ID: 956114455

View in Genome Browser
Species Human (GRCh38)
Location 3:65904440-65904462
Sequence GGTTTTGGATTTTGTTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 9, 3: 57, 4: 549}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956114455_956114465 9 Left 956114455 3:65904440-65904462 CCCTTAGAACAAAATCCAAAACC 0: 1
1: 0
2: 9
3: 57
4: 549
Right 956114465 3:65904472-65904494 GCCTTCAGGGCCCTGCGGCCCGG 0: 1
1: 0
2: 0
3: 28
4: 266
956114455_956114460 -4 Left 956114455 3:65904440-65904462 CCCTTAGAACAAAATCCAAAACC 0: 1
1: 0
2: 9
3: 57
4: 549
Right 956114460 3:65904459-65904481 AACCCTGACCACGGCCTTCAGGG 0: 1
1: 0
2: 0
3: 22
4: 143
956114455_956114464 4 Left 956114455 3:65904440-65904462 CCCTTAGAACAAAATCCAAAACC 0: 1
1: 0
2: 9
3: 57
4: 549
Right 956114464 3:65904467-65904489 CCACGGCCTTCAGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 23
4: 275
956114455_956114459 -5 Left 956114455 3:65904440-65904462 CCCTTAGAACAAAATCCAAAACC 0: 1
1: 0
2: 9
3: 57
4: 549
Right 956114459 3:65904458-65904480 AAACCCTGACCACGGCCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956114455 Original CRISPR GGTTTTGGATTTTGTTCTAA GGG (reversed) Intronic
901690715 1:10971410-10971432 GTGTTTGGATTTTATTCCAAGGG - Intronic
903049989 1:20593575-20593597 TGTTTTTGTTTTTGTTTTAAAGG + Intronic
903310422 1:22451309-22451331 GGATTAGGATTTTGTTTCAAAGG - Intergenic
904280692 1:29416309-29416331 GATTTTGGACTTTGTTCTGAGGG - Intergenic
904284163 1:29443397-29443419 AAGTTTGGATTTTGTTCCAAGGG + Intergenic
904609554 1:31717796-31717818 GGGTTTGGATTTTATTCTGAGGG - Intergenic
904822004 1:33251585-33251607 GGTTTAGGATTTTATCTTAAGGG - Intergenic
906812133 1:48838349-48838371 GGTTTTCTATTCTGTTCTACTGG - Intronic
907067052 1:51494477-51494499 GGTTTGGGATTTTGCTATATTGG - Intronic
907447655 1:54519268-54519290 GACTATGGATTTTGTTGTAAGGG + Intergenic
907896135 1:58693859-58693881 GGGTTTACATTTTGTTTTAAAGG - Intronic
908286389 1:62608233-62608255 GATTTTGGATTTTGTTCCAAAGG - Intronic
908413008 1:63885493-63885515 GGGTATGGCTTTTGTTCTGAAGG + Intronic
909412267 1:75368307-75368329 GTCTGTGGATTTTGTTATAAGGG - Intronic
909679199 1:78272604-78272626 GGTTTTCTATTTTGTTCCATTGG + Intergenic
910485795 1:87711877-87711899 GAGTTTGGACTTTGTCCTAAAGG + Intergenic
910592053 1:88936551-88936573 ATTTCTGGATTTAGTTCTAATGG + Intronic
911007437 1:93241794-93241816 GAGTTTGGATTTTATTCTGAAGG - Intronic
911410674 1:97502495-97502517 GATTCTGGATTTTATTTTAAGGG + Intronic
911525629 1:98982169-98982191 TTTTTTGGATGTTGTTCTCATGG - Intronic
911645022 1:100328634-100328656 GAATGTGGATTTTGTTCTATAGG + Intergenic
915315676 1:155027519-155027541 GGTTTTGGTTTTTGTTTTTTAGG + Intronic
916225343 1:162484504-162484526 GGTGTTTGATTTTTTTCTAAAGG - Intergenic
916369059 1:164068629-164068651 GGTTCTGAATTCTGTTCTATTGG + Intergenic
917046462 1:170866109-170866131 GATGTTGGAATTTGTTCCAAAGG - Intergenic
917081897 1:171264017-171264039 GGTCTTAGATTTTATCCTAAGGG + Intronic
917319442 1:173764200-173764222 GGTTTTTGATTTTTTTATTATGG - Intronic
917369040 1:174268740-174268762 GTTTTTGGTATTTGTTCTAGAGG + Intronic
917815004 1:178699636-178699658 TGTTTTTGTTTTTGTTTTAAAGG + Intergenic
918415513 1:184302468-184302490 TGTTTAGGATTTTGGTCTTATGG + Intergenic
918470356 1:184866381-184866403 GGCTTAGGATTTAGTTCTAAGGG + Intronic
918721368 1:187856456-187856478 GTTTTTGGATTTTTTTATTATGG + Intergenic
918972525 1:191438093-191438115 GGTTTTCTATTTTGTTCCATTGG - Intergenic
919121572 1:193347531-193347553 GAGTTTGTATTTTATTCTAATGG - Intergenic
919276913 1:195430581-195430603 GGTTTTGGATTTTGCTTACATGG + Intergenic
919352975 1:196483507-196483529 TGTTTTGAACTTTATTCTAACGG - Intronic
919363344 1:196623519-196623541 GGTTTTGGTAATTGTTCTAGTGG - Intergenic
919754308 1:201057125-201057147 GATCTTGGATTTTATTCTGAGGG - Intronic
920150607 1:203903868-203903890 GCTGTTGGATCGTGTTCTAAAGG - Intergenic
920243017 1:204567570-204567592 GGTTTTGGTTTGTTTTTTAATGG + Intergenic
920750538 1:208670553-208670575 GAGTTTGAATTTTATTCTAAGGG + Intergenic
920885401 1:209923039-209923061 GGATTTGGCTTTTTTTTTAAAGG + Intergenic
921063742 1:211608235-211608257 GTGTTTGGACTTTGTTCTACAGG - Intergenic
921346451 1:214190674-214190696 GTTTTTGTATTTTGTTTGAATGG - Intergenic
922095336 1:222438676-222438698 GGCTTTGGTTCTTGTTTTAAAGG - Intergenic
922118671 1:222640432-222640454 GATTTTCTATTTTGTTCCAATGG - Intronic
922883391 1:228999648-228999670 GATTTTGGATTTTAGTCTAGGGG + Intergenic
924044675 1:240015262-240015284 GTTTTAGGATTTTTCTCTAAGGG + Intronic
924421385 1:243913302-243913324 GGCTTTGGAGTTTGTTTTAATGG + Intergenic
924849289 1:247808622-247808644 TGTTTTGAATTTTATTCCAAGGG + Intergenic
1063358974 10:5432885-5432907 GGTTTGTGTTTTTGTTCTAATGG + Intronic
1064169033 10:13013436-13013458 GGTTTTCTATTTTATTCTATGGG - Intronic
1065165304 10:22970445-22970467 GATTTTGGACTTTATTTTAATGG + Intronic
1065288580 10:24208602-24208624 TGTTTGGGATTTTTTTTTAAGGG + Intronic
1065662198 10:28017522-28017544 TGTTTGGGATTCTGTTCTCAGGG - Intergenic
1066181536 10:32966518-32966540 GGTTTGCTATTTTGTTCTATTGG - Intronic
1067335137 10:45355492-45355514 AGTATTGGAAATTGTTCTAAGGG + Intergenic
1068484062 10:57633721-57633743 GGTTCTCTATTTTGTTCTATTGG - Intergenic
1068489374 10:57702970-57702992 GGGCTTGGATTTTATTCTGAAGG - Intergenic
1068696861 10:59977011-59977033 GGTTTGCATTTTTGTTCTAATGG + Intergenic
1068702884 10:60038635-60038657 GGATTTAGATTTCATTCTAAAGG - Intronic
1069258522 10:66364207-66364229 TGTTTTTGCTATTGTTCTAATGG - Intronic
