ID: 956118279

View in Genome Browser
Species Human (GRCh38)
Location 3:65940572-65940594
Sequence ATGTGATGGTGTAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2047
Summary {0: 1, 1: 4, 2: 66, 3: 437, 4: 1539}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956118279_956118285 9 Left 956118279 3:65940572-65940594 CCCACTTCCTTACACCATCACAT 0: 1
1: 4
2: 66
3: 437
4: 1539
Right 956118285 3:65940604-65940626 TGATTTCAACATATAAATTTTGG 0: 4
1: 90
2: 720
3: 2184
4: 4376
956118279_956118287 11 Left 956118279 3:65940572-65940594 CCCACTTCCTTACACCATCACAT 0: 1
1: 4
2: 66
3: 437
4: 1539
Right 956118287 3:65940606-65940628 ATTTCAACATATAAATTTTGGGG 0: 37
1: 485
2: 1463
3: 3072
4: 4805
956118279_956118286 10 Left 956118279 3:65940572-65940594 CCCACTTCCTTACACCATCACAT 0: 1
1: 4
2: 66
3: 437
4: 1539
Right 956118286 3:65940605-65940627 GATTTCAACATATAAATTTTGGG 0: 39
1: 411
2: 1413
3: 2998
4: 4532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956118279 Original CRISPR ATGTGATGGTGTAAGGAAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr