ID: 956118279 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:65940572-65940594 |
| Sequence | ATGTGATGGTGTAAGGAAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2047 | |||
| Summary | {0: 1, 1: 4, 2: 66, 3: 437, 4: 1539} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956118279_956118285 | 9 | Left | 956118279 | 3:65940572-65940594 | CCCACTTCCTTACACCATCACAT | 0: 1 1: 4 2: 66 3: 437 4: 1539 |
||
| Right | 956118285 | 3:65940604-65940626 | TGATTTCAACATATAAATTTTGG | 0: 4 1: 90 2: 720 3: 2184 4: 4376 |
||||
| 956118279_956118287 | 11 | Left | 956118279 | 3:65940572-65940594 | CCCACTTCCTTACACCATCACAT | 0: 1 1: 4 2: 66 3: 437 4: 1539 |
||
| Right | 956118287 | 3:65940606-65940628 | ATTTCAACATATAAATTTTGGGG | 0: 37 1: 485 2: 1463 3: 3072 4: 4805 |
||||
| 956118279_956118286 | 10 | Left | 956118279 | 3:65940572-65940594 | CCCACTTCCTTACACCATCACAT | 0: 1 1: 4 2: 66 3: 437 4: 1539 |
||
| Right | 956118286 | 3:65940605-65940627 | GATTTCAACATATAAATTTTGGG | 0: 39 1: 411 2: 1413 3: 2998 4: 4532 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956118279 | Original CRISPR | ATGTGATGGTGTAAGGAAGT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||