1070000187 10:72370505-72370527 GGTTTTGGGTTTTGTTTTGTTGG - Intronic
1070655484 10:78268290-78268312 GGGTTTGGATTTTGTTCTGTAGG + Intergenic
1070709860 10:78672984-78673006 GCATTTGAATTTTGGTCTAAGGG - Intergenic
1070780194 10:79133089-79133111 GGTCTTGGATGCTATTCTAAGGG - Intronic
1072319667 10:94236360-94236382 GGTTTTTGTTTTTTTTTTAAAGG - Intronic
1072419043 10:95274060-95274082 GATTTTGGATTTCATCCTAAGGG - Intronic
1072807331 10:98432198-98432220 GAGTTTGGATTTTATGCTAATGG + Intronic
1073104566 10:101024961-101024983 GGTTCAGGATTCTGTTCTATGGG + Intronic
1073369771 10:102977242-102977264 CATTTTGGATTTTTTTTTAAAGG + Intronic
1073741010 10:106406932-106406954 GCTGTTGAATTTTGTTTTAAAGG + Intergenic
1076355062 10:129846701-129846723 AATATTTGATTTTGTTCTAATGG - Intronic
1076553196 10:131300914-131300936 GGATTTGGATTTTGTTGTCATGG + Intronic
1078960412 11:16260775-16260797 GATTTTGGGTTTTATTCTAAGGG - Intronic
1079374610 11:19880711-19880733 GGGTCTGGATTTTGTTCCCAGGG + Intronic
1079820232 11:25117655-25117677 GAATTTGGCTTATGTTCTAAGGG + Intergenic
1081437855 11:43047058-43047080 GGTTTGCATTTTTGTTCTAATGG - Intergenic
1082642689 11:55684554-55684576 GATTTTTAATTTTATTCTAAGGG + Intergenic
1083336668 11:61925849-61925871 GAATTTGGACTTTATTCTAAAGG + Intergenic
1083917071 11:65754095-65754117 GGTTTTTGATTCTGTTCCACTGG + Intergenic
1084523801 11:69683585-69683607 TGTTTTGCATTTTGTTCAACTGG - Intergenic
1085368072 11:75971515-75971537 AGTTTTGGATTTTATTCTAATGG + Intronic
1085591972 11:77771523-77771545 GAGTTTAGATTTTATTCTAAGGG + Intronic
1086310587 11:85531963-85531985 GGTTTTGGATTTTGTTATCCTGG - Intronic
1086738548 11:90338304-90338326 GGTTTTCTAATTTGTTCTTAAGG - Intergenic
1086880621 11:92149351-92149373 GGTTTTAGATTTTATTTTCAGGG + Intergenic
1087008849 11:93494862-93494884 GGATTTGGATTTTATTCTAAAGG - Intronic
1088451696 11:109988244-109988266 GTGTTTGGATTTTGTTTTAAGGG + Intergenic
1088456063 11:110034230-110034252 GGAGTTGGATTTTATTCTACTGG - Intergenic
1088832824 11:113552128-113552150 GGTTTTGAATTTTACACTAATGG - Intergenic
1089105669 11:116001650-116001672 GGGTTTGGAATATCTTCTAAAGG + Intergenic
1089961634 11:122622114-122622136 GGTTTTTGTTTTTGTTTTAAGGG + Intergenic
1091109229 11:132950110-132950132 TGTTTTGGAATTGGCTCTAAGGG + Intronic
1091425565 12:385492-385514 GGTTTTGGTTTTGGTTTTAATGG - Intronic
1091819447 12:3464347-3464369 GGTTTTTGTTTTTTTTCTTAAGG - Intronic
1092072593 12:5644325-5644347 GGTTTTCTATTTTGTTCCATTGG + Intronic
1092180951 12:6446467-6446489 GGTTTTTGTTTTTGTTTTTACGG - Intronic
1092891688 12:12974969-12974991 GGATTTGTATTTTGTTATTAAGG - Exonic
1093287809 12:17287011-17287033 GAATTTTGATTTTATTCTAAGGG + Intergenic
1093546485 12:20354924-20354946 TGTTTTGGATCTTGTTGTGATGG + Intergenic
1094372114 12:29750117-29750139 AGGTTTGGATTTTATTCTGAGGG - Intronic
1094440422 12:30469958-30469980 GGTTCTCTATTTTGTTCTATTGG + Intergenic
1095257908 12:40061967-40061989 GGTTTTCTATTCTGTTCTAATGG - Intronic
1095364533 12:41386784-41386806 GGTTTTCTATTTTGTTCCATTGG - Intronic
1095673933 12:44893797-44893819 GATTTTGGATACTGTCCTAAGGG - Intronic
1097049753 12:56215243-56215265 GATTTTGGACTTTATTCTGAAGG + Intronic
1097372472 12:58801239-58801261 GGTTTTCCATTTTGTCCTCAGGG + Exonic
1097536708 12:60880973-60880995 GGTTCTTGATTTTGTTCTGTTGG - Intergenic
1097538187 12:60900327-60900349 GGCTTTCTATTCTGTTCTAATGG - Intergenic
1098702081 12:73641563-73641585 GTTTTTGGATTTTGTACTATTGG - Intergenic
1098718354 12:73861218-73861240 GGTTTTTGTTTTTGGTTTAACGG - Intergenic
1098739550 12:74155013-74155035 TTTTTTGGATTTTTTTCTAGAGG + Intergenic
1099349953 12:81553960-81553982 GATTTTGGTTTTAGTTTTAAGGG + Intronic
1099363120 12:81731149-81731171 TGTTTTGGATGCTGTTCTATGGG + Intronic
1099671973 12:85706016-85706038 GGTTTTGGTTTTGGTTTTAGTGG + Intergenic
1099768793 12:87025510-87025532 GGTTTTCTATTTTGCTCCAATGG - Intergenic
1100126401 12:91431588-91431610 AATTTTGGATTTTTTTCTATAGG + Intergenic
1100648504 12:96558550-96558572 GGTTCTCTATTTTGTTCTATTGG - Intronic
1100946785 12:99793482-99793504 GGTTTTCTATTTTGTTCCATTGG - Intronic
1101674380 12:106903991-106904013 AGATTTGGATTTTATTCTGAAGG - Intergenic
1101978959 12:109388754-109388776 GGTTCAGGATTTTGTGCTATTGG + Exonic
1102032639 12:109751749-109751771 GGGTTTAGATTTTGTACTCAGGG + Intronic
1102844420 12:116163778-116163800 GTTTTTGAATTTTTTTATAAAGG + Intronic
1102965751 12:117124276-117124298 AAGTTTGGACTTTGTTCTAAGGG + Intergenic
1103246283 12:119460647-119460669 CGTTGTGGATTTTGTTCACACGG + Intronic
1103293203 12:119864313-119864335 GGTTTTGGATTTTTTTTGAAGGG + Intronic
1103789957 12:123462820-123462842 GATTTTGGATTTTATTCTGTAGG + Intronic
1104190105 12:126473206-126473228 GGTTCTGTATTTTGTTCTATTGG - Intergenic
1105442988 13:20430645-20430667 GGTTTGGGATTCTGGTGTAAGGG - Intronic
1105664590 13:22538704-22538726 GGTTTTGGAGTTTATCCTCAGGG - Intergenic
1105739676 13:23310563-23310585 GGTTTGAGATTTTCTTTTAATGG + Intronic
1108201770 13:48051132-48051154 GGTTAGGGATTTTATTCTACAGG - Intergenic
1109002046 13:56817597-56817619 GGTTCTTGATTCTGTTCTATTGG - Intergenic
1109130655 13:58580904-58580926 CTTTTTGCATTTTTTTCTAATGG - Intergenic
1109475014 13:62869238-62869260 TGTTATGGATTTTTTTATAATGG - Intergenic
1109783694 13:67146982-67147004 GGTTCTGAATTTTGTTATATAGG + Intronic
1110001478 13:70208965-70208987 GATTTTCCATTTTGTTTTAAAGG - Intergenic
1110157155 13:72331351-72331373 GATTTTAGATTTTATTCTGAGGG + Intergenic
1110405544 13:75146201-75146223 GCTTTAGGATTTCTTTCTAATGG + Intergenic
1110419938 13:75296034-75296056 AGTTTTTGATTTTTTTCCAAAGG - Intronic
