ID: 956119004

View in Genome Browser
Species Human (GRCh38)
Location 3:65947157-65947179
Sequence CTGTAGTTCTTCAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956118999_956119004 16 Left 956118999 3:65947118-65947140 CCTCATTGTTATGTAAAATAACT 0: 1
1: 0
2: 2
3: 29
4: 399
Right 956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 238
956119000_956119004 -7 Left 956119000 3:65947141-65947163 CCCGAGCTTGTGTTTCCTGTAGT 0: 1
1: 0
2: 1
3: 20
4: 172
Right 956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 238
956119001_956119004 -8 Left 956119001 3:65947142-65947164 CCGAGCTTGTGTTTCCTGTAGTT 0: 1
1: 0
2: 1
3: 21
4: 230
Right 956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956119004 Original CRISPR CTGTAGTTCTTCAAGGAAAG AGG Intronic
902913760 1:19622653-19622675 CACTGGTTCTTCACGGAAAGAGG - Intronic
904910933 1:33933734-33933756 CTGAAGTCCATCATGGAAAGAGG + Intronic
907460163 1:54601042-54601064 CTGCAGTTCTTCCAGCAACGTGG - Intronic
907603123 1:55789766-55789788 ATGGAGTTCTTCAAGGACACTGG + Intergenic
909748231 1:79125856-79125878 CTGTAATTTATAAAGGAAAGAGG - Intergenic
909916578 1:81326951-81326973 ATGTAGTTTTTAAAGCAAAGAGG - Intronic
910363071 1:86434362-86434384 ATGTCATTCTTGAAGGAAAGAGG + Intronic
911713896 1:101108783-101108805 CTCTAGTTCTGCAAAGAATGTGG - Intergenic
912837867 1:113012171-113012193 CTGAAGTGCTTAATGGAAAGGGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914794267 1:150906746-150906768 CTGAAGTCCTTCAAGGGGAGTGG - Intergenic
915607895 1:156965311-156965333 CTTTAGTTCTACAAAGATAGGGG + Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917195638 1:172462421-172462443 CAGTAGTTGTTCAAGCAAAAAGG - Intronic
918071455 1:181136107-181136129 CAGTAATTCTGCAAGGCAAGGGG - Intergenic
918249465 1:182688800-182688822 CTGAAGTTCATCAAGGACACAGG + Intergenic
918773665 1:188599432-188599454 GTGTAATTGTTCAAGGAAACTGG - Intergenic
918937252 1:190938056-190938078 CTGTATTTTTTCTTGGAAAGTGG + Intergenic
921286733 1:213615973-213615995 CTTTAGTTCTTCACCCAAAGTGG + Intergenic
923728308 1:236526411-236526433 TTGTAGTTTTTAAAGGAAAATGG + Intronic
923975837 1:239261420-239261442 GTGGAGTTCGCCAAGGAAAGGGG + Intergenic
924584151 1:245346997-245347019 CTGTAGTTTTGCAAGGAGAGTGG - Intronic
1062779604 10:189980-190002 CTGTAGGGCTTAAGGGAAAGTGG + Intronic
1064956504 10:20916780-20916802 CTGAAGTTCCTCAAGGCAATAGG + Intronic
1064957861 10:20931514-20931536 CAGTAGATCATCAAGGAATGAGG + Intronic
1066105489 10:32152817-32152839 ATGTAGTTATTGAAGGAAATTGG - Intergenic
1068282354 10:54890863-54890885 CTGTAGTTTTTCAGAGAAAGAGG - Intronic
1068719366 10:60225712-60225734 CTGTAGTTTTCCAAGTAGAGAGG - Intronic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1069613291 10:69789713-69789735 CTGTTCTGCTTAAAGGAAAGAGG - Intergenic
1073947775 10:108771103-108771125 TTGTAGTTATTTAAAGAAAGAGG - Intergenic
1074652294 10:115537455-115537477 ATGTAGGTCATTAAGGAAAGAGG - Intronic
1076122838 10:127950038-127950060 CAGTAGGTCTAGAAGGAAAGAGG - Intronic
