ID: 956105574

View in Genome Browser
Species Human (GRCh38)
Location 3:65814225-65814247
Sequence ATGTAGATGAATATGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956105574_956105576 12 Left 956105574 3:65814225-65814247 CCTTCTTTCATATTCATCTACAT 0: 1
1: 0
2: 3
3: 41
4: 407
Right 956105576 3:65814260-65814282 ATAAAATTCATTCTCTAAGGTGG 0: 1
1: 0
2: 1
3: 27
4: 310
956105574_956105575 9 Left 956105574 3:65814225-65814247 CCTTCTTTCATATTCATCTACAT 0: 1
1: 0
2: 3
3: 41
4: 407
Right 956105575 3:65814257-65814279 ATGATAAAATTCATTCTCTAAGG 0: 1
1: 0
2: 3
3: 29
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956105574 Original CRISPR ATGTAGATGAATATGAAAGA AGG (reversed) Intronic
901096789 1:6687718-6687740 ATGTGAATGAAAATGAGAGAAGG - Intronic
901343550 1:8517892-8517914 CTGTAAATGAATATCAAAAAGGG + Intronic
902550332 1:17215372-17215394 ATGATGATGATGATGAAAGAAGG - Intronic
904659631 1:32074796-32074818 ATGAAGCTGAAGATGTAAGAAGG + Intronic
905056079 1:35094968-35094990 AAGTAGATTAATATTAAATAAGG + Intronic
907288617 1:53398014-53398036 AATTAGATGTATATGAAAGATGG + Intergenic
907325068 1:53632417-53632439 ATGTGGATGAATATGACTGAGGG + Intronic
907562758 1:55405950-55405972 ATTTATATGCATATGAAAGGAGG + Intergenic
907810626 1:57866322-57866344 ATGTAAATGAATAGGAGAGATGG - Intronic
907878049 1:58514204-58514226 ATGTATATGAATATGCATTAAGG + Intronic
909202000 1:72701512-72701534 ACATAGATGAATGGGAAAGAGGG - Intergenic
910018143 1:82552315-82552337 ATGGAGATGATTATAAAATATGG - Intergenic
910923183 1:92371393-92371415 AGGTAGATAAATAAGACAGATGG + Intronic
911155493 1:94632728-94632750 CTGTTGAAGAAAATGAAAGAAGG - Intergenic
911856072 1:102877049-102877071 ATGCAGGTTAATATTAAAGATGG - Exonic
913380309 1:118203120-118203142 ATGTATGGGAATATCAAAGAAGG - Intergenic
913526597 1:119699675-119699697 ATGTTCATGAAACTGAAAGAAGG - Intronic
914214665 1:145614300-145614322 TTGTAAAACAATATGAAAGAGGG - Intronic
914466605 1:147934690-147934712 TTGTAAAACAATATGAAAGAGGG - Intronic
916217335 1:162408743-162408765 CTTTAGATGAATATGCAAGATGG + Intronic
917169791 1:172158391-172158413 ATGAAGAAGCATATGAAAAAAGG + Intronic
917232308 1:172851586-172851608 ATGTAGATGAATAGCTTAGAAGG - Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
919053515 1:192540493-192540515 AGGTTGATGAAAATGAGAGATGG - Intergenic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919335577 1:196227325-196227347 AGATATATGAATAGGAAAGATGG + Intronic
919613045 1:199770445-199770467 ATATAGATAAATATGAACGATGG + Intergenic
920125324 1:203689752-203689774 AAGAAGATGCATATGAATGAAGG + Intronic
920405105 1:205703339-205703361 GTGGAGATGGATCTGAAAGAGGG - Intergenic
921705088 1:218313388-218313410 ATGTAGAGGGATATGGGAGAGGG + Intronic
922046572 1:221951184-221951206 ATGTAAAGGAATAGTAAAGAAGG - Intergenic
923098514 1:230794136-230794158 ATGTAGACAAAAATGAAAGGGGG + Intronic
923780074 1:237014530-237014552 TTGCAGATGAATATGAAATGAGG + Intergenic
924674076 1:246157672-246157694 TTGTAGCAGAATATAAAAGAAGG - Intronic
924683766 1:246266146-246266168 TAGTAGATGACTATGAAGGATGG - Intronic
1063589298 10:7380298-7380320 GTGTAGAAAAATCTGAAAGAGGG + Intronic
1063724738 10:8624370-8624392 AAGTAGATGAAGCTGAAAGCTGG - Intergenic
1063806690 10:9652967-9652989 ATGCATATTAAAATGAAAGATGG + Intergenic
1064073533 10:12250453-12250475 ATGTACATGAATATAAAAAGTGG - Exonic
1064907876 10:20367439-20367461 ATGTAAATGAATAAAAAAGCTGG - Intergenic
1066096624 10:32078258-32078280 ATGTAAATGAATATATGAGAAGG - Intergenic
1066126639 10:32348192-32348214 ATTTAGATGGATATGATAGATGG + Intronic
1066350651 10:34633968-34633990 ATGTAGTTGAGTATGGAATAGGG - Intronic
1067942061 10:50665473-50665495 ATGTACATGTATTTGAAGGAGGG - Intergenic
1068931823 10:62597615-62597637 ATGCACATGGATTTGAAAGATGG + Intronic
1069172292 10:65247424-65247446 GTGGAGATGAAGATGAAAGGGGG - Intergenic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069305755 10:66966907-66966929 ATTTAGTTGAATTTGAAACAGGG - Intronic