1110792155 13:79598494-79598516 GGATTTGGATTTTATCCTAAGGG - Intergenic
1110960351 13:81614585-81614607 GGATTTGGTTTTTCTTTTAAGGG - Intergenic
1111551781 13:89821772-89821794 GGGTTTGAAATTTGTTCTGATGG + Intergenic
1112117203 13:96369172-96369194 GGATTTGGTTCTTGTTCTAGAGG - Intronic
1112849023 13:103681309-103681331 GGTTTTGAATTTTGTTTTTCAGG - Intergenic
1113092998 13:106634507-106634529 GGTTTTGGTTTTTATTATGAAGG - Intergenic
1113116322 13:106878210-106878232 GTGGTTGGATTTTGTTCTTAGGG - Intergenic
1114132528 14:19808929-19808951 GGTTTTCTATTCTGTTCTATGGG - Intronic
1114272547 14:21111182-21111204 GGTTTTTCATTTTGTTCTTAAGG + Intergenic
1115530955 14:34326575-34326597 GGATTTGGTTTTTTTCCTAAAGG + Intronic
1115699288 14:35934190-35934212 GGTTTTGGTTTTAGCTCAAATGG - Intergenic
1115830286 14:37331018-37331040 GGTTTTCAATTTTGTTCCATTGG + Intronic
1116348570 14:43828901-43828923 GGTTTTCTATTTTGTTCCATTGG + Intergenic
1116943447 14:50813105-50813127 GGTTCTGGGTTGTGTCCTAAGGG - Intronic
1117098526 14:52321972-52321994 GGTTTTAGATAAGGTTCTAAAGG + Intronic
1117175004 14:53136829-53136851 ACTTTTGGGTTTTATTCTAATGG - Intronic
1117338599 14:54775378-54775400 GGTCTTGCATTTCTTTCTAAAGG - Intronic
1118095687 14:62534970-62534992 TGTTTTATATTTAGTTCTAAAGG + Intergenic
1118130789 14:62961178-62961200 GAGTTTGGGTTTTATTCTAAAGG - Intronic
1118226510 14:63905140-63905162 AGTTTTCTATTTTGTTCTATTGG + Intronic
1118370305 14:65132002-65132024 GTTTCGTGATTTTGTTCTAAAGG + Intergenic
1118382691 14:65230244-65230266 GTTTTTGTTTTTTGTTTTAAAGG + Intergenic
1118536352 14:66770454-66770476 AGTTTTGGATTTTACTATAATGG + Intronic
1118855362 14:69617447-69617469 GGTTTTGGATTTTTTTTTGGTGG - Intronic
1118859883 14:69654547-69654569 GTTTTTGGGATTTGTTTTAATGG + Intronic
1119165334 14:72487847-72487869 GGTTTTATATTTGTTTCTAAGGG - Intronic
1119582297 14:75796757-75796779 GGTTTTCTATTCTGTTCTATTGG + Intronic
1119811500 14:77524380-77524402 GGTTTGTGATTTTTTTTTAAAGG - Intronic
1120691216 14:87595324-87595346 GGGTTTGGATTTTATTCTAAGGG + Intergenic
1121890539 14:97586287-97586309 GCTTTTGGACCTTGGTCTAATGG - Intergenic
1123575607 15:21664682-21664704 GGTTTTCTATTCTGTTCTATGGG - Intergenic
1123612227 15:22107155-22107177 GGTTTTCTATTCTGTTCTATGGG - Intergenic
1123665016 15:22601461-22601483 TGTTTTGTATTTTTTTTTAAAGG - Intergenic
1124151837 15:27187255-27187277 GGTTCTGTATTCTGTTCTATGGG + Intronic
1124800205 15:32825288-32825310 GAATTTGGATTTTATTCTACAGG - Intronic
1124920588 15:34022504-34022526 GGATTTGCATTTTGTTCTGATGG - Intronic
1125007577 15:34835806-34835828 GGTTTTCTATTCTGTTCTATTGG - Intergenic
1125155144 15:36577551-36577573 GGTTAAGGATTTTTTTTTAAAGG - Intergenic
1125272183 15:37951995-37952017 GGTTTTGTTTTCTGTTATAATGG - Intronic
1125445470 15:39750447-39750469 GGATTTGTATTTTGTTCTGCTGG - Intronic
1126260277 15:46681362-46681384 GCTTTTGGTCTTTATTCTAAAGG + Intergenic
1126412027 15:48382070-48382092 GGTTTTGTTTTTTCCTCTAACGG + Intergenic
1126672379 15:51127956-51127978 GGATTTGGGGTTTGTGCTAAAGG + Intergenic
1127921801 15:63500622-63500644 GGTTTTGGATTTTTTCCAAAAGG + Intergenic
1129278584 15:74464983-74465005 GGTTTTGGCTTTTGGTTTTATGG + Intergenic
1130157716 15:81367091-81367113 GTTTTTGAATTTTTTTCTTAGGG - Intronic
1130415383 15:83689466-83689488 TGTTTTGGATTTTATACAAATGG + Intronic
1202984475 15_KI270727v1_random:398927-398949 GGTTTTCTATTCTGTTCTATGGG - Intergenic
1133917814 16:10125084-10125106 GATGTTGGATTTTATTCCAAAGG + Intronic
1134518083 16:14903143-14903165 GAGTTTAGATTTTATTCTAATGG + Intronic
1134705754 16:16301797-16301819 GAGTTTAGATTTTATTCTAATGG + Intergenic
1134961787 16:18410317-18410339 GAGTTTAGATTTTATTCTAATGG - Intergenic
1134966085 16:18492916-18492938 GAGTTTAGATTTTATTCTAATGG - Intronic
1135682963 16:24474198-24474220 GGTTTTTGTTTTTTTTTTAATGG - Intergenic
1137063105 16:35810094-35810116 AGTTTTTAATTTTTTTCTAAGGG + Intergenic
1137367873 16:47876385-47876407 TGTTTTGGGTTTTTTTCTAGAGG + Intergenic
1137466692 16:48716097-48716119 GAGTTTGCATTTTATTCTAAGGG + Intergenic
1137470575 16:48753018-48753040 GGTTTTGTATTCTGTTCCATTGG - Intergenic
1140383582 16:74513105-74513127 GGTTTTGAATTTTATCTTAAAGG + Intronic
1143709131 17:8721811-8721833 GATTTTGGCTTTTATTCTAAGGG - Intergenic
1144264935 17:13559891-13559913 GGTTTTGGTTTTTTTGCAAAAGG + Intronic
1144285963 17:13775026-13775048 GATTTTGGACCTTATTCTAAAGG - Intergenic
1144521200 17:15953260-15953282 GGTTTTGGATTTTGTCCTGAAGG + Intronic
1145017796 17:19410447-19410469 GAGTTTGGATTTTGATCTGATGG + Intergenic
1145027612 17:19480436-19480458 GGTTTTCTATTCTGTTCTATAGG + Intergenic
1146899080 17:36569840-36569862 TGTTTTGGAGTTTCTTATAATGG + Intronic
1147262309 17:39215640-39215662 CCTTTTGGACTTTCTTCTAAGGG - Intronic
1147533341 17:41300704-41300726 GGTGCTAGATTTTGTTCTTATGG + Intergenic
1148611397 17:48967071-48967093 GGTTCTGGATTTGTTTCTAGGGG - Intronic
1148838765 17:50480776-50480798 GGTTGTGGGCTTTGTTCTGATGG + Intronic
1148877924 17:50703254-50703276 CGTGTTGGACATTGTTCTAAAGG + Intronic
1150089147 17:62305635-62305657 GTTTTTGGATTTTTTTCTTATGG + Intergenic
1150558014 17:66271005-66271027 TGTTTTTGTTTTTGTTTTAAAGG - Intergenic
1150607007 17:66701105-66701127 GGTTTTCTATTCTGTTCTACTGG - Intronic
1152298183 17:79480493-79480515 GACTTTGGATTTTGTCTTAAGGG - Intronic
1153018165 18:602978-603000 GCATTTGGATTTTATTCTGAGGG + Intronic
1153547321 18:6221070-6221092 GGTTTCAGATTTTTTTTTAAAGG + Intronic
1154122490 18:11663217-11663239 GAGTTTGGATTTTTTTCTAAGGG + Intergenic
