ID: 956105980

View in Genome Browser
Species Human (GRCh38)
Location 3:65819417-65819439
Sequence ATGACCAATGTGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956105980_956105987 13 Left 956105980 3:65819417-65819439 CCCTCCACCCTCACATTGGTCAT 0: 1
1: 0
2: 1
3: 27
4: 312
Right 956105987 3:65819453-65819475 GTATACAAGTGAATAACAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 100
956105980_956105989 23 Left 956105980 3:65819417-65819439 CCCTCCACCCTCACATTGGTCAT 0: 1
1: 0
2: 1
3: 27
4: 312
Right 956105989 3:65819463-65819485 GAATAACAGCAGGACAGTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 148
956105980_956105988 22 Left 956105980 3:65819417-65819439 CCCTCCACCCTCACATTGGTCAT 0: 1
1: 0
2: 1
3: 27
4: 312
Right 956105988 3:65819462-65819484 TGAATAACAGCAGGACAGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956105980 Original CRISPR ATGACCAATGTGAGGGTGGA GGG (reversed) Intronic
900835189 1:4997818-4997840 GTGGCAAATTTGAGGGTGGAAGG - Intergenic
900846395 1:5105715-5105737 ATGACCAGTGAGAAAGTGGAAGG + Intergenic
901163302 1:7197222-7197244 GTGTCAAATGTGAGGATGGAAGG + Intronic
901220171 1:7579193-7579215 AGGAGGACTGTGAGGGTGGAGGG - Intronic
901479413 1:9514486-9514508 TTGTCCACTGAGAGGGTGGAGGG + Intergenic
904150780 1:28437760-28437782 ATGACCAATGTGATGGTGATAGG - Intronic
905274247 1:36806873-36806895 GAAACCACTGTGAGGGTGGAGGG + Intronic
905325126 1:37146432-37146454 AAGACCACTGTGAGGTTGGGTGG - Intergenic
906566803 1:46806722-46806744 AGTGCCAATGTGAGGGTGGGAGG + Intronic
907062906 1:51449426-51449448 GGGGCCAATGTGAGGGTGGAGGG + Intronic
908489254 1:64626631-64626653 ATGACCAATGTGCAAGAGGAGGG - Intronic
908790750 1:67779008-67779030 ATGACCAAAGTGGTGGTGGCTGG + Intronic
909708440 1:78615309-78615331 ATCACCAATGTGATGGTTTAAGG - Intergenic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911245104 1:95508338-95508360 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912654849 1:111477103-111477125 ATGAACATTGTGTGGGTTGAGGG + Intronic
913510704 1:119559031-119559053 ATGACCAACATGATGGTGGTAGG + Intergenic
914227666 1:145734814-145734836 ATAAACAATGTCAGGGTGGGTGG + Intronic
915553363 1:156647640-156647662 ATGAGCAATGTGATGCTGGCTGG + Exonic
915697605 1:157760278-157760300 GGGACCTATTTGAGGGTGGAGGG + Intronic
916616502 1:166446604-166446626 GGGACCTATTTGAGGGTGGAGGG - Intergenic
917354786 1:174115752-174115774 ATCACCAATGTGATGGTGTTAGG + Intergenic
918481210 1:184978669-184978691 AGGGCCTATTTGAGGGTGGAGGG + Intergenic
919918305 1:202152721-202152743 AGAACCAAGGTCAGGGTGGAGGG + Intronic
921155951 1:212438962-212438984 ATGACAACTGAGAAGGTGGAGGG - Intronic
922120681 1:222664578-222664600 ATTCCCAAGGTGAGGGTTGAGGG - Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923344150 1:233034815-233034837 ATGAAGAGTGTGAGAGTGGAAGG + Intronic
923414773 1:233745895-233745917 ATGACAAATGTGAGGCAGGCAGG + Intergenic
1063146346 10:3298397-3298419 ATGGCCAATGTTAGGGGCGATGG + Intergenic
1064818391 10:19293743-19293765 GTGACCTATTTGAGGGTGGAGGG + Intronic
1068048023 10:51912457-51912479 ATAACCCAGGTGAGGGTGGATGG + Intronic
1069054815 10:63833590-63833612 GAGATCAGTGTGAGGGTGGAGGG - Intergenic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1073481261 10:103787520-103787542 ATCCCCAGTGGGAGGGTGGAGGG - Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1073955580 10:108867593-108867615 AGGACCTATCAGAGGGTGGAAGG + Intergenic
1075330362 10:121569800-121569822 ATGACCACTGAAGGGGTGGAGGG - Intronic
1075450570 10:122549240-122549262 ATGACCACAGTGAGAGAGGAAGG - Intergenic
1076355710 10:129851345-129851367 CTGACAGATGTGAGGGTGGGGGG - Intronic
1076772994 10:132677226-132677248 AAGACCAATGTGAGCTGGGATGG - Intronic
1078890161 11:15548299-15548321 ATCCCCAATGTGAGGGTGTTTGG - Intergenic
1078932590 11:15923882-15923904 AAGACCAATGGGAGGAAGGAAGG - Intergenic
1078991225 11:16648315-16648337 ATGGCCACTGTGAGGGTTGGGGG - Intronic
1080095785 11:28404586-28404608 ATCACCAATGTGATGGTGCTAGG - Intergenic
1080102405 11:28474801-28474823 ATAACCCAAGTGAGGGTGAATGG + Intergenic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1083992516 11:66255516-66255538 AAGGCCAATGTGAGGGCTGAAGG + Intergenic
1085253385 11:75158538-75158560 ATGACCTATTTCAGGGTGAAAGG + Intronic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086403557 11:86480942-86480964 AAGCCCAAGGTGAGGGTGTAAGG - Intronic
1088629852 11:111764335-111764357 AAGACCAATGTGAGGGGGCTTGG - Intronic
1089826114 11:121279726-121279748 ATGACCAATCTAAGGGTAGTTGG - Intergenic
1090083675 11:123632218-123632240 ATGAGCAGTGTGAGAGGGGAGGG - Exonic
1091122508 11:133067777-133067799 ATGAGCCATGTCAGGGTTGAGGG - Intronic
1091667570 12:2430504-2430526 AAGGCAAGTGTGAGGGTGGATGG - Intronic
1091968616 12:4766561-4766583 ATGACCAAGGACAGGGCGGAGGG + Intronic
1093167169 12:15817492-15817514 AGGACCTATAGGAGGGTGGAGGG + Intronic
1095155605 12:38850171-38850193 AGGAACAGTGGGAGGGTGGAGGG - Intronic
1095526458 12:43131532-43131554 AAGACTAATGGCAGGGTGGAAGG + Intergenic
1095575095 12:43727671-43727693 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1096237930 12:49942494-49942516 ATGCCCAGGCTGAGGGTGGAGGG - Intergenic
1097175457 12:57139956-57139978 ATGACCCATGTGTGCCTGGATGG - Intronic
1097319962 12:58214445-58214467 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1100514577 12:95314705-95314727 GTGATCTATGTGAGGGAGGATGG + Intergenic
1101955733 12:109211143-109211165 ATCACCAATTTGTGGGTGGGTGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102683967 12:114709920-114709942 ATGAGCAATCTGGGGGTGGAGGG + Intergenic
1103370557 12:120416102-120416124 TTGATCAATCTGCGGGTGGAAGG - Intergenic
1104281322 12:127380663-127380685 ATGACCGATGTGCCCGTGGACGG + Intergenic
1104298032 12:127536381-127536403 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1104532690 12:129587378-129587400 TGGGCCTATGTGAGGGTGGAAGG + Intronic
1104968050 12:132518333-132518355 ATGATGAATGCGTGGGTGGATGG - Intronic
1106228234 13:27801178-27801200 ATGACCCATGACAGTGTGGAAGG + Intergenic
1107053729 13:36080234-36080256 ATAACCAGTGTTCGGGTGGAGGG + Intronic
1108585561 13:51867046-51867068 ATGACCAGAGTGAGGGAGTAAGG + Intergenic
1109981402 13:69913102-69913124 ATGAGCACTGTGAGGGAGAAAGG - Intronic
1110146592 13:72199181-72199203 ATGACCAGAGGGAGGGGGGAGGG + Intergenic
1110289042 13:73783103-73783125 ATGACCAATATAAGGGTTGAAGG + Intronic
1111016340 13:82387058-82387080 ATGAACAAAGTGGGGGTGGCAGG - Intergenic
1113294899 13:108948137-108948159 AGGAGCAAAGTGAGGGTGCATGG + Intronic
1113966304 13:114155565-114155587 ATGCACGGTGTGAGGGTGGAGGG + Intergenic
1113966555 13:114156164-114156186 ATGCCGGATGTGAGGGTAGAGGG + Intergenic
1114570391 14:23663205-23663227 ATCACCAATGTGATGGTAGTTGG + Intergenic
1114756843 14:25269353-25269375 ATGGCCACTGTGGGGATGGAGGG + Intergenic
1114775065 14:25472700-25472722 TTGAACAATGTGAGGGTTGCAGG - Intergenic
1115341896 14:32301421-32301443 AGGACCTACCTGAGGGTGGAGGG - Intergenic
1115864682 14:37732004-37732026 TTGAACAATGTGAGGGTTGGGGG + Intronic
1116338816 14:43695681-43695703 ATGACTGCTGTGAGGGTGTAAGG - Intergenic
1117257136 14:53989459-53989481 ATGACCAAAGAAAGGTTGGATGG + Intergenic
1119025540 14:71149394-71149416 ATGCCCAGTGTGAGGCTTGATGG + Intergenic
1126213589 15:46128817-46128839 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131131209 15:89901603-89901625 ATGACCACTGTGTTGGTGGTGGG - Exonic
1133286188 16:4691953-4691975 TTGAAGACTGTGAGGGTGGAGGG + Intergenic
1133575944 16:7089992-7090014 ATTAACACTGTGAGGTTGGAGGG + Intronic
1135933224 16:26757202-26757224 ATGATGAATGTGTGGGTAGATGG + Intergenic
1136678017 16:31931960-31931982 AGGACCTACTTGAGGGTGGAGGG + Intergenic
1138197281 16:55061024-55061046 ATGGCCCATGGGTGGGTGGAGGG - Intergenic
1138865367 16:60812083-60812105 AATACCAATGTCAGGGTGGTAGG - Intergenic
1139275395 16:65723193-65723215 AGGACCCACTTGAGGGTGGAGGG - Intergenic
1139796112 16:69484332-69484354 ATGATCCATGTGATGGTGGCAGG + Intergenic
1140978087 16:80080092-80080114 ATGACAAACCTGAGGGTAGAAGG + Intergenic
1141045980 16:80716478-80716500 ATGAACAATGGGTGGGTGGATGG + Intronic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141311670 16:82919363-82919385 GGGACCTATTTGAGGGTGGAGGG - Intronic
1146570835 17:33951231-33951253 AGGGCCACTGTGAAGGTGGAAGG - Intronic
1146879398 17:36434469-36434491 AGGACCCATGGGAGGGTGGCAGG - Intronic
1147094818 17:38132986-38133008 AGGACCCATGGGAGGGTGGCAGG + Intergenic
1148144974 17:45358431-45358453 ATGAATAGTGTGAGGGAGGAGGG + Intergenic
1149128568 17:53266671-53266693 ATGAGAAAAGTGTGGGTGGAAGG - Intergenic
1150272893 17:63877969-63877991 ATCACCAAAGTGAGAGTGGAAGG - Intronic
1150278552 17:63915270-63915292 ATCACCAAAGTGAGAGTGGAAGG - Intronic
1150279650 17:63921886-63921908 ATCACCAAAGTGAGAGTGGAAGG - Intergenic
1150364961 17:64573966-64573988 ATGGCCTATCAGAGGGTGGAAGG + Intronic
1151020793 17:70615152-70615174 AGGACCTATCAGAGGGTGGAGGG - Intergenic
1151262296 17:72925784-72925806 ATGTGCAATGTCATGGTGGAGGG - Intronic
1152335858 17:79699991-79700013 ATGCCCCATGTGAATGTGGACGG - Intergenic
1154114730 18:11602868-11602890 AGGACCCACTTGAGGGTGGAGGG + Intergenic
1155239012 18:23847718-23847740 ATGACCAGTGTGTGGGCAGATGG - Intronic
1157534880 18:48450888-48450910 ATGACTCATGTGAGGATGGATGG + Intergenic
1158625761 18:59070348-59070370 ATGACCAATGTGGGTGGGGAGGG + Intergenic
1159377676 18:67614862-67614884 ATGACCACTGTCAGGGTGCAGGG + Intergenic
1159732338 18:72044479-72044501 AAGACCTACTTGAGGGTGGAGGG + Intergenic
1160441714 18:78898416-78898438 ATGACCATCGTGGGGGTGGTGGG + Intergenic
1162733586 19:12733586-12733608 TTGCCAAATGTGGGGGTGGAGGG + Intronic
1163071089 19:14842220-14842242 GGGACCTATTTGAGGGTGGAAGG - Intergenic
1163629955 19:18413205-18413227 ACGACGAACGTGAGGGTGGGAGG + Intergenic
1164932068 19:32183547-32183569 ATGAGCAATTTGAGGATGGGAGG + Intergenic
1165449553 19:35874230-35874252 CTGACCAATGTTAAGGTGAAAGG - Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166201405 19:41239915-41239937 ATGACAGATGAGTGGGTGGATGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1168007370 19:53501751-53501773 AGGACCAATTGGAGGGTGCAGGG + Intergenic
926389014 2:12368387-12368409 AAGACCAAGGTGGAGGTGGAAGG - Intergenic
927482611 2:23466119-23466141 AAGACCAATGTGAGTGCTGATGG + Intronic
927871903 2:26629191-26629213 AGGACCGAGGTGAGGATGGAGGG + Intronic
928106239 2:28472292-28472314 AGGGCCCATGTGTGGGTGGAAGG - Intronic
928200409 2:29244345-29244367 ATGACGCGTGTGAGTGTGGACGG + Intronic
928791935 2:34967617-34967639 ATAATCATTGTGATGGTGGAAGG + Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
934083298 2:88487951-88487973 ATGACCATGGTGATGATGGAGGG - Intergenic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938485276 2:131700589-131700611 AGGGCCTATGTGAGGGTAGAGGG - Intergenic
939138998 2:138331005-138331027 ATGCCCCAAGTCAGGGTGGAGGG + Intergenic
941310393 2:163921823-163921845 ATCACCAATGTGATGGTGTTAGG - Intergenic
941657300 2:168157710-168157732 ATTACCAATGTGATGGTGTTAGG - Intronic
942114104 2:172711337-172711359 ATGTAAACTGTGAGGGTGGAAGG - Intergenic
943164721 2:184306360-184306382 ATGGCCTATTTGAGAGTGGAGGG - Intergenic
943546903 2:189292344-189292366 ATGGCCAATGTCAAGGTGTAAGG - Intergenic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
946220772 2:218224422-218224444 ATGACCAATGGGAGGAAGCATGG - Intronic
946877090 2:224140112-224140134 GTGACCAACTTGAGGCTGGAGGG - Intergenic
947997888 2:234544193-234544215 ATGACCTTGGAGAGGGTGGAAGG + Intergenic
1168819884 20:765632-765654 ATGACCACCGTGAGGTAGGAGGG + Exonic
1169444556 20:5660449-5660471 AGGCCCAAACTGAGGGTGGAGGG + Intergenic
1169570547 20:6900783-6900805 TTCATCAAAGTGAGGGTGGAAGG + Intergenic
1169647639 20:7831730-7831752 GTGACCAAAGGGTGGGTGGAAGG - Intergenic
1170383014 20:15782623-15782645 TTGACCAATTTGAAGGTGAAAGG - Intronic