1078205963 11:9229637-9229659 CTGAGGGTCTTCAAGGAAAAGGG - Intronic
1078664877 11:13316063-13316085 TTGTCCTTCTTCAAGGAAAGGGG + Intronic
1078777863 11:14410304-14410326 CTGGAGGTCTTTGAGGAAAGGGG - Intergenic
1079497652 11:21063967-21063989 GTGTAGATCTTCTAGGAGAGTGG + Intronic
1080201530 11:29677117-29677139 CTATGGTTATTAAAGGAAAGTGG + Intergenic
1080709455 11:34733079-34733101 CTGTAGCTCTTCAAAGAAAATGG + Intergenic
1081833852 11:46137271-46137293 CTTTATTTCTTCATGGAAAGTGG + Intergenic
1083443201 11:62690357-62690379 CTCTAGTTCCTGAAGAAAAGGGG - Exonic
1085531518 11:77194860-77194882 CTGGAGTTCTTTTAGGAAAAAGG - Intronic
1085753058 11:79178694-79178716 CTGGAGTTCCTCAAGGGCAGAGG + Intronic
1085827510 11:79863838-79863860 CGGTAGTTCATAAAGAAAAGAGG - Intergenic
1085827528 11:79864029-79864051 CTGTAGTTTATCAAGGATACTGG - Intergenic
1086669873 11:89533003-89533025 CGGTAATTCATAAAGGAAAGAGG - Intergenic
1087287730 11:96283522-96283544 TTTTAGTTCTTCAAGGCAAAAGG - Intronic
1088765766 11:112975030-112975052 TTGCAGTTCTTAAAGGAAAAGGG + Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1092513514 12:9184009-9184031 CTTGAGTTCAACAAGGAAAGTGG + Intronic
1093078659 12:14784169-14784191 TTGTAGTTTATGAAGGAAAGAGG - Intergenic
1095528583 12:43157801-43157823 GTGTAGTTTATAAAGGAAAGAGG + Intergenic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1095561605 12:43572431-43572453 TTGTATTTATTCAAGGAAATGGG - Intergenic
1095641268 12:44487839-44487861 CTGTAGTTCTTCATGCAACTGGG + Intergenic
1097591601 12:61581994-61582016 CTGTGTTTGTTCCAGGAAAGGGG + Intergenic
1098614554 12:72507157-72507179 GTGTAGTTCATAAAGAAAAGAGG - Intronic
1100117343 12:91323307-91323329 TTGTAGATGTTCAAAGAAAGTGG - Intergenic
1100530191 12:95455335-95455357 CTGTAGTCACTCAAGGAAGGCGG + Intergenic
1101269079 12:103123971-103123993 CTGGACTTCTTCAAGTAAAACGG - Intergenic
1102633425 12:114301677-114301699 CTGTAATCCTTCCAGTAAAGTGG - Intergenic
1104171933 12:126290848-126290870 GTGGAGTTCTTCAAGGGAAGAGG - Intergenic
1104283700 12:127403379-127403401 TTTTAGGTGTTCAAGGAAAGTGG - Intergenic
1104490377 12:129188964-129188986 CTGTAGGTCCTCCAGGAAAGTGG - Intronic
1105318703 13:19294788-19294810 GTGTAATTCTTCAAGGAAAAAGG - Intergenic
1106978648 13:35252097-35252119 GGGTAGTTCATAAAGGAAAGAGG + Intronic
1107143453 13:37030783-37030805 GTGCAGTTCTTCAAGGAACATGG - Intronic
1110264108 13:73518836-73518858 CTCTAGTTGTTACAGGAAAGGGG + Intergenic
1110582135 13:77142997-77143019 CTGATGCTCCTCAAGGAAAGGGG - Intronic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1111086605 13:83382990-83383012 CTGTAATCCCTCCAGGAAAGTGG - Intergenic
1112391918 13:98992741-98992763 CTGTAATTTATAAAGGAAAGAGG - Intronic
1115085301 14:29508140-29508162 CTGTGATTCTACAAGGAATGAGG + Intergenic
1115826302 14:37281837-37281859 CTGTAATTCTTCACAGAAATAGG - Intronic
1115880699 14:37914440-37914462 CTTTTGTTTTTCAAGGAAAAAGG + Intronic
1116219619 14:42066481-42066503 CTGTGGCTTTTCAAGGGAAGGGG - Intergenic
