ID: 956111402

View in Genome Browser
Species Human (GRCh38)
Location 3:65873292-65873314
Sequence CAGGCCTGAGAGCTTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956111402 Original CRISPR CAGGCCTGAGAGCTTGCCGT GGG (reversed) Intronic
900564390 1:3325179-3325201 CAGGCATGAGAGATTTCCTTGGG - Intronic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
902219006 1:14952921-14952943 CAGGCCTGAGAGACTGGCCTTGG + Intronic
905280616 1:36846719-36846741 CAAGCCTGAGAGCATCCCCTAGG + Intronic
906054011 1:42900171-42900193 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
906195188 1:43925870-43925892 GAGGGCTGAGAGGTGGCCGTCGG + Intronic
906753992 1:48291640-48291662 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
907486336 1:54780850-54780872 CAGGCCTGAGTGCCTGTCTTTGG - Exonic
908981699 1:69967046-69967068 CAGGGCTGAGAACTTGCCCCAGG - Intronic
909860103 1:80594266-80594288 CAGGGCTGAGACCTTGCTTTAGG - Intergenic
910142203 1:84038293-84038315 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
910380675 1:86623334-86623356 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
910919606 1:92329492-92329514 CAGGGCTGAGAACTTGCCCCAGG + Intronic
914346023 1:146799230-146799252 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
914904153 1:151730115-151730137 CAGGCCTAGGAGCTTGCGGGGGG + Intergenic
916331720 1:163625047-163625069 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
917351319 1:174081015-174081037 CAGGACTGAGATCTTGCCCCAGG - Intergenic
918159047 1:181880235-181880257 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
919408053 1:197209118-197209140 CAGGGCTGAGAACTTACCCTAGG + Intergenic
919727825 1:200895322-200895344 CAGGCCTGAGACCTGGCTTTGGG + Intronic
922657869 1:227401747-227401769 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
922803036 1:228372692-228372714 CAGGTCTGAGAGGTTGAGGTAGG - Exonic
924321457 1:242855046-242855068 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
924909669 1:248497058-248497080 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
924914433 1:248551002-248551024 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1063185682 10:3649032-3649054 CAGGCCTGACAAGTTACCGTGGG + Intergenic
1064557247 10:16559632-16559654 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1064908182 10:20370419-20370441 CAGGGGTGAGAACTTGCCGCAGG + Intergenic
1065862319 10:29882391-29882413 CAAGCCTGAGAGCTGGTCTTAGG + Intergenic
1067034514 10:42903172-42903194 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1068173209 10:53422442-53422464 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1068775564 10:60864490-60864512 CATGCCTGAGACCTTGCCACTGG + Intergenic
1068925102 10:62527640-62527662 CAGGGCTGAGAACTTGCCACAGG + Intronic
1069200983 10:65616470-65616492 ATGGCCTGTGAGCTTGCCTTAGG - Intergenic
1071595788 10:86922947-86922969 CAGGCCTGAGACCTTCCCTTAGG - Intronic
1071870592 10:89789897-89789919 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1072010749 10:91301057-91301079 AAGGCCTGAGAACTTGGGGTGGG + Intergenic
1072229186 10:93399075-93399097 CTGGCCAGAGAGCTTGCCTAAGG + Intronic
1072885154 10:99266245-99266267 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1074986313 10:118662831-118662853 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1075247092 10:120832343-120832365 CAGGGCTGAAAACTTGCCGCGGG - Intergenic
1076700373 10:132269815-132269837 CAAGCCTGAGAGGTTGGTGTTGG + Intronic
1077021831 11:420397-420419 CAGGCCTGTGGGCTTCCCGCTGG - Intronic
1077355695 11:2115732-2115754 CAGGCCTGAGGGCTTGCTTGAGG - Intergenic
1077828037 11:5831643-5831665 CAGGGCTGAGAGCTTGCCCCAGG + Intronic
1079806109 11:24932694-24932716 CAGGACTGAGAACTTGCCCCAGG + Intronic
1080923336 11:36730918-36730940 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1082784394 11:57308944-57308966 CAGGCCAGAGAGAGTGGCGTGGG - Exonic
1085373269 11:76032057-76032079 CAAGCCAGAGAGTTTGCAGTAGG + Intronic
1086743103 11:90391944-90391966 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1087630760 11:100647869-100647891 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1087901978 11:103651296-103651318 CAGGGCTGAGAACTTGCCCCGGG - Intergenic
1089075838 11:115737789-115737811 CAGGCCTGAGATCTGGCCAATGG - Intergenic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1090307224 11:125702050-125702072 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
1090752992 11:129763751-129763773 CAGGGCTGAGAGCTTGCCCCAGG - Intergenic
1090895060 11:130964605-130964627 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1092360936 12:7836002-7836024 CAGGCCTGAGAGCTGGGATTAGG - Intronic
1092677883 12:10942603-10942625 CAGGGCTGAGAACTTGCCACAGG + Intronic
1092822106 12:12362563-12362585 CAGGCCTGAGAGTTAGACTTTGG + Intronic
1093010486 12:14101760-14101782 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1093758241 12:22876427-22876449 GAGGGCTGAGAACTTGCCCTAGG + Intergenic
1093991374 12:25592812-25592834 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1094661074 12:32471143-32471165 AAGACCTGAGAGCTTGGTGTGGG - Intronic
1094722315 12:33077083-33077105 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1096347836 12:50866231-50866253 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1097761706 12:63473343-63473365 CAGGCCTGAGTGCTAGCGTTTGG - Intergenic
1098500560 12:71187290-71187312 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1099687480 12:85908284-85908306 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1100203643 12:92325644-92325666 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1100706280 12:97203603-97203625 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1103318686 12:120077487-120077509 CAGGCCTGAGAACTGGCTGAGGG - Intronic
1103359690 12:120346371-120346393 CAGGCTTGAGGGGGTGCCGTGGG - Intronic
1103999802 12:124853252-124853274 AAGGCCTGTGAGGTTGCAGTGGG + Intronic
1105990473 13:25615436-25615458 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1107709996 13:43142191-43142213 CAGGCATGAGACCTTTCCCTGGG + Intergenic
1108131862 13:47310339-47310361 CAGGACTGAGAACTTGCCCCAGG - Intergenic
1108188909 13:47917271-47917293 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1108458015 13:50636142-50636164 CTGGCCTGAGAGCTTTCTCTGGG + Intronic
1108825497 13:54408007-54408029 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1108901183 13:55410568-55410590 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1109534694 13:63700533-63700555 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1109975651 13:69828653-69828675 CAGGGCTGAGATCTTGCCCCAGG - Intronic
1110315646 13:74102739-74102761 CAGGTCTGAGATCCTGCTGTAGG - Intronic
1110504692 13:76272015-76272037 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1110748046 13:79079330-79079352 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1111748557 13:92298217-92298239 CAGGGCTGAGAACTTGTCCTAGG + Intronic
1111889207 13:94060513-94060535 AAGGCCTGAGAAATTGCAGTGGG + Intronic
1112086941 13:96041590-96041612 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1113534999 13:111058958-111058980 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1113847541 13:113401301-113401323 CAGTCCTGGGAGCCTGCAGTTGG - Intergenic
1115765349 14:36617722-36617744 CAGCCTTGAGAGCCTGCAGTGGG + Intergenic
1115958480 14:38808851-38808873 CAGGGCTGAGAACCTGCCCTAGG - Intergenic
1116025441 14:39508664-39508686 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1118165554 14:63332384-63332406 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1118352445 14:64982907-64982929 CAGGACTGAGACCTGGCCCTTGG + Intronic
1120450959 14:84666135-84666157 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1121013756 14:90536116-90536138 GTGGCCTGAGAGCTGACCGTGGG - Exonic
1122339518 14:101019125-101019147 CTGGCCTGGGAGCTGGCCGAGGG - Intergenic
1124380682 15:29162404-29162426 CAGGCTTGAGAACTTGCCTCAGG - Intronic
1124386120 15:29209426-29209448 CAGGAGTGAGAGGTTGCTGTGGG + Intronic
1126604989 15:50467481-50467503 CAGGTCTCAGAGCTTTCTGTAGG + Intronic
1127194420 15:56568636-56568658 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1127574112 15:60273376-60273398 CAGGCCTGAGATCTTGACCCAGG + Intergenic
1128711350 15:69874608-69874630 CAGTCCTGGGAGCTGGCCATTGG - Intergenic
1129097637 15:73225685-73225707 CAGGCTTGAGAACTTGCCCCAGG + Intronic
1132074475 15:98808751-98808773 CAGGACTTTGAGCTTGCAGTGGG - Intronic
1132299046 15:100765265-100765287 CAGGCCTGAGAGCTCCCCCAAGG - Intergenic
1132373902 15:101315971-101315993 CAGGCATGAGTGCTTGGGGTAGG - Intronic
1134816145 16:17207576-17207598 CAGGCCTGAGAGGTTGCCCATGG + Intronic
1136146123 16:28317637-28317659 CAGGGCTGAGAGGTTGGGGTGGG + Intronic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1138798017 16:59993421-59993443 CAGGCTTGAAAGCTTGCCCCAGG + Intergenic
1138880971 16:61014650-61014672 CAGGGCTGAGAGCTTGCCCCAGG - Intergenic
1139430940 16:66910759-66910781 CAGGACAGAGAGCTGGCCCTGGG - Intronic
1139987958 16:70916037-70916059 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1143766433 17:9140796-9140818 CCTGCCTGAGAGCTGGCCGGTGG - Intronic
1144278402 17:13699410-13699432 CAGGGCTGAGAGCTTGCCCCAGG + Intergenic
1145785886 17:27593621-27593643 CAGGCCTGACAGTCTGCCATGGG + Intronic
1146941554 17:36847231-36847253 GAGGCCTGAGAGGTGGCAGTGGG - Intergenic
1148052741 17:44777102-44777124 CAGGCCTGAGGTCTTGGGGTGGG + Intronic
1151031363 17:70744110-70744132 CAGGCCCGAGAGCCTGCAGGTGG - Intergenic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152310986 17:79549636-79549658 CAGGCCTGAGGCCTTCCTGTGGG + Intergenic
1153072027 18:1116719-1116741 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1153169012 18:2293714-2293736 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1153400438 18:4678852-4678874 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1153424948 18:4952793-4952815 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1156011426 18:32501583-32501605 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1156344811 18:36247249-36247271 CAGGGCTGAGATCTTGCCCCAGG + Intronic
1156893402 18:42215728-42215750 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1157640582 18:49209156-49209178 CACACCTGAGAGCTAGCTGTAGG - Intronic
1157668491 18:49508593-49508615 CAGGAGTGAGAGGTTGCGGTGGG + Intergenic
1160620770 18:80169128-80169150 CATGCCTGAGAGCTTGCACCGGG + Exonic
1160941208 19:1621242-1621264 AACGCAGGAGAGCTTGCCGTCGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161984768 19:7647219-7647241 GCGGCCTGGGAGCTGGCCGTGGG - Exonic
1162498203 19:11035199-11035221 CAGGCCTGAGTCCTGGCGGTGGG - Intronic
1164018369 19:21273478-21273500 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1164835099 19:31350851-31350873 CCGGCCTGAGAGCTGGCCCAGGG - Intergenic
1164908228 19:31985010-31985032 AAGGCCTGAGAGCTGGCTGTTGG - Intergenic
1166874808 19:45890856-45890878 CAGGCCTGGGAGGTGGCGGTGGG + Exonic
1166899579 19:46049363-46049385 CAGGACTGAGAACTTGCCCCAGG - Intronic
1167162018 19:47774210-47774232 CAGGGCTGAGAACTTGCCAGGGG - Intergenic
1167879584 19:52444897-52444919 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1168458448 19:56534009-56534031 CAGGCTTGAGAACTTGCCCCAGG + Intergenic
924992878 2:328939-328961 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
925479185 2:4251203-4251225 CAGGGCTGAAAACTTGCCCTGGG + Intergenic
926687108 2:15706601-15706623 AAGGCCTGAGAGCTGGTTGTGGG + Intronic
927872113 2:26630286-26630308 TAGGCCTAAGAGCTTGCTGGTGG - Intronic
928443279 2:31311454-31311476 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
930969894 2:57382487-57382509 CAGGCCTGGGAGCATGCCTCAGG - Intergenic
931547830 2:63408646-63408668 CAGGCTTGAAAACTTGCCCTAGG - Intronic
931834562 2:66085430-66085452 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
932384939 2:71323571-71323593 CAGGCCTGAGAACTTGCCCCAGG + Intronic
932883738 2:75528372-75528394 CAGGGCTGAGATCTTGCCCCAGG - Intronic
935007076 2:99089503-99089525 CAGGGCTGAGAACTTGCCCCAGG - Intronic
935443660 2:103133168-103133190 CAAGCCTGAGAGCTTGGTCTTGG + Intergenic
936015871 2:108958666-108958688 AAGGCCTGAGAGCTGGACTTGGG - Intronic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
936587271 2:113769172-113769194 CAGGCCTAAAAGCCTGCAGTTGG - Intergenic
936633949 2:114234442-114234464 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
937828981 2:126399586-126399608 CAGAGCTGAGAACTTGCCCTAGG + Intergenic
938216687 2:129523498-129523520 CAGGGCTGACAACTTGCCTTGGG + Intergenic
938727213 2:134119820-134119842 CAGGGTTGAGAGTTTGCCGACGG + Intergenic
939149431 2:138455896-138455918 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
940217484 2:151315597-151315619 CAGGGCTGAGAACTTGCTGCAGG - Intergenic
940709429 2:157144213-157144235 CAGGCTTGAGAACTTGCCCCAGG + Intergenic
940785027 2:157971891-157971913 CAGGACTGAGAACTTGCCCCAGG + Intronic
940796847 2:158089373-158089395 CAGGGCTGAGAACTTGCCCCAGG + Intronic
940819414 2:158335572-158335594 CAGGCAAGAGAGCTTGTGGTGGG + Intronic
941357856 2:164514808-164514830 CAGGGCTGAGAACTTGCCTCAGG - Intronic
941402243 2:165045093-165045115 CAGGGCTGAGAACTTGCCCTAGG + Intergenic
941631667 2:167891345-167891367 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
941702068 2:168614467-168614489 CAGGGCTGAGAACTTGCCCCAGG - Intronic
943348693 2:186772048-186772070 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
943621194 2:190150112-190150134 CAGGCTTGAAAACTTGCCCTGGG + Intronic
943909285 2:193542482-193542504 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
944012021 2:194984042-194984064 CAGGCCTGTGATCTGCCCGTAGG + Intergenic
944602076 2:201313307-201313329 CAGGACTGAGAACTTGCCCCAGG - Intronic
945163724 2:206920243-206920265 CAGGCCTGATACCTTGCCACAGG - Intergenic
945362285 2:208906555-208906577 CAGGACTGAGAACTTGCCCCAGG - Intergenic
946170758 2:217893968-217893990 CAGGCCTCAGGGCTGTCCGTAGG - Intronic
946207317 2:218119141-218119163 CAGGGCTGAGGGCTTGCTTTTGG + Intergenic
947270283 2:228326930-228326952 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
948373338 2:237504590-237504612 CAAGGCTGAGGGCTGGCCGTGGG - Intronic
948531153 2:238606499-238606521 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
948713932 2:239846878-239846900 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
949042464 2:241855596-241855618 CAGGCCTGTGAGGTGGCGGTGGG + Intronic
1170157087 20:13278826-13278848 GAGGCCTCAGAGCTAGACGTGGG + Intronic
1170721065 20:18879528-18879550 CAGGCTTGAGAACTTGCCCCAGG + Intergenic
1171038722 20:21739841-21739863 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1171160347 20:22916642-22916664 CAGGCCTGAGAACTTGCCCCAGG + Intergenic
1171382247 20:24742668-24742690 CAGGCCTGAGAGCTGGGGATGGG + Intergenic
1172217027 20:33242993-33243015 CAGGCCTGATGGCTTGCCCAGGG + Intronic
1173568334 20:44058211-44058233 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1173962973 20:47089311-47089333 CCGGCCTCGGAGCTTCCCGTCGG - Exonic
1177176422 21:17704851-17704873 CAGGACTGAGAACTTGCCCCAGG - Intergenic
1177847373 21:26306226-26306248 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1178793758 21:35724050-35724072 CAGGCCTGAGAGATGGATGTGGG + Intronic
1178958992 21:37047115-37047137 CAGGCTTGAGAACTTGCCCCGGG - Intergenic
1179084247 21:38203376-38203398 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1179443291 21:41411098-41411120 CAGGACTGAGATCTTGCCGCAGG - Intergenic
1180840075 22:18955033-18955055 CACGGCTGAGAGCCTGCCGTGGG - Intergenic
1183167288 22:36157213-36157235 CAGGCCTGGGCCATTGCCGTGGG - Intronic
950536798 3:13583567-13583589 GAGGCCTGCCAGCTTGCCCTGGG - Intronic
950599242 3:14017336-14017358 CAGGACTGAGAACTTGCCCCAGG + Intronic
951183750 3:19688550-19688572 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
951268480 3:20597833-20597855 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
951294470 3:20917399-20917421 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
951886047 3:27525609-27525631 TAGGTCTGAGAGCTTTCTGTGGG - Intergenic
952522455 3:34174932-34174954 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
952732437 3:36653109-36653131 CAGGGCTGAGAACTTGCTGCAGG - Intergenic
953185253 3:40631570-40631592 CAGGGCTGAGAACTTGCCTTAGG - Intergenic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
959875129 3:111373427-111373449 CAGGGCTGAGAACTTGCCCCAGG - Intronic
960516502 3:118608080-118608102 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
961077899 3:123998689-123998711 CAGGCTGGAGAGCTTGCTATGGG - Intergenic
961344852 3:126257363-126257385 CAGGGCTGAGTGCTGGGCGTGGG + Intergenic
961809374 3:129513110-129513132 AAGGCCTGAGAGCCTACCTTTGG + Intronic
962715524 3:138122758-138122780 CAGGCCTCAGAGCCTGACGATGG + Intergenic
963014574 3:140809699-140809721 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
966686680 3:182703369-182703391 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
968266242 3:197365701-197365723 CATGCCTGACAACTTGCCATTGG + Intergenic
969517742 4:7656943-7656965 CAGGCCAGTGAGCTGGCCGGGGG - Intronic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
970312026 4:14792904-14792926 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
971896975 4:32609417-32609439 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
972621160 4:40749744-40749766 CGGGCCTGAGTGCGTGCCCTTGG - Intergenic
972826749 4:42767862-42767884 CAGGCCTGAGAACTTGCCCCAGG - Intergenic
973069186 4:45835864-45835886 CAGGTCTGAGAGCTTGTCCCAGG + Intergenic
973070863 4:45856554-45856576 CTGGGCTGAGAGCTTGCCCCAGG + Intergenic
973534257 4:51865482-51865504 CAGACCAGAGAGCTTGCTGGGGG + Intronic
975020006 4:69474612-69474634 CAGGGCTGAGAGCTTGCTCCAGG + Intergenic
975147152 4:70980817-70980839 TAGGCCTGAGAGTTTGCTGATGG + Intronic