1170389719 20:15858898-15858920 TTGAACAATGTGAGGGTGAGTGG + Intronic
1171151098 20:22827034-22827056 CTGTCCAATGTGGGAGTGGATGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1174148727 20:48470717-48470739 ATGAACCATGTCAGTGTGGATGG + Intergenic
1175478004 20:59290485-59290507 ATGACAAATGTGACAGTGGCTGG - Intergenic
1175606238 20:60314536-60314558 AAGATCGATGTGAGGATGGATGG - Intergenic
1175655839 20:60769707-60769729 ATGAGAAATGAGAGAGTGGAGGG - Intergenic
1176886078 21:14257386-14257408 TGGGCAAATGTGAGGGTGGAAGG - Intergenic
1178489520 21:33040234-33040256 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1178969774 21:37163005-37163027 ATCACCAATGTGATGGTGTTAGG - Intronic
1179502945 21:41821341-41821363 ATGACTCATGCCAGGGTGGAAGG + Intronic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181877079 22:25948079-25948101 ATGATCGATGGGTGGGTGGATGG - Intronic
1182654089 22:31876024-31876046 ATGTCTAATCTGGGGGTGGAGGG + Intronic
1184664472 22:45980590-45980612 ATCTCGAATGTGAGGGTGGCCGG + Intergenic
1184717239 22:46289157-46289179 ATGAGCAAACTGAGGCTGGAAGG + Intronic
1184744612 22:46449094-46449116 ATGAACAATGGATGGGTGGATGG - Intronic
950358116 3:12428694-12428716 GTGACCAGTTGGAGGGTGGAGGG + Intronic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
951309002 3:21100673-21100695 AGGACCCACTTGAGGGTGGAAGG - Intergenic
951517911 3:23582057-23582079 ATGGCCTACTTGAGGGTGGAGGG - Intronic
951843573 3:27061459-27061481 AAGACCAATGTAAAGGTGGAGGG - Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
954473447 3:50720291-50720313 AGGGCCTATGTGAGGGTGGGTGG - Intronic
954980949 3:54744850-54744872 ATCACCAATGTGAGGTGGGTGGG + Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956377528 3:68631621-68631643 AGGACTTATGTGAGGGTAGATGG - Intergenic
956875366 3:73457688-73457710 ATCACCAATGTGACGGTGTTAGG + Intronic
958897518 3:99845478-99845500 ATGAAATATGTGGGGGTGGAGGG - Intronic
959310802 3:104734401-104734423 AGGACCTACTTGAGGGTGGAGGG - Intergenic
960036244 3:113105502-113105524 ATGTTGAATGTGTGGGTGGATGG - Intergenic
960667024 3:120119401-120119423 ATGACAAGTGTGAGGGGCGAAGG - Intergenic
960695137 3:120388574-120388596 TTGTCCAATGTGAGAGTGAATGG - Intergenic
961797543 3:129420550-129420572 ATGACGATTGTGAGGTTGGGAGG - Intronic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
963774981 3:149429471-149429493 TTGACCAAAAGGAGGGTGGAGGG + Intergenic
964054341 3:152434205-152434227 AGGGCCTATTTGAGGGTGGATGG - Intronic
964764178 3:160162535-160162557 ACGATGAATGTGAGGGTGGAAGG + Intergenic
964968601 3:162530693-162530715 AGGGCCTATTTGAGGGTGGAGGG + Intergenic
964987349 3:162760459-162760481 AGGACCTATTTGAAGGTGGAGGG - Intergenic
965308022 3:167092560-167092582 ATCCCCAATGTGATGGTGGTTGG - Intergenic
965341626 3:167498430-167498452 ATGGCAAATGGCAGGGTGGAGGG + Intronic
967443785 3:189540728-189540750 AGGAGCAAGGTGAGGGGGGAAGG - Intergenic
968594721 4:1476458-1476480 ATGATAAATGGGTGGGTGGATGG + Intergenic
