ID: 956114468

View in Genome Browser
Species Human (GRCh38)
Location 3:65904483-65904505
Sequence GGCAGCAGAGGCCGGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956114468 Original CRISPR GGCAGCAGAGGCCGGGCCGC AGG (reversed) Intronic