1070863300 10:79690418-79690440 ATGTATATGTATTTGAAGGAGGG - Intergenic
1071762589 10:88625667-88625689 ATGTAGAGTAAAATGAAAAATGG + Intergenic
1072164613 10:92801151-92801173 ATGTAGTTGAAAACAAAAGAGGG + Intergenic
1074571065 10:114624665-114624687 ATATAAATAAATATGAGAGAAGG - Intronic
1075170327 10:120107383-120107405 ATGAAGATCAATAGCAAAGAAGG - Intergenic
1075206335 10:120452656-120452678 ATGAAGCTCAATATGAAATATGG + Intergenic
1079494355 11:21024796-21024818 ATGTACATAAATAGGAAAGGTGG - Intronic
1080217483 11:29861874-29861896 TCATCGATGAATATGAAAGAAGG - Intergenic
1080276961 11:30513552-30513574 CTGTAGATGGATAAGACAGAAGG + Intronic
1080339817 11:31249187-31249209 ATCTTCATGAATATAAAAGAGGG + Intronic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1081317933 11:41653344-41653366 ATCTAGATGAAGAAGAAGGAGGG - Intergenic
1082222069 11:49650981-49651003 AGCTGGAAGAATATGAAAGATGG - Intergenic
1085103024 11:73817481-73817503 ATGTTGATGAGTATGTAAAAAGG - Intronic
1086626965 11:88968230-88968252 AGCTGGAAGAATATGAAAGATGG + Intronic
1086811203 11:91312451-91312473 TTGTAGATGAATATATAATATGG - Intergenic
1086942803 11:92815770-92815792 ATGGAGAGGAAGATGAAACATGG + Intronic
1087045899 11:93843797-93843819 ATGTAGATGGAAAAGAAAGTTGG - Intronic
1087122612 11:94590528-94590550 ATGGAGATGAATATGTAATTTGG - Intronic
1087377598 11:97364573-97364595 ACATAGGTGAATATGAAAGATGG + Intergenic
1087828797 11:102796680-102796702 ATTTTGATGAAGATGAAAGGTGG - Exonic
1087914931 11:103799248-103799270 AATTAGATGATTATGTAAGATGG + Intergenic
1088390254 11:109306215-109306237 ATGTACAGGAAGTTGAAAGAAGG - Intergenic
1088446976 11:109941410-109941432 ATGTTGTTGAATATTAAAGATGG - Intergenic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1089813557 11:121152157-121152179 ATCTAGATGCATTTGAAAAATGG + Intronic
1090678214 11:129025493-129025515 ATTTAGCTGAATAGGAAACAAGG + Intronic
1090715383 11:129425957-129425979 ATGTAAATGAATTAGAAACACGG - Intronic
1091024488 11:132129875-132129897 AGGTAGGTGAAGATGAAAAAGGG - Intronic
1091316724 11:134619074-134619096 ATGGAGATGAATAAGAAAGCAGG + Intergenic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1092685119 12:11034588-11034610 ATTAAGTTGAATATGCAAGAAGG - Intronic
1092689810 12:11095504-11095526 ATTAAGTTGAATATGCAAGAAGG - Intronic
1092693064 12:11136703-11136725 ATTAAGTTGAATATGCAAGAAGG - Intronic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1097048088 12:56202705-56202727 ATGGAGATGAATATATAATAAGG - Exonic
1097127607 12:56787264-56787286 ATGTAGGTAAATAAGATAGAGGG - Exonic
1097548598 12:61037329-61037351 ATGTAGATTAATGTGTATGATGG - Intergenic
1097698951 12:62801303-62801325 AAGTAAAAGAAGATGAAAGAGGG - Intronic
1097912313 12:64983789-64983811 ACATAGATGCATAAGAAAGAAGG - Intergenic
1098409302 12:70163236-70163258 GGGTGGATGAATAAGAAAGAAGG + Intergenic
1098697906 12:73582930-73582952 ATTTAGATGCATATAAAAGTAGG + Intergenic
1098731622 12:74042554-74042576 AAATAGATAAATAAGAAAGAGGG - Intergenic
1100040814 12:90314691-90314713 CTGTGGATGCATATGAAAAATGG + Intergenic
1100498678 12:95151813-95151835 AGGTAGATGAAAATGAAAAAAGG - Intronic
1102819254 12:115894094-115894116 AAGAAAATGGATATGAAAGAGGG + Intergenic
1103757747 12:123222992-123223014 ATGTATATGTATATAAAAAAAGG + Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1104315692 12:127698571-127698593 ATGGAGATGTATTTTAAAGATGG - Intergenic
1105314015 13:19240611-19240633 GTGTAGATGAATAAGAAATATGG + Intergenic
1106305925 13:28509461-28509483 TTCTAGATGAAAATGACAGATGG + Intergenic
1106359663 13:29018866-29018888 ATGTGCCTGATTATGAAAGATGG + Intronic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109476917 13:62891441-62891463 ATGATAGTGAATATGAAAGAGGG - Intergenic
1110336899 13:74343386-74343408 ATGTAGATGAAAGTAAAGGATGG - Intergenic