1155562773 18:27097603-27097625 AGTTTTGGCTTTTGTTGCAATGG + Intronic
1156128918 18:33944236-33944258 CCTTTTGAATTTTTTTCTAAAGG + Intronic
1156143319 18:34143017-34143039 GGTTTTGGATTTTGAGTTCAAGG + Intronic
1156306487 18:35882890-35882912 TATTTTGTATTTTGTTCTATTGG - Intergenic
1156501282 18:37560420-37560442 GAATTTGGAGTTTGTTTTAATGG + Intronic
1156687873 18:39671724-39671746 ATTTTTGGATTTTATTCTACAGG + Intergenic
1156693149 18:39733140-39733162 GGCATTGGATTTTATTCTATGGG + Intergenic
1156912203 18:42424314-42424336 GGTTTTGGATTTTTTTTTCAGGG + Intergenic
1157259211 18:46164260-46164282 GTTGTTCGATTTTATTCTAAAGG - Intergenic
1157516671 18:48316226-48316248 TGTTTTAGTTTTTGTTTTAAAGG + Intronic
1158829466 18:61261912-61261934 GATTTTGGATTTTATTTTTATGG - Intergenic
1159253244 18:65909376-65909398 TGTTTTTGTTTTTGTTTTAAAGG - Intergenic
1159493684 18:69172417-69172439 GGTTTTCTATTATGTTCTATTGG - Intergenic
1161096889 19:2397233-2397255 AGTTTTACATTTTATTCTAAAGG + Intronic
1161290926 19:3492876-3492898 GGCTTGGGATTTTGTCCTAAAGG + Intronic
1163446228 19:17348005-17348027 GGAGTTAGACTTTGTTCTAAGGG + Intergenic
1163534429 19:17869049-17869071 GGGTGTGGATTTTGTTCTGAGGG - Intergenic
1164483275 19:28632744-28632766 AGTTCTGGATTTTGTTCTTGGGG - Intergenic
1164485078 19:28649258-28649280 GGTTTAGTCTTTTGTTCTCAAGG - Intergenic
1165335353 19:35166025-35166047 GATTTTGGGTTTTGTTCTAAGGG + Intronic
1165593016 19:36987392-36987414 GGTTTTAGTTTTAGTTCCAAAGG + Intronic
1165922272 19:39306885-39306907 GGTTTTGGATTTTGTTCGTGTGG + Exonic
1166071478 19:40390484-40390506 GAGTTTGGATTCTGTTCTGAGGG + Intergenic
1166352730 19:42207782-42207804 TGGTTTGGATTTTATTCTAGGGG - Intronic
1166385341 19:42377411-42377433 GGTTTTGGGTTTTATTCTCAGGG + Exonic
925608870 2:5686531-5686553 GGACGTGGATTTTGTCCTAATGG + Intergenic
926638979 2:15215001-15215023 GGTATGGGATTTTTTTCTAAAGG + Intronic
928318012 2:30260667-30260689 GAGTTTGGATTTTATTCTAAGGG + Intronic
928942306 2:36738834-36738856 GATTTTGGAATTTTTCCTAATGG + Intronic
930178549 2:48326382-48326404 GGTTAAGGATTTTGACCTAAGGG + Intronic
930733191 2:54748384-54748406 GGTTTTGGTTTTTCTTCTTCAGG + Intronic
931420137 2:62119474-62119496 AGTTTTGGATTTTGTTTTTTTGG - Intronic
931585173 2:63818343-63818365 GATTGTGGTTTTTATTCTAAAGG - Intronic
931849907 2:66242393-66242415 GATGTTGGATTTTGTTTTTAAGG - Intergenic
932261240 2:70329433-70329455 GGCTTTGGCTTCTGTTCTGATGG + Intergenic
932263530 2:70346574-70346596 GGTTTTCCAGTTTGTTCTGAGGG + Intergenic
932263536 2:70346605-70346627 TGTTTTGATTCTTGTTCTAAAGG - Intergenic
932492369 2:72130577-72130599 TGTTTTCGATTTTCTTGTAAAGG + Exonic
932622921 2:73276487-73276509 TGTTTTGGATTTACTTCTCAAGG - Intronic
932806440 2:74787730-74787752 GGTTCTGTATTTTGTTCCATTGG + Intergenic
933171038 2:79125596-79125618 GTTTTTGGTTTTTGTTTTAATGG - Intergenic
933295484 2:80485856-80485878 GGTTTTGAGTATTGTTTTAATGG + Intronic
933326156 2:80840317-80840339 GGTTCTCTATTTTGTTCCAATGG + Intergenic
933332513 2:80912140-80912162 GGATTTGAATTTTGTTTTATGGG - Intergenic
933510528 2:83235245-83235267 GGTTTTGAATTTTAGTCTATAGG + Intergenic
934987133 2:98895642-98895664 GTGTTTGGATTCTATTCTAAAGG + Intronic
935058093 2:99584925-99584947 GGTTTTGTCATTTGTTCTAGAGG - Intronic
935761727 2:106326752-106326774 GGTTTTGAGTATTGTTCAAAAGG - Intergenic
935996275 2:108777210-108777232 GATTTTGCTTTTGGTTCTAAAGG + Exonic
936002444 2:108847033-108847055 GGTTTTGAATTGTTTTATAATGG + Intronic
936624563 2:114134788-114134810 GATTTGGGATTAAGTTCTAAAGG - Intergenic
936939342 2:117867719-117867741 GGTTCTCTATTTTGTTCTATTGG + Intergenic
937366493 2:121265794-121265816 TGTTTTGTGTTTTGTTTTAAAGG - Intronic
937751771 2:125484046-125484068 GGTTTTGTATTCTGTTCCATTGG + Intergenic
938693839 2:133816663-133816685 GGTTTTCTATTCTGTTCTATCGG - Intergenic
939113316 2:138033027-138033049 GGTTTTGAAATTAGTTATAAAGG + Intergenic
939829234 2:147052944-147052966 AGTTTTGGAATTTGATCAAATGG + Intergenic
939835743 2:147126969-147126991 GGTTATGGATTCTGTTCCATTGG + Intergenic
940053974 2:149493996-149494018 GGGTTTGGGTTTTATTCCAAAGG - Intergenic
940084696 2:149846054-149846076 ATTTTTGGATTTTCTTTTAAAGG + Intergenic
940249476 2:151658833-151658855 GTGATTGGATTTTGTTCTAGGGG - Intronic
941089144 2:161154398-161154420 GATTTTGGATTTTATTCTAAAGG + Intronic
942389063 2:175473117-175473139 GAATTTAGACTTTGTTCTAAAGG + Intergenic
942524637 2:176840297-176840319 GATTCTGGTTTTTATTCTAAGGG - Intergenic
943076932 2:183207186-183207208 GACTTTGGATTTTGCTCTGAGGG - Intergenic
943192487 2:184696483-184696505 GGTCTAGAATGTTGTTCTAAAGG + Intronic
943278148 2:185895646-185895668 TATTTTGGATTTTGTTATGAGGG - Intergenic
943526658 2:189025111-189025133 TGGTTCAGATTTTGTTCTAAGGG + Intergenic
943562237 2:189477731-189477753 GGTTTAGCTTGTTGTTCTAATGG + Intergenic
944507905 2:200432511-200432533 GGTTTTGACTTTTGTTCTAACGG - Intronic
945203964 2:207311994-207312016 GGGTTAGGATTTTATTTTAAGGG - Intergenic
945738537 2:213631815-213631837 GGTTTTCTATTTTGTTCTATGGG + Intronic
945990603 2:216392637-216392659 GGTTTTGCATTTTCTCCTCACGG + Intergenic
947511186 2:230755700-230755722 GAATTTGGGTTTTATTCTAAGGG + Intronic
947548687 2:231030858-231030880 TGTTTTGAATTTTGTTCCACAGG - Intergenic
948163755 2:235845334-235845356 GGTGTTGGATTTTGCTCTGGGGG - Intronic
948682224 2:239643101-239643123 GTTTGTGGACTTTGTTCCAAGGG + Intergenic
1170054643 20:12187671-12187693 GGTTTTCTATTTTGTTTTATTGG + Intergenic
1170375380 20:15694380-15694402 GGTTTTTGATTTTTTTATTATGG + Intronic