1116989639 14:51261923-51261945 CTATAGCTCTCCAGGGAAAGAGG - Intergenic
1117248904 14:53915835-53915857 GTGTAATTCATAAAGGAAAGAGG + Intergenic
1117395959 14:55311084-55311106 CTGTAATTTATAAAGGAAAGAGG + Intronic
1118248217 14:64132753-64132775 CTGTACTTCTTCAAGAGAACAGG + Intronic
1118255520 14:64201924-64201946 CTTTAGGACTTTAAGGAAAGCGG + Intronic
1118680730 14:68239102-68239124 CTGTATTTCTACAAGGACAAGGG - Intronic
1118682003 14:68251397-68251419 GTGTAGCTATACAAGGAAAGAGG + Intronic
1119368977 14:74121571-74121593 CTTTGGTTTTTCCAGGAAAGTGG + Intronic
1122587031 14:102815687-102815709 GGGTAGTTTTTAAAGGAAAGAGG + Intronic
1125050614 15:35294236-35294258 TTATAGTTCTTCAAGGACTGAGG - Intronic
1125496263 15:40197377-40197399 CTGGAGTACTTGAAGGCAAGAGG + Intronic
1126654879 15:50966353-50966375 CAGTAGTTCCTCAAGGGCAGAGG + Intronic
1130418185 15:83714230-83714252 CTGGAGTTCTTCAATGAAACTGG + Intronic
1130720655 15:86382871-86382893 CTGGAGGTGTTCAAGGAATGGGG - Intronic
1134307923 16:13049940-13049962 TTGTAAGTCTTCAAGGATAGAGG + Intronic
1134398078 16:13883766-13883788 TTGGAGTTCTGCAAGAAAAGAGG + Intergenic
1135847881 16:25935181-25935203 GGGTAATTTTTCAAGGAAAGAGG - Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137930940 16:52587007-52587029 ATGTAGTGCTTCTAGGCAAGAGG + Intergenic
1143179007 17:4972833-4972855 CTGTAGTTCCTCAAGGCAGCGGG + Exonic
1143458373 17:7082883-7082905 CGGTAATTTATCAAGGAAAGGGG + Intergenic
1146358597 17:32156047-32156069 ATGTAGTTATTTAAGGAAAAAGG + Intronic
1146470825 17:33123191-33123213 AAATAGTGCTTCAAGGAAAGTGG - Intronic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1148003679 17:44407513-44407535 CTGTATTTCTTCCAGAAAAATGG + Intronic
1149042276 17:52204102-52204124 TTGGAGTTCTCCAAGGAAACGGG + Intergenic
1149158849 17:53666775-53666797 GTGTAATTCATAAAGGAAAGAGG - Intergenic
1149439003 17:56659487-56659509 GTGTGGTTATTCTAGGAAAGTGG - Intergenic
1155587449 18:27383500-27383522 TGGTAGTTATTCCAGGAAAGAGG - Intergenic
1156563978 18:38163060-38163082 CTGCATTTCTTCGAGGAATGTGG + Intergenic
1156747176 18:40406483-40406505 CTGTAGAGCTGCAAGGAATGTGG - Intergenic
1157782925 18:50456306-50456328 CGGTAGTTTATAAAGGAAAGAGG + Intergenic
1158693532 18:59682929-59682951 CTGTAGTTCCTACAGGGAAGGGG - Intronic
1159841266 18:73401739-73401761 GGGTAGTTTTTAAAGGAAAGAGG - Intergenic
1159899743 18:74034894-74034916 CAGTAATTCTAAAAGGAAAGGGG - Intergenic
1161405838 19:4090701-4090723 GTGTGGTTCTGCAAGGAAAGGGG + Exonic
1164695450 19:30240441-30240463 CTGTATCTCTTCAAGGGAATAGG + Intronic
1165721096 19:38080393-38080415 CTTTACTTGTTGAAGGAAAGGGG - Intronic
1167372741 19:49093433-49093455 CTGTAATCCTTCAAGGCAGGTGG + Intronic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
926716370 2:15927496-15927518 CTGCAGTCCTGCAAGGAGAGAGG + Intergenic
927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG + Intergenic
927480250 2:23448126-23448148 CTGTGGATCTTCCAGGAATGGGG - Intronic
928112648 2:28523063-28523085 TTGAAGTTCTACAAGGAAAAGGG - Intronic