1110939702 13:81333983-81334005 AACTAGATTAATATGAAAAATGG - Intergenic
1111481641 13:88835055-88835077 GTGTTGATGAATATGAAAAAAGG + Intergenic
1111633563 13:90874512-90874534 ATGTACATGAAAACCAAAGAGGG + Intergenic
1114242680 14:20883023-20883045 ACGGAGATGAATGTGTAAGAGGG - Intergenic
1114249611 14:20946950-20946972 ACGGAGATGAATGTGTAAGAGGG - Intergenic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115734075 14:36304877-36304899 ATGTAGATGAATTCTAAACATGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116372252 14:44150922-44150944 ATGTATTTGAAGATGACAGAAGG - Intergenic
1116492239 14:45518307-45518329 ATGTAGATGTATATGGCAAAGGG + Intergenic
1116496409 14:45565999-45566021 ATGTAGATGTATATGGTATATGG - Intergenic
1116500334 14:45613539-45613561 ATGTAGATGAATATTCAACAAGG + Intergenic
1116830222 14:49712373-49712395 GTGTAGATGAATATGTTAAATGG - Intronic
1117243403 14:53859050-53859072 ATGTAGAGGAAGAGGAAAAAAGG - Intergenic
1117667829 14:58076010-58076032 AGGAAGAAGAATAAGAAAGAAGG + Intronic
1120203249 14:81561244-81561266 ATGGAGATGGATATGTAAGGAGG + Intergenic
1120427542 14:84367932-84367954 ATGTAGGTGAATCTGAATTAAGG - Intergenic
1120572048 14:86131101-86131123 ATGAAGAGGAATATGAAAGAAGG + Intergenic
1123894273 15:24812934-24812956 ATGTGTATGAACAGGAAAGATGG - Intergenic
1124469963 15:29975652-29975674 ATGTAGATAAATATTACAGCTGG + Intergenic
1125801316 15:42450478-42450500 ATGTAGAAGAATCTGAAAAAGGG - Exonic
1126330884 15:47529911-47529933 ATGAACATGAACATGAAACATGG - Intronic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126858052 15:52858239-52858261 ATGGAGATGAATATGAAACATGG + Intergenic
1127187865 15:56498569-56498591 ATCTAGAATAATAGGAAAGAGGG + Intergenic
1127828668 15:62729839-62729861 ATGCATATGAATCTGAAAGGAGG - Intronic
1128246954 15:66139549-66139571 ATTTAGTGGATTATGAAAGAAGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129568032 15:76645322-76645344 TTGTAGAAGAATATGTAAAATGG - Intronic
1129571064 15:76684070-76684092 ATAAATATGAATAGGAAAGATGG + Intronic
1130222082 15:82028130-82028152 ATGAACATGAATATGAGAGTGGG + Intergenic
1131124285 15:89845418-89845440 ATGAAGTTGACCATGAAAGATGG + Intronic
1131654206 15:94437854-94437876 ATGTAGATGAAAGAGAAAAATGG + Intronic
1132791218 16:1689764-1689786 AAGAAGATGGATATGAAGGAAGG + Intronic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1137714122 16:50587560-50587582 ATCTTGATGGATCTGAAAGAAGG + Intronic
1137808052 16:51326138-51326160 ATTTAGATGAATAAGAAGGGTGG - Intergenic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138170300 16:54843293-54843315 ATGAAGATGAAAGTGAAAGAGGG + Intergenic
1138630584 16:58291378-58291400 CTGCTGATGAATATGAAAGGTGG - Intronic
1138845124 16:60555542-60555564 ATGAATATGATTATGAAACAGGG - Intergenic
1139174619 16:64671857-64671879 ATGTGGATGGAAATGTAAGATGG + Intergenic
1139569614 16:67803225-67803247 ATGGGGATAAAAATGAAAGATGG + Intronic
1143476668 17:7207189-7207211 GTGAAGATGAATAGGCAAGAGGG + Intronic
1143607747 17:7999453-7999475 ATATAGATGAAGATGAAGGGGGG - Intergenic
1144704790 17:17361466-17361488 ATGAGGATGGATATGAGAGATGG + Intergenic
1146131168 17:30276792-30276814 ATGTATATTGATATGAATGATGG - Intronic
1150963980 17:69946891-69946913 AGGTAGAGGAATATGGAAGATGG - Intergenic
1151061499 17:71099878-71099900 TTGTAGACAAATATGAATGAAGG + Intergenic
1151232396 17:72694273-72694295 ATGTAAATGAAAACCAAAGATGG + Intronic
1151689282 17:75671390-75671412 GTGTATATGAAAAGGAAAGAAGG + Intronic
1153138830 18:1948541-1948563 AAGTAGATGAATTTGCAATATGG + Intergenic
1154031484 18:10757253-10757275 ATGGGGATGAATATGAGGGATGG + Intronic
1154031529 18:10757465-10757487 ATGGGGATGAAGATGAAAAATGG + Intronic
1154067188 18:11118329-11118351 AAGGAAATGAGTATGAAAGAAGG - Intronic
1155327056 18:24675156-24675178 ATGTTGAAGTATATTAAAGAGGG - Intergenic
1157997482 18:52576401-52576423 ATGTAGAATAATTTTAAAGAGGG + Intronic
1159060171 18:63506314-63506336 ATGAGGAGGAAGATGAAAGAGGG + Intergenic