1170410591 20:16086578-16086600 GGTTCTGTATTCTGTTCTATTGG - Intergenic
1171087728 20:22253241-22253263 GGTACTGGAATTTATTCTAAAGG - Intergenic
1171170242 20:23009766-23009788 GGGTGTGGACTTTGCTCTAAGGG - Intergenic
1171222469 20:23411793-23411815 GGTTTGTAATTTTGTTCTACTGG - Intronic
1171943875 20:31358106-31358128 GGTTTTCTATTTTGTTCTGCTGG - Intergenic
1172592003 20:36124330-36124352 GAATTTAGATTTTATTCTAAGGG - Intronic
1173680295 20:44874620-44874642 GCTTTTGGTTTTTTTTTTAACGG - Intergenic
1174166369 20:48586431-48586453 GGCTGTGGGTTTTGTTCTGATGG - Intergenic
1174691244 20:52508382-52508404 GGTTTTCTATTCTGTTCTATTGG - Intergenic
1177144089 21:17388742-17388764 GGTGGTGAATTTGGTTCTAAAGG - Intergenic
1178414029 21:32389336-32389358 GACTTTGGATTTTATCCTAAGGG + Intronic
1180389513 22:12213428-12213450 TGTTTTAGATTTTCTTCTTAAGG + Intergenic
1180660556 22:17463295-17463317 AACTTTGGATTTAGTTCTAAAGG + Intronic
1181411435 22:22723721-22723743 GGTTTTCTATTTTGTTATATTGG - Intergenic
1182404725 22:30116293-30116315 ACTTTTGGATTTTATTTTAAGGG + Intronic
1183140970 22:35938585-35938607 GGTTTTGTATTTTCTTCTCCAGG - Intronic
1183223762 22:36534872-36534894 GAGTTTGGATTTTATACTAATGG + Intergenic
1183504041 22:38199160-38199182 TGTTTTGGTTTTGGTTTTAAAGG + Intronic
1183651162 22:39153764-39153786 GGTGTTGGATTTTATTGTGAGGG - Intergenic
949265227 3:2149277-2149299 TGGTTTTTATTTTGTTCTAAGGG + Intronic
949587966 3:5461599-5461621 GGCTTTGTATTCTGTTCTATTGG - Intergenic
949756835 3:7421809-7421831 TGTTTTCGTTTTTGTTTTAAAGG + Intronic
950465857 3:13153298-13153320 GGCTTGGAGTTTTGTTCTAAAGG - Intergenic
950468256 3:13168534-13168556 GAGTTTGAATTTTGTTCCAAGGG - Intergenic
950571977 3:13806856-13806878 GGTTTTGATTTTTCTTATAATGG + Intergenic
952267991 3:31805203-31805225 GGTTGTGAATTTTGTTTTAAAGG - Intronic
952380705 3:32802570-32802592 GGTTTTCTATTCTGTTCCAATGG + Intergenic
952711467 3:36436390-36436412 GGCTTTGGAATTTATCCTAAGGG - Intronic
953529818 3:43730459-43730481 GGTTTTCTTTTTTGTTTTAATGG + Intronic
954898067 3:53994460-53994482 GGTTTTGGAGTTTATTTTGAGGG - Intergenic
955385922 3:58479871-58479893 GGTTCTTGATTTTGTTCCATTGG + Intergenic
955548832 3:60060756-60060778 GGTTTTGGTTTGTTTTCTACTGG + Intronic
955735193 3:62031501-62031523 GAGTTTGGATTTTATTTTAAGGG + Intronic
955988757 3:64602425-64602447 GGATTTGACTTTTGTTGTAAAGG - Intronic
956114455 3:65904440-65904462 GGTTTTGGATTTTGTTCTAAGGG - Intronic
956612673 3:71140427-71140449 GGTTTTGGATTTTCCTGTTAGGG + Intronic
957537404 3:81524739-81524761 GGTTTTATATTCTGTTCTACTGG + Intronic
957723658 3:84036466-84036488 GGTTCTCTATTTTGTTCTATTGG - Intergenic
957870111 3:86081145-86081167 GGTTTTGGTTTTTGTCAAAAAGG - Intergenic
957963702 3:87294635-87294657 GGTTTTTGATTTTTTTATTATGG - Intergenic
958024272 3:88032325-88032347 GATTTTGTGTTTTGTTCTTAGGG + Intergenic
958885615 3:99723447-99723469 TGTTTTTGTTTTTGTTTTAAGGG - Intronic
959439012 3:106353604-106353626 GGTTCTGTATTCTGTTCTATTGG + Intergenic
960081057 3:113540778-113540800 AGTTTTTGTCTTTGTTCTAATGG + Intronic
960305477 3:116055208-116055230 AGTTTTGAATTTTATTCAAAGGG - Intronic
960379623 3:116944062-116944084 GGTTTTGGTTTTTGTTCCATTGG - Intronic
960452653 3:117829478-117829500 AGTTTTTGTTTTTGTTTTAAAGG - Intergenic
960960130 3:123064860-123064882 GAGTTTGGATTTTATTCTAAGGG + Intergenic
962984818 3:140525799-140525821 GGTTTTTGATTCTGTTCACATGG - Intronic
963325578 3:143859042-143859064 GGTTCTGTATTCTGTTCTATTGG + Intergenic
963370897 3:144398582-144398604 GGTTCTGTATTCTGTTCTACTGG + Intergenic
965064010 3:163821301-163821323 GGTTCTGTATTTTGTTCTATTGG - Intergenic
965201038 3:165657662-165657684 TGTTTTGTATTTTGGTCTTAGGG - Intergenic
965462484 3:168984435-168984457 GGTTTTCTATTTTGTTCCATTGG - Intergenic
966170699 3:177076710-177076732 AGTTTTGTTTTTTGTTTTAAGGG - Intronic
966429101 3:179812969-179812991 GGTTTTGGCTTTTCCTCTCATGG + Intronic
967443287 3:189534486-189534508 GGGCTAGAATTTTGTTCTAATGG + Intergenic
967683938 3:192398060-192398082 TGTTTTAGATTTTTTTTTAAAGG - Intronic
968250598 3:197208040-197208062 GGTTTTGTATCTTTTTCTTAGGG - Intronic
969334277 4:6498234-6498256 GATTTTGGATTTTTATATAATGG - Intronic
970165630 4:13234669-13234691 GGTTTTTGATTCTGTTCCATTGG - Intergenic
970251394 4:14119825-14119847 ATTTTTGGTTGTTGTTCTAATGG - Intergenic
970830111 4:20327895-20327917 ACTTTTGAATTTTGCTCTAATGG + Intronic
971558125 4:28039342-28039364 GGTTTTCTATTTTATTCTATTGG - Intergenic
971922929 4:32967444-32967466 GGTTTTGTATTCTGTTCCATTGG - Intergenic
972234555 4:37115824-37115846 GATTTTTGATTTTATTATAAAGG + Intergenic
972415621 4:38837386-38837408 GGTTCTGTATTCTGTTCTATTGG - Intronic
972941555 4:44201465-44201487 AGTTTTCTATTTTGTTCTATTGG - Intronic
974919714 4:68223889-68223911 GGTCTTAGATATTGGTCTAATGG - Intergenic
975191698 4:71471267-71471289 GAATTTGAATTTTATTCTAAGGG + Intronic
975311116 4:72904817-72904839 GGTTTGGGATTTTATTATATGGG - Intergenic
975386369 4:73764454-73764476 GGTCTTGGTTAATGTTCTAATGG - Intergenic
975634798 4:76437300-76437322 GGTTTTGAATTTTTTTCACAGGG - Intronic
975851818 4:78580466-78580488 GGGTTTAGATTTTATTCTAAGGG + Intronic
975947874 4:79729600-79729622 GGTTTTAGAATTTGTTATAGTGG - Intergenic
975969680 4:80018130-80018152 GGTTTAGGATTTTGGTCTTTTGG + Intronic
976108936 4:81649599-81649621 GGTTTTGGTATTTTTTTTAATGG + Intronic
976157721 4:82165605-82165627 GGTTCTGTATTCTGTTCTATTGG - Intergenic
976599188 4:86922619-86922641 TGTTGTAGATTTTGTTCTTATGG + Intronic
976892194 4:90063351-90063373 GGTCGTGGATTTCATTCTAATGG - Intergenic
