic
1141333668 16:83135430-83135452 ATGTCCCCATTGTACAGTGGAGG + Intronic
1145247152 17:21276831-21276853 AGGTCCCTCTGGAAGTGGGGGGG - Intergenic
1146492238 17:33291664-33291686 AGGTCCCCCTTGGAGAGGCGCGG + Exonic
1147214438 17:38891032-38891054 ATGTGCCCCTGTAGGAGGGGAGG + Intronic
1151212419 17:72554589-72554611 AGTACCCCCTTGAAGAAGGGCGG + Intergenic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1161197500 19:2995058-2995080 ATGTCCCCCTTGTTGGGGGGGGG - Exonic
1163721616 19:18900577-18900599 ATCTCCACCTTGCAGAGCGGTGG - Intronic
1165831213 19:38731288-38731310 ATGTCCTCCCTGAGGAGGTGGGG - Exonic
925554964 2:5120932-5120954 ATGTCCCCTTAGAAGGGAGGGGG + Intergenic
926044062 2:9696774-9696796 ATGCCCCCCTTTAAAAGGAGGGG - Intergenic
926399999 2:12487473-12487495 ATGTTCCCCTTTTAGAGGAGGGG - Intergenic
926931730 2:18047918-18047940 ATATCCCCCATGAATAAGGGGGG + Intronic
930300428 2:49609031-49609053 ATGATCCCCAGGAAGAGGGGTGG - Intergenic
932707786 2:74039981-74040003 ATTTCCCCCATGGAGAGGTGGGG - Intronic
934735746 2:96689058-96689080 ATGTCCCCATTGCACAGGTGAGG - Intergenic
936483935 2:112910663-112910685 ATGTCACCTTTGAAGAAGAGGGG + Intergenic
937156477 2:119723397-119723419 ATTTCCCCCTGGAAGCTGGGAGG - Intergenic
937532962 2:122852437-122852459 AAGTCACCCATGCAGAGGGGTGG - Intergenic
938114714 2:128595248-128595270 ATGTTCACCTTGCAGTGGGGTGG - Intergenic
940032873 2:149283424-149283446 CTTTCCCCTTGGAAGAGGGGAGG + Intergenic
943688780 2:190847621-190847643 TTTTTCCCATTGAAGAGGGGAGG + Intergenic
1169943359 20:10962059-10962081 ATGACTCCGTAGAAGAGGGGAGG - Intergenic
1173983455 20:47242422-47242444 ATCTCCACCTGGAAGAGGCGGGG - Intronic
1175756540 20:61533709-61533731 CTATTCCCCTTGAAGAGTGGGGG - Intronic
1179307907 21:40171397-40171419 AGGTCCCCACTGAAGAGGAGAGG + Intronic
1180131489 21:45829793-45829815 TTGTCCCACTTGAAGCGGGGAGG + Intronic
1180868839 22:19134741-19134763 TCGTTCCCCTTGGAGAGGGGTGG - Intronic
949514244 3:4792854-4792876 ATGTACCACTTGAAGGGAGGAGG + Intronic
951502645 3:23406939-23406961 GTGTCCCCCATGAGGAGGGCAGG + Intronic
952760407 3:36908560-36908582 ATGTGCCCTTTGAAGGTGGGTGG - Intronic
952881215 3:37987282-37987304 CAGGCCCCCTTGAAGAGGGGTGG + Intergenic
956065504 3:65393260-65393282 AAGACCACATTGAAGAGGGGGGG - Intronic
956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG + Intronic
959832502 3:110881091-110881113 AGGTTCCCCTTGAAGGTGGGTGG + Intergenic
962234595 3:133696458-133696480 ATATCCCCCTTGAATAAGGTGGG + Intergenic
962250132 3:133830965-133830987 ATGTCCCCTGTGGGGAGGGGAGG + Intronic
964180687 3:153880962-153880984 ATATCCCCCATGAATATGGGGGG - Intergenic
964183964 3:153920187-153920209 ATGTCCTCCTTGAGGAGGCAGGG + Intergenic