1159598491 18:70406110-70406132 ATTTAGAGCAATATGGAAGATGG + Intergenic
1161365528 19:3877197-3877219 AGTTAGATGAATAAAAAAGAGGG - Intergenic
1162727532 19:12699097-12699119 AGATAGACGAATGTGAAAGATGG - Intergenic
1167226958 19:48251446-48251468 ATCCAGAGGAAAATGAAAGAGGG - Intronic
1168363588 19:55764751-55764773 AAATAGATGAATTTAAAAGAGGG - Intergenic
925791630 2:7494396-7494418 TTGTAGAAGAATATGGGAGAAGG + Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926759300 2:16263171-16263193 ATGCAGTTGAATTTTAAAGAGGG + Intergenic
926860911 2:17307791-17307813 ATATAGATTATTATCAAAGATGG + Intergenic
927305437 2:21566497-21566519 ATGTAGATGAAGCTGATAAAAGG + Intergenic
927387557 2:22552883-22552905 AAGCAGATGAAAATCAAAGATGG + Intergenic
927772479 2:25875952-25875974 AAATAGATGAAAATAAAAGAAGG - Intronic
928835203 2:35535794-35535816 ATTTAGATGAATAAGATATATGG - Intergenic
929412829 2:41716460-41716482 ATGTAGATTAATGAGAGAGAGGG + Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929826642 2:45313981-45314003 ATGGAGATGGCTATGAATGAAGG + Intergenic
931138357 2:59429689-59429711 ATGTAGATGAAAGTTCAAGATGG - Intergenic
931926202 2:67075180-67075202 AGGTAAATGAAAATCAAAGAAGG - Intergenic
932995063 2:76841750-76841772 AAGTATATAAAAATGAAAGAAGG + Intronic
933425431 2:82105703-82105725 ATGTGGATGAATATAGGAGAAGG - Intergenic
933638058 2:84728752-84728774 AAGCAGATGAACATGAAGGAGGG - Intronic
934864626 2:97795398-97795420 ATTTAGATAAAGAAGAAAGAAGG - Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935649166 2:105367374-105367396 ATGTTGATGTCTTTGAAAGAAGG + Intronic
936465713 2:112747520-112747542 ATGCAGGTGTTTATGAAAGAGGG + Intronic
936990921 2:118365182-118365204 ATGTAGAAGTTAATGAAAGAAGG - Intergenic
937707127 2:124933948-124933970 ATTTAGATGAAAATGAAGAAGGG + Intergenic
937713173 2:125001535-125001557 AGGCAGATGAATATGAGAAAAGG + Intergenic
938639195 2:133262704-133262726 CTGTAGATGAATAAGAATGTGGG - Intronic
939127580 2:138195471-138195493 AAGGAGAGGAATATGAAATAAGG - Intergenic
939227385 2:139380982-139381004 TTGTACATGATTATCAAAGATGG + Intergenic
939287291 2:140148763-140148785 ATGTAGATCCAAATGAAACATGG + Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
940324892 2:152414816-152414838 ATGTGAATGCACATGAAAGAGGG - Intronic
940490792 2:154357426-154357448 ATGTAGTTGAATGAGAAAGTGGG - Intronic
940701744 2:157053300-157053322 CCCTAGATTAATATGAAAGATGG - Intergenic
940776494 2:157889954-157889976 ATGTAAACAAATATGGAAGAAGG - Intronic
940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG + Exonic
941599248 2:167520067-167520089 AAATATATTAATATGAAAGATGG + Intergenic
941745341 2:169080907-169080929 ATGCAGATGAGTATTAAAGTGGG - Intronic
942306887 2:174617454-174617476 AGGTAGATGAACATGTACGAGGG - Intronic
943155929 2:184176744-184176766 ATGTCAATGAATACTAAAGAAGG - Intergenic
944735877 2:202564191-202564213 ATGTCCATAAATATGAAAAAAGG - Exonic
944862944 2:203832261-203832283 ATGTAGAAACATATGAAAGGTGG + Intergenic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
945751918 2:213797955-213797977 ATGTTGATGAGAATGAGAGAAGG - Intronic
946747798 2:222862455-222862477 AGGTTGATAAACATGAAAGAAGG - Intronic
947099169 2:226600812-226600834 ATGAATGTGAATATGAAATATGG + Intergenic
948579639 2:238976357-238976379 ATATAGGTAAATATAAAAGATGG + Intergenic
948584447 2:239010427-239010449 ATGTAGATCCAAATAAAAGAAGG - Intergenic
1169709036 20:8540604-8540626 ATGTGGAGTAATTTGAAAGATGG - Intronic
1170684100 20:18553562-18553584 TTGTGGATGAGTATAAAAGAAGG + Intronic
1170814616 20:19703017-19703039 ATGTAAATGAACAAGAAACAGGG + Intronic
1172473745 20:35221546-35221568 ATATAAATAAATATGAAAGGAGG + Intergenic
1173169764 20:40714483-40714505 ATGCAGCTGAATATGAAATATGG - Intergenic
1173637060 20:44569155-44569177 ATGTAGGTGAAAATGGAAAACGG - Intronic