976958227 4:90932416-90932438 GGTTTAGCATTTTGTTGTATTGG + Intronic
977002000 4:91516538-91516560 GGTTTTTGATTCTGTTCCATTGG + Intronic
977011005 4:91633308-91633330 GGTTCTCGATTCTGTTCTATTGG - Intergenic
977330375 4:95629836-95629858 GATTTGAAATTTTGTTCTAAGGG - Intergenic
977669799 4:99682884-99682906 GAGTTTGGATTTTATTCTGAAGG - Intergenic
977808150 4:101327304-101327326 GGTTTTAGAATTTTTTCTTATGG - Intronic
977906969 4:102488249-102488271 GGTTTTGTATTCTGTTCCATTGG - Intergenic
978027985 4:103901491-103901513 GGTTTTCTATTTTGTTCCATTGG - Intergenic
979202171 4:117991666-117991688 GGTTTTCTATTCTGTTCTATTGG - Intergenic
979706840 4:123730336-123730358 GGTTTTGCATTCTGTTTTATTGG + Intergenic
979987468 4:127332641-127332663 GGTTTTGGAATTTGTAGTAGGGG - Intergenic
980223592 4:129951386-129951408 GGTTTTGTTTTTTTTTCCAAGGG - Intergenic
980725603 4:136756588-136756610 TGTTTTTGATTTTATTCAAAGGG - Intergenic
981119766 4:141036539-141036561 GAATTTGGATTTTGTTCTATGGG + Intronic
981198195 4:141944695-141944717 GGTTCTGTATTTTGTTCCATTGG + Intergenic
981205666 4:142036660-142036682 GGTTTTTGTTTTTGTTGTAGAGG + Intronic
981367588 4:143920959-143920981 GTTTTTGAATTTTGTTACAAGGG + Intergenic
981415651 4:144490200-144490222 GAGTTTGGATCTTATTCTAAGGG - Intergenic
981921995 4:150095992-150096014 GAGTTTGGCCTTTGTTCTAAGGG + Intronic
983130278 4:164010921-164010943 GGTTTTCCATTCTGTTCTATTGG - Intronic
983507480 4:168570495-168570517 CATTTTGGTTTTTGTTTTAAAGG - Intronic
983616792 4:169715324-169715346 GGGGTTGGACTTTCTTCTAAGGG + Intronic
983632721 4:169865809-169865831 GATGTGGGATTTTCTTCTAATGG + Intergenic
984562706 4:181289723-181289745 GGTCTTGGATTCTGTTCTGAAGG + Intergenic
986250179 5:6048490-6048512 AGTTTGGGATATTGTACTAAAGG + Intergenic
986589612 5:9355025-9355047 AGCTTTGGATTTTATTCTATGGG + Intronic
987962717 5:24831235-24831257 GTTTGTGGATTTTCTTATAATGG - Intergenic
989174484 5:38509650-38509672 AGTCTGGGATTTTGGTCTAAAGG - Intronic
989377470 5:40779313-40779335 TTTTTTGGATTTTGTTCTTTTGG - Intronic
989434884 5:41399504-41399526 GGTTCTCTATTTTGTTCTATTGG - Intronic
989501515 5:42173676-42173698 GTTTTTGGTTTTTGTTCTTGTGG + Intergenic
989533175 5:42531715-42531737 TGTTTTGGCTCTTGTTTTAATGG + Intronic
989561737 5:42859801-42859823 ATTTTTGGATTTTTTTGTAATGG + Intronic
989667350 5:43871106-43871128 GCTTTTGGATTTTGTGGAAATGG + Intergenic
989678461 5:44001828-44001850 AATTTTGCATTTTGTTCAAATGG + Intergenic
989717105 5:44477391-44477413 GGTTTTGGATGTTGTGAGAACGG - Intergenic
991308818 5:65211907-65211929 TGTTTCGGATATTGTTCTAGGGG + Intronic
992395591 5:76366581-76366603 GGTGGTGGCTTTTGTTTTAAAGG - Intergenic
992579373 5:78155734-78155756 AGTTATGGATTTTTTTTTAAGGG + Intronic
992842591 5:80711024-80711046 GGTTTTGGTTTTGTTTTTAAAGG - Intronic
993183616 5:84587171-84587193 TGTTTTGGATTCTGTTTAAATGG - Intergenic
993268407 5:85760833-85760855 AATTTTGGATTTTATCCTAAAGG + Intergenic
993441314 5:87960325-87960347 GGTTGTGGACTTTGTTTTTATGG + Intergenic
993579047 5:89636297-89636319 GGTTTTCTATTTTGTTCCATTGG + Intergenic
993693998 5:91038275-91038297 GGTTTTGGACTTGATTCTGATGG + Intronic
993908407 5:93649924-93649946 AGTGTTGGTTTTTGTTCTAGTGG - Intronic
994267236 5:97732454-97732476 GATTTTGGTTTTTACTCTAATGG + Intergenic
994437493 5:99757643-99757665 TCTTTTAGATATTGTTCTAATGG + Intergenic
994680680 5:102883049-102883071 GGTTCTGTATTTTGTTCCATTGG + Intronic
994681328 5:102891242-102891264 GCTATTGGATTGTGTTTTAAGGG - Intronic
994773168 5:104009478-104009500 GATTTTGGTTTTTCTTCTCAAGG + Intergenic
994870758 5:105347392-105347414 GGTTTTTGATTTTGTTTTTGAGG - Intergenic
995567446 5:113445909-113445931 GGTACTGTATTTTGTTCTATTGG - Intronic
995758618 5:115540205-115540227 GGTTCTGGATTTTTTTCTATGGG - Intronic
996074219 5:119170582-119170604 GGTTTTGGATCTTCTTCAGAGGG + Exonic
996618588 5:125471985-125472007 GATGTTGGATTTTATTCTGAGGG - Intergenic
996970805 5:129365671-129365693 TGTTTTTGATTTTGTTCCATTGG - Intergenic
997547953 5:134726399-134726421 GGTTTTTTGTTTTGTTTTAATGG + Exonic
998044760 5:138977714-138977736 AAATTTGGATTTTATTCTAAGGG - Intronic
999009423 5:148019263-148019285 GCATTTGGATTTTATTCTATAGG + Intergenic
999087745 5:148908157-148908179 GGTTCTGGATTGTGTCCTTAAGG + Intergenic
999820405 5:155222372-155222394 AGCTCTGGATTTTTTTCTAAAGG - Intergenic
999958781 5:156731569-156731591 GGTTTTCTATTTTGTTCCATTGG + Intronic
1000128284 5:158268920-158268942 GGTTTTGGATTTTGGTGTCAGGG + Intergenic
1000699033 5:164425014-164425036 GGTTTTGCAGTTTCTTCCAAAGG + Intergenic
1000834762 5:166140835-166140857 GGTTTTCTATTCTGTTCTATTGG - Intergenic
1000942396 5:167377899-167377921 GGTTATTGATTTGGTTCTGAAGG - Intronic
1001147591 5:169198322-169198344 GGTTTTGAGTTTAGTTTTAAAGG + Intronic
1001702275 5:173715614-173715636 GGTTTTGGACTTTGTGCAAATGG + Intergenic
1003148709 6:3530677-3530699 GGGTTTGAATTTCGTCCTAAGGG + Intergenic
1003803267 6:9695710-9695732 GGAGTTTGACTTTGTTCTAATGG - Intronic
1004252637 6:14034629-14034651 GATTCTGAGTTTTGTTCTAAAGG + Intergenic
1004375071 6:15083984-15084006 AATTTTGAATTTTGTACTAAAGG - Intergenic
1004401936 6:15296835-15296857 GGTTTTTGATGCTGTTGTAAAGG + Intronic
1004599802 6:17137697-17137719 GGTTCTGTATTCTGTTCTATTGG - Intergenic
1004829926 6:19465646-19465668 GGTTGTGGGTTTTGTTGAAAGGG + Intergenic
1004944748 6:20598799-20598821 CGTTTTTGCTTTTGTTCTATGGG + Intronic
1004977320 6:20982588-20982610 TTTTTTGGATTTTGTTCTTTTGG - Intronic
1005402387 6:25448255-25448277 GGATTTTGATTTTATTCTCAGGG - Intronic
1005589333 6:27309117-27309139 GGTTTTTGATTTTGCGCCAATGG + Exonic
1006746843 6:36348739-36348761 GGTGTTGTATTTTGTTCCAGTGG + Intergenic
1007558616 6:42786938-42786960 ATTTTTGGATTTAATTCTAATGG + Intronic
1008204211 6:48633247-48633269 GGTTTGGGACCTTGTTCTCAAGG - Intergenic
1008216771 6:48800355-48800377 GATTCTGTATTTTGTTCTACTGG - Intergenic
1008614573 6:53213880-53213902 TGTATTGGATGCTGTTCTAAGGG - Intergenic
1008822052 6:55644729-55644751 GGTTTTCTATTCTGTTCTATTGG + Intergenic
1010091529 6:71988398-71988420 GATTTTGAATTTAGTTCTCATGG - Intronic
1010474269 6:76266534-76266556 GGTTCTGGATTTTGTGTAAAGGG - Intergenic
1010735202 6:79436196-79436218 GGTTTTTAATTTTTTTTTAAGGG - Intergenic
1011460927 6:87602857-87602879 GGGTTTGGATTTTGTCCTATGGG - Intronic
1011699932 6:89946709-89946731 GGGTTTGGGTTTTATTTTAATGG - Intronic
1012453698 6:99381332-99381354 GATTTTGGTCTTTTTTCTAATGG - Intronic
1012770586 6:103428524-103428546 GGTTCTGTATTCTGTTCTACTGG - Intergenic
1013017826 6:106177225-106177247 GATTTTGGATTTCATACTAATGG + Intergenic
1013031393 6:106336683-106336705 AGATTTGGATTTTGTTCTGTAGG - Intergenic
1013210688 6:107984017-107984039 GGTTGTGGACTTTATCCTAAGGG + Intergenic
1013915624 6:115333918-115333940 GGTTTTGGTTTTGGTTTTAGAGG + Intergenic
1014367473 6:120562685-120562707 GGTTTTCTATTTTGTTCCATTGG + Intergenic
1014387253 6:120817625-120817647 TGTTTTGTTTTTTGTTCTATTGG - Intergenic
1015021495 6:128481058-128481080 GGTCTTGCAGTTTGTTCTCAGGG - Intronic
1015029277 6:128574734-128574756 CTTTTTGTATTTTGTTCTAGGGG + Intergenic
1015107496 6:129553916-129553938 GATTTTGGACTTGGTTCTAAGGG + Intergenic
1016345716 6:143112059-143112081 GGTCTTGGCTTTTGTGCTGAAGG - Intronic
1017220495 6:151960639-151960661 GATTTTGGCTTTTATTCTGAAGG + Intronic
1018111097 6:160537572-160537594 GGTGTTTGTTTTTGTTGTAAGGG + Intronic
1018794768 6:167177287-167177309 GGTTTAGGATCTTGTTTGAAAGG - Intronic
1018821551 6:167377780-167377802 GGTTTAGGATCTTGTTTGAAAGG + Intronic
1019344908 7:524834-524856 GGCTCTGGATTTTATTCTAGGGG + Intergenic
1019852273 7:3571618-3571640 TGTTTTACAGTTTGTTCTAAGGG + Intronic
1020352015 7:7230857-7230879 AGTTTTGTAATTTGTTTTAATGG + Intronic
1020635572 7:10692289-10692311 GCTTTTGAATTTTCTTTTAAAGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020978992 7:15044385-15044407 TGTTTTGGATTTTGTTGGCAAGG + Intergenic
1021139116 7:17002241-17002263 TTTTTTGGATTGTGTTTTAATGG + Intergenic
1022015993 7:26348658-26348680 GTGTTTTGACTTTGTTCTAAGGG - Intronic
1022067440 7:26873679-26873701 GGTTTTGCATTTTGTTTAGATGG - Intronic
1022298922 7:29084173-29084195 GAGTTTGGACTTTATTCTAACGG - Intronic
1022662691 7:32381413-32381435 GATATTGGATTTTATTATAAGGG - Intergenic
1023124456 7:36941659-36941681 GGTTTGGCATTCTATTCTAATGG - Intronic
1023270732 7:38459506-38459528 GGCTTTGTATTTTGTTCCATTGG - Intronic
1023466114 7:40456927-40456949 GATTTTGGTTTTTGCTTTAAGGG + Intronic
1024981397 7:55160361-55160383 GTTTATGGAGTTGGTTCTAATGG + Intronic
1026705365 7:72686881-72686903 GGGTCTGGATTTTTTTTTAATGG - Intronic
1027200842 7:76063071-76063093 GGATTTGAATTTTGTTCTGTGGG + Intronic
1027364008 7:77438336-77438358 GGTTTTGGTTTTTCATCAAAGGG - Intergenic
1027366549 7:77464256-77464278 AGATTTGAATTTTGTTCTGAAGG + Intergenic
1027759091 7:82254997-82255019 GAGTTTGGATTTTTTTCTAAAGG - Intronic
1027987707 7:85315585-85315607 GGTTCTGGATTTTGATCCAGTGG - Intergenic
1028070379 7:86443014-86443036 GATTTTGGATTTTGCTTCAAGGG - Intergenic
1028237271 7:88377745-88377767 GGTTTTGTTTTGTATTCTAAGGG + Intergenic
1028237500 7:88380131-88380153 GGTTTTCTATTTTGTTCCATTGG + Intergenic
1028704099 7:93817540-93817562 TGGTTTGAATTTTCTTCTAAAGG + Intronic
1028707515 7:93867355-93867377 GATTTTGTATTTTTTTCTACTGG + Intronic
1028763871 7:94527878-94527900 GATTTTAGATTTTATTCTGAGGG + Intronic
1030160158 7:106499483-106499505 TGTTTTGTTTTTTGTTTTAAGGG + Intergenic
1030294860 7:107913128-107913150 GGTTTTTTATTTTGTTCCATTGG + Intronic
1030370093 7:108689531-108689553 GGTTCTGTATTCTGTTCTATTGG + Intergenic
1030831666 7:114231527-114231549 GGGTTTCTATTTTGTTCTATTGG - Intronic
1030941742 7:115659339-115659361 GATTCTGCATTTTGTTCTATTGG - Intergenic
1031096805 7:117429812-117429834 GGTTTTCTATTCTGTTCTATTGG - Intergenic
1031254739 7:119433285-119433307 GGTTTTCTATTTTGTTCCATCGG - Intergenic
1031358514 7:120818261-120818283 GATTTTGGATTTTATTCTATGGG + Intronic
1031584447 7:123517602-123517624 TGTTTTGAATTTTGTTTTCAAGG - Intronic
1032558265 7:132860556-132860578 GGGTTTGGATTTTATTCTAACGG + Intronic
1033101339 7:138475285-138475307 GGTTTGGGCTTTTGTCCTAATGG - Intronic
1033549178 7:142430525-142430547 GATCTTTGATTTTGTTCTAGAGG + Intergenic
1033659918 7:143396124-143396146 GGTTTTGGAGTTTCTGATAAAGG - Intronic
1034758524 7:153647709-153647731 AGTTTTGGATTCTATTCTGAAGG + Intergenic
1035098073 7:156372767-156372789 TGTCTTTAATTTTGTTCTAAAGG + Intergenic
1036087900 8:5633547-5633569 GCAGTTGGATTTTGTCCTAATGG + Intergenic
1037021678 8:13979335-13979357 GGTTTTGGCTTTTTTTCTTTTGG - Intergenic
1038805919 8:30791006-30791028 GCTTTTGGAAATTGTCCTAAGGG - Intronic
1039345832 8:36704363-36704385 GGTTTTGGAATTACTTTTAATGG + Intergenic
1039674143 8:39641324-39641346 GGTTCTCTATTTTGTTCTATTGG + Intronic
1039782743 8:40802881-40802903 GGCTTTTGATTTTGTTCCATTGG - Intronic
1040406409 8:47108118-47108140 GATTTTGGATTTTGGTATTAGGG + Intergenic
1040493226 8:47943988-47944010 GATTTTTAATTTTGTACTAAAGG - Exonic
1040670731 8:49687038-49687060 GGTTCTGTATTCTGTTCTATTGG + Intergenic
1040716155 8:50255343-50255365 TGTTTTGGATTAAATTCTAAAGG + Intronic