967019000 3:185506086-185506108 AGGTCACCAGTGAAGAGGGGAGG + Intergenic
973549204 4:52014914-52014936 ATGTTCAACTTGAAGAGGAGGGG - Intronic
982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG + Intronic
983599585 4:169511230-169511252 AGGGCCTTCTTGAAGAGGGGAGG - Intronic
985712175 5:1435710-1435732 ATGGCTCCCTTGAACAGTGGTGG + Intronic
985712251 5:1435971-1435993 ATGGCTCCCTTGAACAGTGGTGG + Intronic
987246180 5:16051290-16051312 CTGTACCCTTTGAAGAGAGGAGG - Intergenic
994506475 5:100648778-100648800 ATGTGCCCCTTTAAGAAAGGTGG - Intergenic
999665187 5:153905407-153905429 ATGTCTCCCTTGGACAGGGTTGG - Intergenic
1001911600 5:175523292-175523314 GAGCCCCCCTTGAAGAGGGCAGG + Intronic
1002789737 6:428274-428296 TTGTCCCAGTTGGAGAGGGGTGG + Intergenic
1002854325 6:1023888-1023910 ATGTCCTCCTTGATAAGGGATGG - Intergenic
1005087948 6:22025975-22025997 ATTACCCCCTTGCAGGGGGGAGG - Intergenic
1005261297 6:24063746-24063768 AAGACCCCCTTGGAGAGGGATGG + Intergenic
1005605015 6:27467880-27467902 ATGTCCCCCTTGGAGAAGGGTGG + Exonic
1007393754 6:41565552-41565574 ATGTCCCCCCAGGTGAGGGGTGG - Intronic
1008160456 6:48069127-48069149 ATGTGCCCCATAAAGGGGGGGGG + Intergenic
1008888498 6:56457750-56457772 GATTCCCTCTTGAAGAGGGGAGG + Intergenic
1015928591 6:138334631-138334653 GGGTCGCCCTTGAAGATGGGAGG - Exonic
1017072925 6:150592244-150592266 ATGTCTTCCTTTAAAAGGGGAGG + Intergenic
1017468476 6:154716961-154716983 ATGTCCTCCCTGAAGGGGAGGGG - Intergenic
1017823982 6:158068406-158068428 CTGTTCCCTTTGAACAGGGGAGG - Intronic
1020144939 7:5634959-5634981 AGGTAGCCCTTGCAGAGGGGTGG - Intronic
1020147044 7:5652628-5652650 ATATCCCCCCTGAAAAGGAGAGG - Intronic
1029612822 7:101636470-101636492 CTGTCCCACTTGCAGAGGGCAGG - Intergenic
1034827744 7:154282038-154282060 ATCTCCCCATTGGACAGGGGAGG - Intronic
1042344467 8:67713195-67713217 ATATCCCCCGTGAACAAGGGAGG + Intronic
1050037211 9:1449557-1449579 ATTTCCACCTTGAAGAGATGGGG - Intergenic
1050144163 9:2547930-2547952 ATGTCCCCCAGGTAGTGGGGTGG + Intergenic
1050564676 9:6869706-6869728 ACATACCCCTTGAAGAGGGAGGG - Intronic
1060040565 9:120296594-120296616 ATATCCACCTTTTAGAGGGGAGG - Intergenic
1061785908 9:133028377-133028399 AGGTCCCCCCTGGAGAGGGCAGG + Intergenic
1185834762 X:3335049-3335071 ATGTCCCCATTATAGAGGAGAGG - Intronic
1189276046 X:39786988-39787010 GTAGACCCCTTGAAGAGGGGAGG - Intergenic
1190114163 X:47614835-47614857 TTGTCCCAGTTGAAGCGGGGTGG - Intronic
1191175460 X:57495982-57496004 CTGACCCCATTGCAGAGGGGAGG + Intergenic
1196175604 X:112636173-112636195 ATGTCCCCCGGTATGAGGGGAGG + Intronic
1197539186 X:127733898-127733920 TTGTGCCTCTGGAAGAGGGGAGG + Intergenic
1201349399 Y:13023333-13023355 CTCTCCCCCTTGACTAGGGGAGG - Intergenic