1174685642 20:52452494-52452516 ATTCAGTTGAATAAGAAAGAAGG - Intergenic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1174888676 20:54365158-54365180 ATGCATATGCTTATGAAAGATGG + Intergenic
1177545705 21:22555756-22555778 ATGTAGATTATTATAAAAGAAGG + Intergenic
1178909602 21:36663988-36664010 ATGAATATGAATATGAAAGGCGG + Intergenic
1179622798 21:42628983-42629005 AAGTAGATGAATGAGATAGATGG + Intergenic
1179622800 21:42629120-42629142 AAGTAGATGAATGAGATAGATGG + Intergenic
1179622803 21:42629238-42629260 AAGTAGATGAATGAGATAGATGG + Intergenic
1181429486 22:22869980-22870002 ATGTAGATCTAGATGAAAGGGGG + Intronic
1182201220 22:28572489-28572511 AAGTAGATGAATATTAAACATGG + Intronic
1182469622 22:30540122-30540144 GTCTAAAGGAATATGAAAGAGGG + Intronic
1183644351 22:39114939-39114961 AAGTAGATGAATAGGAGAAAAGG + Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
949146491 3:706912-706934 ATGTGAAAGAATGTGAAAGAGGG + Intergenic
949528280 3:4928045-4928067 ATGTGTATGGAAATGAAAGAAGG - Intergenic
949792318 3:7806611-7806633 ATGTAAATGAATTGGAAGGATGG - Intergenic
949841770 3:8327650-8327672 ATGAAGATGAAAATGTAACAGGG + Intergenic
950085930 3:10257735-10257757 ACGAAGATGAATAGGAAAGGTGG - Intronic
950138935 3:10601886-10601908 ATGAAGACAAATAAGAAAGAGGG - Intronic
951787710 3:26441191-26441213 GTGTAGATGTATATGCAATATGG - Intergenic
953294382 3:41698652-41698674 ATTTACATAAATATGAAAAAAGG - Intronic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
954998284 3:54902040-54902062 ATGAAGATGAATATGTGAGCAGG + Intronic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
956893701 3:73638431-73638453 ATGCAGACCAATATGATAGAAGG + Intergenic
957274435 3:78072938-78072960 ATGTAGATGAATCAGAATGATGG - Intergenic
957819558 3:85354097-85354119 ATGTAGCTGAATATAAATAAAGG - Intronic
959926695 3:111929822-111929844 ATCTAGAAGAATATGCAAGCAGG - Intronic
960213304 3:114998171-114998193 ATGTACATGGTTATGTAAGATGG - Intronic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
960574140 3:119213105-119213127 ATGTAGATGAGGATGAATGAAGG + Intronic
963534783 3:146513995-146514017 ATTGTGCTGAATATGAAAGAGGG + Intergenic
964397263 3:156258513-156258535 AGGTGGATGCATATGAATGAGGG - Intronic
964799227 3:160535020-160535042 ATGTAGATTAAGATTAATGACGG - Intronic
964815995 3:160718662-160718684 TTGAAGATGAAGATTAAAGATGG + Intergenic
965612940 3:170563805-170563827 ATGCAGATGAAAACCAAAGAGGG - Intronic
965844150 3:172942009-172942031 ATCTTGAAGAATATGAGAGAAGG + Intronic
966472484 3:180306824-180306846 ATGCAGAGGAAGAAGAAAGAGGG - Intergenic
967470579 3:189857175-189857197 AAATAGATCAATAGGAAAGAGGG + Intronic
968162133 3:196435256-196435278 AAGAATATGAATATGAAGGATGG + Intergenic
968343106 3:197975650-197975672 ATCTAGATTACTATGAATGATGG - Intronic
970360173 4:15301430-15301452 ATGAAGAGGAAGATGAAAAAAGG + Intergenic
970465398 4:16317446-16317468 TTGTAGGGGAATATAAAAGATGG + Intergenic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971519481 4:27530963-27530985 AAGTAGCAGAATATCAAAGAAGG - Intergenic
971758272 4:30730742-30730764 ATGTAGACGCATCTGAAAGAAGG - Exonic
972912855 4:43839834-43839856 ATGAAAATGAAAATGAAACATGG - Intergenic
973159888 4:47002925-47002947 ATGAAGATAAATATCAGAGAAGG + Intronic
973287981 4:48440696-48440718 ATGTTAATGAATTTCAAAGATGG - Intergenic
973655220 4:53040269-53040291 ATGTAACTCAATATGAGAGAGGG + Intronic
974439319 4:61896724-61896746 ACGGAGATGCATATGTAAGAGGG - Intronic
974482013 4:62457241-62457263 ATGGTGAGGAAGATGAAAGAAGG + Intergenic
975001813 4:69233707-69233729 ATGTATTAAAATATGAAAGAAGG + Intergenic
975003629 4:69258385-69258407 ATGTATTAAAATATGAAAGAAGG - Intergenic
975011991 4:69366981-69367003 ATGTATTAAAATATGAAAGAAGG - Intronic
975915054 4:79314977-79314999 ATGTAAATGTATATTTAAGAAGG + Intronic
976487865 4:85628846-85628868 ATATAGATTAAAATTAAAGAAGG - Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978270253 4:106880408-106880430 ATGTATATTAAAATGAAAGTTGG + Intergenic