1041910958 8:63087561-63087583 GGCTTTGGCTTCTGTTCTGAGGG + Intergenic
1042173678 8:66017899-66017921 GCTTTTGGTTTTTGTTCTTTAGG - Intergenic
1042392076 8:68247560-68247582 GGTTCTGTATTCTGTTCCAATGG + Intergenic
1042768877 8:72356930-72356952 GGTTTTGGTTTTCTTTTTAATGG - Intergenic
1042895879 8:73667331-73667353 AGGTTTGGATTTTATTCTGAAGG - Intronic
1043360397 8:79465346-79465368 TTTTTTGGATTTTGTTTTTAAGG + Intergenic
1043772758 8:84225410-84225432 GAATCTGGATATTGTTCTAAGGG - Intronic
1044022619 8:87125439-87125461 GGTTTTGGATACTGTTTTATTGG - Intronic
1044160263 8:88904899-88904921 GGTTTTCTATTTTGTTCCATTGG - Intergenic
1044198343 8:89404553-89404575 GCTTTTGAATTTTTTACTAAAGG - Intergenic
1044701042 8:94965417-94965439 GAATTTGGATTTTATTCTGAAGG + Intronic
1045127512 8:99108609-99108631 GGTTTTTGATTTTATTCCATTGG + Intronic
1045231899 8:100313818-100313840 GGTTTTGGTTTTGGTTTTAGAGG + Intronic
1045843863 8:106610451-106610473 GGATTTGGATTTTGATCTGAGGG - Intronic
1046257042 8:111713990-111714012 GGGTCTGTATTTTGTTCTATTGG + Intergenic
1046310065 8:112424069-112424091 TGTTTTGGATTCTATTCAAAGGG + Intronic
1046933419 8:119863736-119863758 GACTTTGGTTTTTATTCTAAAGG - Intergenic
1046990630 8:120448953-120448975 GTGTTTGGATTTTTTCCTAATGG + Intronic
1047394688 8:124485059-124485081 AGTTTTAGATTTTTTTTTAAAGG - Intronic
1047488526 8:125354844-125354866 GGTTTTGGATTTTGGGATTAGGG - Intronic
1049848061 8:144813995-144814017 GGTTCTCTATTTTGTTCTATTGG - Intergenic
1050573838 9:6970972-6970994 GGTTTTGCATTTTGATTTAATGG + Intronic
1051164354 9:14246237-14246259 GGTATTGGATTTTATCCTAGAGG - Intronic
1051696852 9:19777036-19777058 TGTTTTTGTTTTTGTTTTAATGG - Intronic
1052013699 9:23441345-23441367 AGTTTTGGTTTTTGTTCCACTGG + Intergenic
1052262856 9:26538073-26538095 AGATTTCGATTTTGTCCTAAAGG + Intergenic
1052308415 9:27037733-27037755 AATTTTTGATTTTGTTCTTAAGG - Intronic
1052539227 9:29786552-29786574 GGTTTTCTATTTTGTTCCATTGG - Intergenic
1052685212 9:31746504-31746526 GGTTTTGCAATTTGTTAGAATGG - Intergenic
1053275404 9:36779883-36779905 GACTTTGGATTTTATTTTAAGGG + Intergenic
1053549954 9:39067400-39067422 GGTGTTGGATTTTTTTTTGATGG + Intergenic
1053814066 9:41887493-41887515 GGTGTTGGATTTTTTTTTGATGG + Intergenic
1054616530 9:67299947-67299969 GGTGTTGGATTTTTTTTTGATGG - Intergenic
1054721182 9:68605290-68605312 TGTTTTTGTTTTTGTTCTGATGG - Intergenic
1054911678 9:70460782-70460804 TGTTTTGAATTTTATCCTAAAGG + Intergenic
1055931634 9:81565218-81565240 GGTTTTGGTTTTTGGTTTTAAGG + Intergenic
1055942536 9:81664064-81664086 GTTTGTGGATTTTGTTCTACTGG - Intronic
1056415457 9:86371313-86371335 GGTTCTCTATTTTGTTCTATTGG + Intergenic
1057102143 9:92372185-92372207 GCTTTTGGATTTTGTTTGCATGG + Intronic
1058099095 9:100898881-100898903 GGGTTTGGATTTTGTTCTGTGGG - Intergenic
1060196277 9:121625616-121625638 GGTTTTGGAGTTTGGGCTGATGG + Intronic
1061128489 9:128691066-128691088 CGTTTTTGTTTTTGTTTTAATGG + Intronic
1186364676 X:8878895-8878917 GTTTTTGGATTATTTTCTTAAGG - Intergenic
1186373942 X:8978259-8978281 GGTTCTCTATTTTGTTCTATTGG + Intergenic
1186539815 X:10389082-10389104 GGTTTTCCTTTTTTTTCTAATGG - Intergenic
1188206732 X:27368982-27369004 GGTTTTCTATTTTGTTCTATCGG - Intergenic
1188206735 X:27369011-27369033 GGTTTTCTATTTTGTTCTATTGG - Intergenic
1188345085 X:29054108-29054130 GAATTTGAATTTTGATCTAAGGG - Intronic
1189671471 X:43414813-43414835 GGTTATGGTTTTTCTTGTAAGGG - Intergenic
1190631794 X:52394427-52394449 GGTTTTGTATTCTGTTCCATTGG + Intergenic
1191201587 X:57788460-57788482 GGTTGTGTATTTTGTTCCATTGG - Intergenic
1191261121 X:58322873-58322895 GGTTTTGGATTTTTCACTATTGG - Intergenic
1191945295 X:66527613-66527635 GGTTCTCTATTTTGTTCTATTGG - Intergenic
1191954562 X:66630000-66630022 GGTTTTTGATTTCGTTCCATTGG - Intronic
1191980702 X:66921949-66921971 GTTTTTGGTTTTTATTCTATTGG + Intergenic
1192574008 X:72228447-72228469 GGTTTTGGATTTGGTTGTTTGGG - Intronic
1192894976 X:75433055-75433077 GAGTTTGGATTTTATTCTGAAGG - Intronic
1193762138 X:85480116-85480138 GAGTTTAGATTTTGTTCTCAGGG - Intergenic
1194165762 X:90513169-90513191 GGTTTTCTATTTTGTTCCATTGG - Intergenic
1194192996 X:90860047-90860069 GGTGTTGGCGGTTGTTCTAATGG + Intergenic
1194389447 X:93298603-93298625 GGTTTTCTATTCTGTTCTATTGG - Intergenic
1196105230 X:111888275-111888297 GGATTTGGGTTTTATGCTAAAGG + Intronic
1196240176 X:113334665-113334687 GGTTTAGTATTTTATTCTAATGG - Intergenic
1196586655 X:117437108-117437130 GAATTTGGATTTTATTCCAAAGG - Intergenic
1196596539 X:117552351-117552373 AGTTTTGGATTTTTTTCTGTTGG - Intergenic
1197121242 X:122895547-122895569 GTTTCTGGAAATTGTTCTAAGGG - Intergenic
1197294388 X:124700137-124700159 GGTTTTGTATTTTTATCTGAAGG - Intronic
1198141038 X:133803672-133803694 ACTTTTGGATTTTGTTGTAAGGG - Intronic
1198411725 X:136376230-136376252 GGTTTTCTATTCTGTTCTATTGG + Intronic
1198794776 X:140383532-140383554 GGTTATGGATTGTGTTGTAAAGG - Intergenic
1199257889 X:145737888-145737910 GGTTTTGGTTTGTGTCCTTAAGG - Intergenic
1199398752 X:147371896-147371918 AGTTTTCTATTTTGTTCTACTGG + Intergenic
1200414395 Y:2893284-2893306 AGTTTTGGATTTTTTTATTAGGG + Intronic
1200512029 Y:4090966-4090988 GGTTTTCTATTTTGTTCCATTGG - Intergenic
1200539619 Y:4442497-4442519 GGTGTTGGCAGTTGTTCTAATGG + Intergenic
1200678015 Y:6175172-6175194 GGTTTTGGAGTATGTTTTCAGGG - Intergenic
1201573793 Y:15440655-15440677 GTTTTTGGATTTTTTTCTCCTGG - Intergenic
1201856041 Y:18544135-18544157 GGCTTTGGATTTTATTCACAGGG + Intergenic
1201877280 Y:18776250-18776272 GGCTTTGGATTTTATTCACAGGG - Intronic