975662673 4:76703263-76703285 CAGGCCTGAGGGCATGCAGAGGG + Intronic
975718401 4:77227496-77227518 CAGGGCTGAGATCTTGCCTCAGG + Intronic
976462890 4:85333433-85333455 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
976562836 4:86521690-86521712 CAGGGCTGAGATCTTGCCCCAGG + Intronic
976887808 4:90007634-90007656 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
977929682 4:102737340-102737362 CAGGACTGAGATCTTGCCCCAGG - Intronic
978490134 4:109303042-109303064 CAGGCCAGAGAGGTGGCCCTCGG - Intergenic
978566654 4:110089795-110089817 CAGCCCTGAGGTCTTTCCGTTGG - Intronic
980237783 4:130131418-130131440 CAGGACTGAGAACTTGCCCCAGG - Intergenic
980536169 4:134126871-134126893 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
982049826 4:151489576-151489598 CAGGGCTGAGATCTTGCCCCAGG - Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
982312198 4:153997572-153997594 CAGGCTTGAGAGCTTGCCCCAGG + Intergenic
982630514 4:157824200-157824222 CAGGGCTGAGAATTTGCCTTGGG - Intergenic
983035846 4:162864906-162864928 CAGGACTGAGAACTTGCCCCAGG - Intergenic
985416673 4:189742300-189742322 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
985592600 5:773420-773442 CACGCCTGGGAGCTTGTCCTTGG - Intergenic
986571156 5:9167617-9167639 GAGGCCTGAGAGCTGGCTCTTGG - Intronic
986644582 5:9904070-9904092 CAGGCCTGAGAACCTGCCCCAGG + Intergenic
986870193 5:12036562-12036584 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
987436940 5:17906127-17906149 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
987440650 5:17951922-17951944 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
989694543 5:44184036-44184058 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
991923835 5:71684172-71684194 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
992340128 5:75814756-75814778 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
992898608 5:81270222-81270244 TAGGGCTGAGAACTTGCCGCAGG - Intergenic
994051348 5:95365870-95365892 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
994220855 5:97193226-97193248 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
994222227 5:97208909-97208931 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
994887412 5:105582474-105582496 CAGTGCTGAGATCTTGCCCTAGG - Intergenic
995851447 5:116550448-116550470 CAGCCCTCAGAGCCTGCCATGGG - Intronic
995955279 5:117769705-117769727 CAGGACTGAGAACTTGCCCCAGG - Intergenic
996080766 5:119255794-119255816 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
996615908 5:125441133-125441155 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
996726304 5:126675702-126675724 AACAGCTGAGAGCTTGCCGTGGG + Intergenic
997206478 5:132053299-132053321 CAGGCCTGAGAGCTGGGCTCAGG - Intergenic
997291450 5:132738618-132738640 AAGGGCTGTGAGCTTGCAGTAGG + Intergenic
998746047 5:145260909-145260931 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
999108580 5:149095199-149095221 CAGGGCTGAGATCTTGCCTCAGG - Intergenic
999484900 5:151985556-151985578 CTGGGCTGAGAGCTTGCCCCAGG + Intergenic
999818464 5:155200771-155200793 CAGGCTTGAGAACTTGCCTCAGG - Intergenic
1000264448 5:159621294-159621316 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1000779603 5:165464773-165464795 CAGGCTTGAGAACTTGCCCCAGG - Intergenic
1001287157 5:170431935-170431957 CAGGCCTGAGGGGTTGCTGGTGG + Intronic
1001693815 5:173654301-173654323 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1004600513 6:17145341-17145363 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
1006420985 6:33934007-33934029 CAGGACTGAGCTCTTCCCGTGGG - Intergenic