968594767 4:1476635-1476657 ATGACGGATGGGTGGGTGGATGG + Intergenic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
971176282 4:24285398-24285420 ATGAGGAATGAGAGGGTGAAAGG + Intergenic
971711078 4:30113363-30113385 ATGATCAATGTGATGGTGTTTGG - Intergenic
971892026 4:32537145-32537167 ATCACTAATGTGAGGGTGAAGGG - Intergenic
972125912 4:35765422-35765444 AAGACCTACTTGAGGGTGGAGGG - Intergenic
972167633 4:36307059-36307081 CTGACCAATGTGGGGATGTAAGG - Intronic
972661945 4:41124793-41124815 ATGACCAAAATCTGGGTGGAAGG - Intronic
973716669 4:53683662-53683684 AAGGACAATGTGAGTGTGGAAGG + Intronic
973795012 4:54416259-54416281 ATGACCAATGTGATGGTATTAGG - Intergenic
974754298 4:66183616-66183638 ATCACCAATGTGATGGTGCCAGG - Intergenic
975094502 4:70442443-70442465 ATGACCACTGTTGGGGTGGTGGG - Intronic
976356639 4:84126561-84126583 GTGACCAAGGTGGGGGTAGAAGG + Intergenic
976361013 4:84178116-84178138 CTGTCCAATGTGAGGGAAGAAGG - Intergenic
976713383 4:88097935-88097957 ATGAGTAATGTGAGGATGTATGG - Intronic
976940252 4:90691854-90691876 GGAACCTATGTGAGGGTGGAAGG - Intronic
977482845 4:97600076-97600098 AGGACCTACTTGAGGGTGGAAGG + Intronic
977647674 4:99432303-99432325 AGGGCCCATTTGAGGGTGGAAGG + Intronic
978295846 4:107204113-107204135 ATGCCCAATTTGGGGGGGGATGG - Intronic
978694768 4:111564724-111564746 GTGGCCTATTTGAGGGTGGAGGG - Intergenic
980947526 4:139337268-139337290 ATCACCAATGTGATAGTGGTAGG + Intronic
981936146 4:150241900-150241922 ATGCCCAATGTGATGGTAGTAGG - Intronic
982066695 4:151660642-151660664 ATAAACAATGTGAGGCTGAAGGG + Intronic
983155638 4:164344212-164344234 AGGACCTACTTGAGGGTGGAGGG + Intronic
985223417 4:187732342-187732364 TTGAACAACGTGAGGGTGAAGGG - Intergenic
987331418 5:16860745-16860767 ATGAACGATGGGTGGGTGGAGGG + Intronic
987395985 5:17423974-17423996 ATGACCTAAGTGAGGGAGAATGG + Intergenic
989003106 5:36782101-36782123 AAAACCAAAGAGAGGGTGGAGGG + Intergenic
989219469 5:38940201-38940223 ATGACCAAGGTGAGGGTACAGGG + Exonic
990757383 5:59088775-59088797 GTGACCTATCAGAGGGTGGAGGG + Intronic
991409199 5:66330108-66330130 ATGATTGATGTGAGGATGGATGG - Intergenic
992626218 5:78637938-78637960 GTGAACAGTGTGAGGGAGGAAGG - Intronic
994406190 5:99348121-99348143 AGGAAAAATGAGAGGGTGGATGG + Intergenic
996942159 5:129021115-129021137 ATGAACAATGTGAGGTAGGCCGG - Intronic
998498531 5:142612050-142612072 ATGAGAAAAGTGAGGGTGAAAGG + Intronic
999054066 5:148554801-148554823 GGGACCTACGTGAGGGTGGAAGG - Intronic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1002712129 5:181201753-181201775 AAAACGAATGTGGGGGTGGATGG + Intronic
1004446403 6:15703483-15703505 GGGGCCAATTTGAGGGTGGAGGG + Intergenic
1004969753 6:20896751-20896773 ATTACCAAGTTGGGGGTGGAAGG + Intronic
1005909681 6:30297542-30297564 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1006134743 6:31888603-31888625 ATGGCCACTGAGAGTGTGGACGG - Exonic