978965888 4:114741118-114741140 GTGTAGTTGAATATTCAAGAAGG + Intergenic
978970683 4:114800852-114800874 CTGTAGATGACCATTAAAGAGGG + Intergenic
979359785 4:119747959-119747981 ATGCAGAGAAATATGACAGATGG + Intergenic
979476257 4:121160965-121160987 ATACAGGTGAATAAGAAAGAAGG + Intronic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
980011301 4:127597511-127597533 ATCTAGATGTATCTGGAAGATGG + Intergenic
980847913 4:138345869-138345891 ATGTGGATGAATCTGAGAGTAGG - Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
981307596 4:143263239-143263261 ATGTATCTGAATTTGAAAAAAGG + Intergenic
982038616 4:151372558-151372580 ATGCATATTATTATGAAAGAAGG + Intergenic
982259160 4:153479322-153479344 ATGGGGATGAAGAGGAAAGAGGG - Intronic
983437972 4:167740306-167740328 ATGTATATAAACAAGAAAGAGGG + Intergenic
983780158 4:171660538-171660560 ATGTAACTGAAAATGAAGGAAGG - Intergenic
983799840 4:171913565-171913587 ATATAGATTTATATGAAAAATGG - Intronic
984347300 4:178545915-178545937 ATATAGATAAGTATGAAACATGG + Intergenic
985043846 4:185919969-185919991 AGGAAGATTAATAAGAAAGATGG - Intronic
986681125 5:10233490-10233512 ATGTAGAGAAATCTGAAATAAGG - Intronic
988877233 5:35459874-35459896 ATTAAAATGAATATGAAAGGTGG - Intergenic
989224799 5:39013885-39013907 CTGTAGATGTATATGCAAAAAGG - Intronic
989474981 5:41864462-41864484 AAGCAGATGAATAGAAAAGAGGG - Intronic
989531149 5:42509591-42509613 ATGTCCTTGAATATGCAAGAGGG - Intronic
991395560 5:66201358-66201380 ATGTAGAGGAACAAGAATGATGG - Intergenic
991942934 5:71871841-71871863 ATGTATATGAATATGATTTATGG + Intergenic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
993140443 5:84026396-84026418 ATGAAGATAAAAAAGAAAGATGG - Intronic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
993922812 5:93828497-93828519 AAGTAGATGGATTTGAGAGACGG - Intronic
994040519 5:95254510-95254532 ATGTAGATCATTAGAAAAGACGG - Intronic
994816531 5:104593618-104593640 ATGTAGATGGATAGTAAAAAAGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995900382 5:117059009-117059031 ATATAAATGAAAATGAAAGAAGG - Intergenic
996386557 5:122915195-122915217 ATGGAGATGGAGATGAAAGTGGG - Intronic
996409346 5:123140409-123140431 ATGTAAATAAATTTCAAAGATGG - Intronic
996743281 5:126821916-126821938 ATGTGGATGAATATGTAATTTGG + Intronic
997893622 5:137696344-137696366 ATATAGATGAACAGGAAAGCTGG + Intronic
998143816 5:139714337-139714359 ATGTACATGAATATGCATGTGGG - Intergenic
998881779 5:146652555-146652577 ATGTATTGGAATGTGAAAGATGG + Intronic
999033871 5:148325362-148325384 ATGTAAATGAAAATGTAAAATGG - Intronic
999235639 5:150091178-150091200 ATGTTGGTGAAAATGAAAAATGG + Intronic
1000483986 5:161816134-161816156 AAGCAGATGAAAATGAAGGAAGG - Intergenic
1004102841 6:12632304-12632326 ATAGAGATAAAAATGAAAGAAGG - Intergenic
1007198116 6:40080787-40080809 AGAAAGATGTATATGAAAGAAGG + Intergenic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1008056307 6:46949474-46949496 ATGTAGCAGAAAAGGAAAGATGG + Intronic
1008399180 6:51044443-51044465 ATTTATATGGAAATGAAAGATGG - Intergenic
1008408777 6:51148613-51148635 ATGTAGCCAAATATGAAGGAAGG + Intergenic
1008708775 6:54197733-54197755 TAGTAGATAAAAATGAAAGAAGG + Intronic
1008715911 6:54289393-54289415 ATGTGGATTGATAAGAAAGATGG + Intergenic
1009440934 6:63677284-63677306 GTGTAGATAAAGAAGAAAGATGG + Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1010542213 6:77105663-77105685 ATATAGATTAATATGTAGGAAGG - Intergenic
1010558382 6:77314937-77314959 ATATAGAAAAATATGAAAGGTGG - Intergenic
1010615825 6:78010969-78010991 AAGGAGATAAATATGAGAGAGGG - Intergenic
1010973297 6:82285992-82286014 ATTTAGAAAAATATAAAAGAAGG - Intergenic
1011838008 6:91457747-91457769 ATATAGAACATTATGAAAGAAGG + Intergenic
1011889755 6:92143161-92143183 ATGTAAATGTATATGATATATGG - Intergenic
1012374513 6:98545401-98545423 ATGAAGATAAATATGAGAAATGG + Intergenic
1012410832 6:98954948-98954970 AAGTAGCTGAATATAATAGAAGG + Intergenic