1007374679 6:41448389-41448411 GAGGCCAGAGTGCTTGCAGTAGG - Intergenic
1007730199 6:43940920-43940942 CAGGCCTGAGAGGGAGCCCTGGG - Intergenic
1008775444 6:55032217-55032239 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1009798479 6:68502690-68502712 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1010009000 6:71028439-71028461 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1010165149 6:72906291-72906313 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1010863081 6:80937654-80937676 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1011366153 6:86584768-86584790 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1011620457 6:89237634-89237656 CAGGGCTGAGAACTTGCCCGAGG + Intergenic
1012203739 6:96436574-96436596 CAGGCCTGAGATCTTGCCCCAGG - Intergenic
1013221366 6:108080547-108080569 CAGGGCTGAGAGCTTGCCCCAGG + Intronic
1013913807 6:115310426-115310448 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1013946624 6:115729281-115729303 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1014116197 6:117670890-117670912 CAGGCAAGAGAGCTTGCGCTGGG - Intergenic
1018168803 6:161127217-161127239 CAGGCCTGAGAACTTGCTCCAGG + Intergenic
1018596693 6:165488689-165488711 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1019640480 7:2100919-2100941 CACGCCTGACAACTTGACGTTGG + Intronic
1020358611 7:7303686-7303708 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1020455720 7:8371957-8371979 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
1023669598 7:42561677-42561699 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1024042744 7:45567864-45567886 CAGGCCTGAGTGCTGGACATTGG - Intergenic
1024044092 7:45575563-45575585 CCGGCCTTGGAGCTTGCCCTGGG - Intronic
1024745405 7:52400181-52400203 CAGGCTTGAGAACTTGCCCCAGG + Intergenic
1025820584 7:64959243-64959265 CAGGGCTGAGAACTTGCCCAAGG - Intergenic
1028401555 7:90430812-90430834 CAGGGCTGAGATCTTGCCCCAGG - Intronic
1028647927 7:93119420-93119442 CAGGGCTGAGAACTTGCCCCTGG - Intergenic
1028961530 7:96754446-96754468 AAGGCCTGAGAGCCTGGGGTGGG - Intergenic
1031074364 7:117198744-117198766 CAGGCCTGAAAGCCTGTCCTAGG + Intronic
1032922702 7:136567267-136567289 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1032931490 7:136677669-136677691 CAGGGCTGAGATCTTGCCCCAGG - Intergenic
1033816761 7:145083020-145083042 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
1034188494 7:149196511-149196533 GAGGCCTGAAAGCTTGCCCAGGG + Intronic
1037390402 8:18386760-18386782 GAGGCCTGAGAGCTTCCCAGAGG - Intergenic
1039001042 8:32980137-32980159 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
1039095587 8:33881118-33881140 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1039571787 8:38592801-38592823 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1040529415 8:48254190-48254212 CAGGGCTGAGATCTTGCCCGAGG + Intergenic
1040820102 8:51546746-51546768 CAGGGCTGAGATCTTGCCCCAGG - Intronic
1040967060 8:53093252-53093274 CAGGACTGAGAACTTGCCCTGGG + Intergenic
1041879825 8:62736580-62736602 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1042466749 8:69136643-69136665 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
1043816923 8:84812809-84812831 CAGGCTTGAGAACTTGCCCCAGG + Intronic
1044907208 8:97017505-97017527 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1045694498 8:104793307-104793329 CAGCCCTGAAAGCTTGCAGGTGG + Intronic
1046074370 8:109299348-109299370 CAGGGCTGAGAACTTGCCCCAGG - Intronic
1046394583 8:113625381-113625403 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1050068378 9:1785367-1785389 CAGGCCTAAGAACTTCCCTTTGG - Intergenic
1050133644 9:2439433-2439455 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1050903420 9:10974528-10974550 CAGCGCTGAGAACTTGCCGGAGG - Intergenic
1051053362 9:12955968-12955990 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1051120206 9:13744448-13744470 CAGGCCAAAGAGTTTGCCCTGGG + Intergenic
1052894548 9:33735004-33735026 CAGGGCTGAGAGCTTGCCCCAGG - Intergenic
1053276662 9:36788354-36788376 CAGGGCTTAGATCTTGCCTTTGG - Intergenic
1054761796 9:69011461-69011483 CAGGCCTGAGAGCTCCTCCTGGG + Intergenic
1056948028 9:91017450-91017472 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1057443226 9:95096696-95096718 GAGGCCTGAGAGCTGGCCGCTGG + Intergenic
1058784612 9:108374825-108374847 CAGGGCTGAGATCTTGCCCCAGG + Intergenic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic
1061592561 9:131607397-131607419 CAGGCCTGGGAGCTCGCTCTGGG + Intronic
1062331526 9:136047005-136047027 CGGGCCTGAGCGATTGCCGAGGG - Intronic
1062426982 9:136510605-136510627 GAGGCCTGAGAGCTTCCTGGAGG + Intronic
1062713528 9:137990050-137990072 CAGGGCTGAGAACTTGCCTGTGG - Intronic
1189539525 X:41971565-41971587 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
1190053885 X:47170956-47170978 CAGGCCTAGGAGCTGGCCGCTGG - Intronic
1190304051 X:49072501-49072523 CTGGCCGCAGTGCTTGCCGTCGG - Exonic
1190897356 X:54633806-54633828 CAGGGCTGAGATCTTGCCTCTGG + Intergenic
1192674046 X:73175887-73175909 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1192899997 X:75486583-75486605 CAGGGCTGAGATCTTGCCCCAGG - Intronic
1192968221 X:76202572-76202594 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
1193077936 X:77375130-77375152 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1193154553 X:78158668-78158690 CAGGCTTGAAAGCTTGCCCGAGG - Intergenic
1193290090 X:79762442-79762464 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1193541304 X:82775649-82775671 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1194165325 X:90507920-90507942 CAGGGCTGAGAACTTGCTCTAGG - Intergenic
1194224945 X:91244897-91244919 CAGGACTGAGATCTTGCCCCAGG + Intergenic
1194299129 X:92163231-92163253 CAGGGCTGAGAGCTTGCCCCAGG + Intronic
1194468160 X:94257750-94257772 CAGGCCTGAGATCTTGTCCCAGG - Intergenic
1194510081 X:94783206-94783228 CAGGTCTGAGAACTTGCCCTAGG - Intergenic
1194532784 X:95071809-95071831 CAGTGCTGAGAACTTGCCTTAGG - Intergenic
1194701538 X:97119938-97119960 CAGGGCTGAGAACTTGCCCCAGG + Intronic
1195075829 X:101326480-101326502 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1195232018 X:102859637-102859659 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1195734197 X:107996304-107996326 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1196948318 X:120850491-120850513 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1197476347 X:126929836-126929858 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1197910638 X:131479544-131479566 CAGGGCTGAGAACTTGCCCCAGG - Intergenic
1198616402 X:138463102-138463124 CAGCACTGAGAGCTTGCCCCAGG - Intergenic
1198727413 X:139692063-139692085 CAGGCCTGGGATCCTGCCGCAGG + Intronic
1198797321 X:140410837-140410859 CAGGGCTGAGAACTTGCCCCAGG + Intergenic
1200249517 X:154545369-154545391 CAGGCCTCAGATCCTGCCTTTGG + Intronic
1200511594 Y:4085730-4085752 CAGGGCTGAGAACTTGCTCTAGG - Intergenic
1200561408 Y:4708207-4708229 CAGGACTGAGATCTTGCCCCAGG + Intergenic
1200616732 Y:5388065-5388087 CAGGGCTGAGAGCTTGCCCCAGG + Intronic
1201930904 Y:19345798-19345820 CAGGGCTGAGATCTTGCCTTAGG + Intergenic