1006152669 6:31997720-31997742 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006158977 6:32030457-32030479 AAGATCAATGTGAAGGTGGGAGG + Exonic
1007831573 6:44642959-44642981 ACGACCAAGGTGAAGGTAGAGGG + Intergenic
1007908017 6:45483739-45483761 ATGACCAAGTTGAGCTTGGAAGG + Intronic
1008695222 6:54028277-54028299 AAGACCAAGCTGGGGGTGGAGGG - Intronic
1009302056 6:62036379-62036401 AGGGCCTATTTGAGGGTGGAGGG + Intronic
1010589059 6:77691736-77691758 AGGACCCTTGTGAGGGTGAAAGG + Intronic
1010784742 6:79987201-79987223 ATAACCAATGTGATGGTGTTGGG + Intergenic
1011646033 6:89458936-89458958 ATGTCAAATGTGGGGGTGGCAGG - Intronic
1011756402 6:90502509-90502531 ATGACAAATGTGGAGGTGGTTGG - Intergenic
1012937008 6:105378882-105378904 AAGACCATTGTGAGCTTGGATGG - Intronic
1013115306 6:107099084-107099106 ATAACAAGTGTGTGGGTGGAGGG + Intronic
1014559146 6:122869722-122869744 ATTACCTAGGTGAGGGTGGGAGG + Intergenic
1014710024 6:124795854-124795876 ATCACCAATGTAATGGTGTAAGG - Intronic
1015488032 6:133793948-133793970 GGGACCAACTTGAGGGTGGAGGG - Intergenic
1016002998 6:139061707-139061729 GTGGCCTATTTGAGGGTGGAGGG + Intergenic
1016882761 6:148927213-148927235 AGGACCAGTGGGAGGGAGGAAGG + Intronic
1017030860 6:150220317-150220339 ATTCCCTATGTGAGGGTTGACGG + Intronic
1017942883 6:159068539-159068561 ATGACGAATGTGAGAGTACACGG - Intergenic
1019704753 7:2492171-2492193 AGGACTGATGTGTGGGTGGATGG - Intergenic
1019704785 7:2492330-2492352 AGGACTGATGTGTGGGTGGATGG - Intergenic
1022061141 7:26796887-26796909 ATGAACAATGTGAGGGTTTAGGG - Intronic
1022597025 7:31722562-31722584 CTGACCTATCTGAGGGTGGATGG + Intergenic
1026099569 7:67373299-67373321 GGGATCTATGTGAGGGTGGAGGG - Intergenic
1026157780 7:67842263-67842285 GGGGCCTATGTGAGGGTGGAAGG + Intergenic
1026295165 7:69045207-69045229 AGGGCCTATTTGAGGGTGGATGG - Intergenic
1026378731 7:69777818-69777840 CTGAACAATGTGAGGTGGGAGGG + Intronic
1028374201 7:90129043-90129065 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1031070646 7:117157628-117157650 ATTACCCATGTGAATGTGGAAGG + Intronic
1031871166 7:127091435-127091457 ATGACCAGTGGGATGGTGGTGGG - Intronic
1031871187 7:127091501-127091523 ATGACCAGTGGGATGGTGGTGGG - Intronic
1031871198 7:127091528-127091550 ATGACCAGTGGGATGGTGGTGGG - Intronic
1035077038 7:156186753-156186775 ATCACCAATGTGATGGTGTTAGG + Intergenic
1035341918 7:158167670-158167692 ATGAGCAGTGTCAGGGTGGGAGG - Intronic
1037177078 8:15960543-15960565 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1039806735 8:41006401-41006423 ATCACCAATGTGATGGTGTTAGG + Intergenic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1041003694 8:53478936-53478958 ATCACCAATGTGACGGTGTTAGG + Intergenic
1043230882 8:77799739-77799761 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043738613 8:83777762-83777784 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043784076 8:84374696-84374718 ATGGCCTACTTGAGGGTGGAGGG + Intronic
1046493944 8:114988909-114988931 ATTACCCATATGAGGGTTGAAGG + Intergenic