1013979444 6:116112334-116112356 ATGTAGAGAAGTATGGAAGAAGG + Intronic
1014376693 6:120684319-120684341 AAGTATATGAATATCACAGAGGG - Intergenic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016327523 6:142920244-142920266 AAGTAGCAGAATATGATAGAAGG - Intronic
1016563965 6:145430760-145430782 CTGAAGATGAATATGAGAAATGG + Intergenic
1017444503 6:154495040-154495062 ATGTACATGAATATGACACCCGG - Intronic
1018709498 6:166487613-166487635 ATGAAGATGAATCTGCAGGAAGG + Intronic
1019027789 6:168985736-168985758 AAGTAAATAAATATGAAGGAAGG + Intergenic
1019923110 7:4175192-4175214 ATGTTGATGAATGTTGAAGACGG + Intronic
1020001033 7:4755759-4755781 AAGAAGATAAATATAAAAGAGGG + Intronic
1020978827 7:15042228-15042250 AAGTAGATGAATGTCAATGATGG + Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021795294 7:24248593-24248615 ATGCAGAGGTATGTGAAAGAAGG + Intergenic
1022009370 7:26295360-26295382 TTGCAGATGAATATGAAATCAGG - Intronic
1022881295 7:34590412-34590434 AAGTAGATGATAATGAAAAATGG - Intergenic
1022886150 7:34646295-34646317 AGAGAGATGAAAATGAAAGATGG + Intergenic
1023637189 7:42224264-42224286 ATGTAGAAAAATAAGCAAGATGG - Intronic
1024486435 7:49925529-49925551 ATGGAGCTGATGATGAAAGATGG + Intronic
1024773409 7:52753742-52753764 ATCTAGATGAAAATGACAAAAGG - Intergenic
1024958837 7:54954269-54954291 AGGAAAATGAAAATGAAAGAGGG + Intergenic
1025016989 7:55447619-55447641 ATGCATATGTATATGAAATATGG - Intronic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1027838779 7:83279948-83279970 ATGGTGAGGAATATGAAAGTAGG - Intergenic
1027905514 7:84175623-84175645 ATCCAGATGACTCTGAAAGAAGG - Intronic
1028127915 7:87135805-87135827 AGGTAGAGGACTATGGAAGAGGG - Intergenic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028437454 7:90821113-90821135 ATGTAGAGGAATGTGAAAGAAGG - Intronic
1029958857 7:104668629-104668651 ATGAAGACCAATATGACAGACGG + Intronic
1030175435 7:106648885-106648907 ATGTAGTGGAATATTAAGGATGG - Intergenic
1030279979 7:107763689-107763711 ATGAACAAGAATATAAAAGAGGG - Intergenic
1030620034 7:111779137-111779159 ATGTAAAAGAATGGGAAAGAGGG + Intronic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1031503762 7:122555193-122555215 CTGTAGATCAATACCAAAGAAGG + Intronic
1032539864 7:132694093-132694115 ATGGAGATGAATTTGTAAAAGGG + Intronic
1032586213 7:133149320-133149342 GTGTAGATGGATTTGAAGGAGGG + Intergenic
1033755391 7:144395155-144395177 AGGAAGATGAATATGAAAAGGGG - Intergenic
1036567870 8:9953120-9953142 ATCTTGAAGAATTTGAAAGAGGG - Intergenic
1037481332 8:19308620-19308642 AAATAGAGAAATATGAAAGAGGG - Intergenic
1037678741 8:21075012-21075034 ATGTCCTTGAATATGCAAGAGGG - Intergenic
1037851019 8:22328427-22328449 TTGTATATGAATTTGAGAGAAGG + Intronic
1038085912 8:24195944-24195966 ATGTGGGTGAAAATCAAAGAAGG + Intergenic
1038468718 8:27791728-27791750 ATGTATATGACTATAAAACAAGG - Intronic
1038773738 8:30509203-30509225 AAGGAGAAGAATATGAAAGTAGG - Intronic
1039651831 8:39349354-39349376 ATGTATATTTATATTAAAGAGGG - Intergenic
1040406976 8:47114634-47114656 AAATAGATGAGGATGAAAGAAGG - Intergenic
1040560183 8:48516990-48517012 CTTTAGATGACAATGAAAGAGGG - Intergenic
1041792433 8:61712512-61712534 ATGTAAAAGAATATGTAAAAGGG - Intronic
1041831679 8:62161989-62162011 ATGTGCATGAATGTGGAAGAGGG - Intergenic
1041921135 8:63182741-63182763 ATGGAGATGCATAGGAAAGGTGG - Intronic
1042823079 8:72952902-72952924 ATGAGGTTGAATATGGAAGAAGG - Intergenic
1042924196 8:73950792-73950814 ATGTAATTCAATATGAAATATGG + Intronic
1042963728 8:74329253-74329275 ATGTAGCTGAAAATGAATGGAGG + Intronic
1043240820 8:77932991-77933013 ATGTGACTGAAAATGAAAGATGG - Intergenic
1043404334 8:79915423-79915445 ATGGACATGAATATGGGAGAAGG + Intergenic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1044549911 8:93500508-93500530 TTGTAGATTAAAAAGAAAGAAGG + Intergenic
1044811398 8:96066919-96066941 ATATAGATGATTATGATAAAAGG - Intergenic
1045079718 8:98612485-98612507 ATATATATATATATGAAAGATGG + Intronic
1045539854 8:103073598-103073620 ATTAAGATGAAAGTGAAAGAAGG + Intergenic
1046647700 8:116803966-116803988 ATGTATATGACTAGGAAATACGG + Intronic
1048346819 8:133582107-133582129 AGGTAGATGAGTTTCAAAGAAGG + Intergenic
1048410750 8:134169715-134169737 CTGTAGAGGAATATGAAATCAGG - Intergenic
1048649656 8:136461168-136461190 GTGTAGATAAAACTGAAAGAAGG + Intergenic
1049134536 8:140884023-140884045 TGGGAGGTGAATATGAAAGAAGG - Intronic
1049291599 8:141805938-141805960 AATTTGATGACTATGAAAGATGG - Intergenic
1049937606 9:514275-514297 ATTGAGATGAATAGGAAGGAAGG - Intronic
1050232626 9:3543785-3543807 ATGTAGATGAACATGTCAGCTGG + Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050871406 9:10575277-10575299 ATCTTGAAGAATATGAAAGTTGG + Intronic
1053096572 9:35333728-35333750 ATGTACAAGAATTTGAGAGAGGG - Intronic
1053552107 9:39093068-39093090 ATTTAGTTGAAAATAAAAGAAGG - Intronic
1053816241 9:41913210-41913232 ATTTAGTTGAAAATAAAAGAAGG - Intronic
1054106501 9:61056894-61056916 ATTTAGTTGAAAATAAAAGAAGG - Intergenic
1054614356 9:67274231-67274253 ATTTAGTTGAAAATAAAAGAAGG + Intergenic
1055141668 9:72883389-72883411 TTGTAGAAAAATATGAGAGAAGG - Intergenic
1055287967 9:74750816-74750838 AGGTAGATGAAGAAAAAAGAAGG - Intronic
1055349300 9:75369694-75369716 GTGTAAGTGAATATGAAATAAGG + Intergenic
1056037181 9:82619042-82619064 ATGTAGATGGATGTGATATAAGG + Intergenic
1056566381 9:87776501-87776523 ATATAGATAAATAAGAAAAACGG + Intergenic
1056662990 9:88558368-88558390 AGGGAGATGCATATGAGAGAAGG - Intronic
1056748047 9:89321970-89321992 ATGTAGTTGAACAAGTAAGAAGG - Intronic
1056784946 9:89584813-89584835 ATTTAGATTAAGATTAAAGAGGG + Intergenic
1057392487 9:94651351-94651373 ATGTAGTTGAATATTCAAGAAGG - Intergenic
1057691355 9:97289562-97289584 ATGTAAAGGAAAATGAAAAAGGG - Intergenic
1058323689 9:103667659-103667681 ATGTATTTGAATATAACAGATGG + Intergenic
1058599576 9:106654520-106654542 ATGTAGTTCAATATGACAGAAGG - Intergenic
1058629448 9:106971538-106971560 ATGTAAATGAAGATAAAAGATGG + Intronic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1060573622 9:124667342-124667364 ATATACATGAATATGAAAGTAGG - Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1190431560 X:50382668-50382690 ATGAAGATGAATCTGCATGATGG + Intronic
1191808897 X:65165190-65165212 ATGTGGAGCAATATAAAAGAAGG - Intergenic
1193917431 X:87382588-87382610 ATGTAGATTAAGAAGAAAAATGG + Intergenic
1194036160 X:88874995-88875017 ATATATATGAATATGATATATGG + Intergenic
1194036161 X:88875020-88875042 ATATATATGAATATGATATATGG + Intergenic
1194099427 X:89684693-89684715 ATGAAGCTGAATTTGAAAGCAGG + Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194342733 X:92724777-92724799 ATATAGGTAAATATGAAAGGTGG + Intergenic
1194467566 X:94252830-94252852 ATGTTGCTGAAACTGAAAGAAGG - Intergenic
1194566106 X:95490737-95490759 AGGTAGATGAAGATGAGAAAGGG - Intergenic
1195783841 X:108495018-108495040 ACATAGATCAATATGATAGAAGG + Intronic
1196153624 X:112403198-112403220 AAGTAAATGAAAAAGAAAGAAGG - Intergenic
1197696552 X:129556027-129556049 ATGGAGAAAAATGTGAAAGAAGG - Intronic
1197966011 X:132062501-132062523 ATGTAAATGGATAAGAAAAAGGG - Intergenic
1198000299 X:132427705-132427727 ATTTAGATGCATATAAAAGATGG + Intronic
1198990719 X:142511603-142511625 AGGTAGGTGAATAAGGAAGATGG + Intergenic
1199178552 X:144823291-144823313 ATGTTAATGTATATAAAAGACGG + Intergenic
1199203280 X:145118703-145118725 ATGTACACGAACATGAAAGAGGG - Intergenic
1199804381 X:151283291-151283313 ATGAGGATGAATATGCAGGAAGG - Intergenic
1200311530 X:155083522-155083544 ATGTAGATGTGTAAAAAAGAGGG - Intronic
1200376715 X:155788559-155788581 ATGTTTAAGAAAATGAAAGAAGG - Intergenic
1200452434 Y:3346072-3346094 ATGAAGCTGAATTTGAAAGCAGG + Intergenic
1200651094 Y:5841442-5841464 ATATAGGTAAATATGAAAGGTGG + Intergenic
1200936111 Y:8739923-8739945 ATGCAGATGAAGTTGAGAGAGGG + Intergenic