1046865359 8:119143438-119143460 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047221327 8:122921032-122921054 AGGGCCATTGTGAGGATGGAAGG + Intronic
1047264567 8:123293987-123294009 TTTACAAATGTGAGGGTGCATGG - Intergenic
1050184443 9:2958013-2958035 ATGACAGATGAGAGAGTGGAAGG + Intergenic
1051339655 9:16099897-16099919 ATGGCCAGTGAGAGGGTGGGTGG - Intergenic
1052240309 9:26264151-26264173 GGGACCAAGTTGAGGGTGGAGGG + Intergenic
1053034899 9:34816687-34816709 ATAACCAATGTGATGGTGTTAGG - Intergenic
1053548706 9:39052038-39052060 AGGACCTATTTGAGGGCGGAAGG + Intergenic
1053812821 9:41872097-41872119 AGGACCTATTTGAGGGCGGAAGG + Intergenic
1054617774 9:67315342-67315364 AGGACCTATTTGAGGGCGGAAGG - Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055738918 9:79364372-79364394 ATGACTGAAGTGAGGGTGGGTGG - Intergenic
1056232297 9:84559127-84559149 CTGCTCAATGTGGGGGTGGAAGG - Intergenic
1056461577 9:86814183-86814205 ATCACCAATGTGATGGTGTTAGG - Intergenic
1056776544 9:89516990-89517012 GGGACCTATTTGAGGGTGGAGGG - Intergenic
1056985272 9:91358250-91358272 ACTACCAAGGTGAGGGTGGAGGG + Intronic
1057942318 9:99296101-99296123 ATGACCAATGGCAGGGTATAAGG + Intergenic
1061890780 9:133618002-133618024 ATGGCCAATGGGAGGGAGGGAGG + Intergenic
1062623108 9:137431415-137431437 GGGACCAACATGAGGGTGGAGGG + Intronic
1185611505 X:1396073-1396095 ATAATCAATGAGTGGGTGGATGG + Intergenic
1186018488 X:5226623-5226645 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1186314957 X:8359242-8359264 ATGACCAATGTGATAGTGCTAGG + Intergenic
1186373292 X:8968628-8968650 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1188184799 X:27100525-27100547 AGGGCCTATCTGAGGGTGGAGGG - Intergenic
1188424867 X:30035165-30035187 ATGTCCAATGAGAGCGTGCAAGG + Intergenic
1188721709 X:33530110-33530132 AGGGCCTATATGAGGGTGGAGGG - Intergenic
1188947721 X:36327938-36327960 ATAAACACTGTGAGGGTGGGAGG + Intronic
1190044568 X:47101566-47101588 GTGGCCACTGTGAGGGGGGAAGG + Intergenic
1190947907 X:55113850-55113872 AGCACTAATGTGAAGGTGGAAGG + Intronic
1191219286 X:57969683-57969705 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1192699402 X:73451625-73451647 ATGACCAATGGGGGTGGGGAAGG + Intronic
1193047352 X:77067112-77067134 ATGGCCATTATGAGGGAGGAGGG - Intergenic
1193666915 X:84331258-84331280 ATGACCAAAATGAGTATGGATGG + Intronic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1194260963 X:91695152-91695174 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1196121713 X:112058309-112058331 ATGACCAGTGTCAGGTTTGATGG + Intronic
1196410436 X:115412664-115412686 ATCACCAATGTGATGGTGTTAGG - Intergenic
1197367235 X:125579157-125579179 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1197701344 X:129602431-129602453 ATGAGAAATGTGATTGTGGAGGG - Intergenic
1200579614 Y:4933954-4933976 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1201901247 Y:19047335-19047357 GTGACCAATGGGTGGGTGGATGG + Intergenic