928704770 2:33936654-33936676 GTGTAATTCATAAAGGAAAGAGG - Intergenic
928898081 2:36287924-36287946 CTTAAGTTCCTCAAGCAAAGTGG + Intergenic
929291835 2:40201544-40201566 ATGTAGTCATTCAGGGAAAGTGG - Intronic
930224662 2:48779944-48779966 CTGTACTTTTTCAAGAAAACAGG - Intergenic
930897570 2:56463819-56463841 CTGAACTGCTTCTAGGAAAGGGG + Intergenic
931541344 2:63332968-63332990 CTGTAGACCTTCAGGAAAAGTGG - Intronic
932256593 2:70293319-70293341 CTGGAGATCTTCAAGGAACGAGG + Intronic
933334710 2:80942892-80942914 CTGTAGTTCTTTGAGGCAAGAGG + Intergenic
933998694 2:87688546-87688568 GTGTAATTCTTAAAGAAAAGAGG + Intergenic
936295154 2:111262335-111262357 GTGTAATTCTTAAAGAAAAGAGG - Intergenic
937222919 2:120352496-120352518 CTGCAGTCCTCCAAGGAAACGGG - Intergenic
940205704 2:151199147-151199169 CTGAAGTTTTTCAAGGACATGGG + Intergenic
943136675 2:183922016-183922038 CTGTAATTTATAAAGGAAAGAGG - Intergenic
944013986 2:195009924-195009946 ATGTAGAATTTCAAGGAAAGGGG - Intergenic
944428445 2:199608015-199608037 CTGGTGTTTTTCTAGGAAAGAGG + Intergenic
945437235 2:209833046-209833068 CAGTAGTTCCTCTAGGAATGGGG - Intronic
946979917 2:225199275-225199297 CTGTAGATGGTCAAGGAAGGAGG - Intergenic
948000033 2:234560251-234560273 CTGCAGTTGTCCAGGGAAAGAGG + Intergenic
948633819 2:239320977-239320999 CAGTTGTTATACAAGGAAAGCGG - Intronic
1175485817 20:59345369-59345391 ATGTAGTTTATAAAGGAAAGAGG + Intergenic
1175980671 20:62737054-62737076 GTGTAGTTTATAAAGGAAAGAGG - Intronic
1178681518 21:34676136-34676158 CTTTAGATATTCAAGGAAATGGG - Intronic
1184592542 22:45494688-45494710 CTGTAATTTATAAAGGAAAGAGG + Intergenic
951296945 3:20949055-20949077 ATGGTGTTCTTCAAGGATAGTGG + Intergenic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
957375062 3:79345027-79345049 GTGTAGTTTCTAAAGGAAAGAGG - Intronic
959682870 3:109116175-109116197 CTGTAGTGTTTTAAGAAAAGGGG + Intronic
962376669 3:134864068-134864090 CTGTTGTTCTTAGAGGACAGAGG - Intronic
963828266 3:149979339-149979361 CAGTAGTTCATAAAGAAAAGAGG - Intronic
966649483 3:182283360-182283382 CTGTGGATGTTCAAGAAAAGGGG - Intergenic
967240492 3:187434715-187434737 CTGGAGTTTGGCAAGGAAAGGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969189674 4:5506929-5506951 CTGAAGTTCTGTAAGGAAAGAGG + Intergenic
970543813 4:17106278-17106300 CTGTACTTCTTGATGAAAAGGGG - Intergenic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
972037200 4:34540392-34540414 ATGTAAATGTTCAAGGAAAGAGG + Intergenic
972453210 4:39225413-39225435 CTCAGGATCTTCAAGGAAAGAGG - Intronic
973605361 4:52581684-52581706 CTGCACTTCTTGAAGGACAGAGG - Intergenic
975030890 4:69614828-69614850 CTGTAGTTTATAAAGAAAAGAGG + Intronic
977056226 4:92195240-92195262 ATGGATTTCTTCAAGGAAGGTGG - Intergenic
977287371 4:95125478-95125500 CAGTATTTCTACAAAGAAAGAGG + Intronic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
980295287 4:130906793-130906815 ATATAGTTGTTAAAGGAAAGGGG - Intergenic
981570558 4:146146481-146146503 CTGTAATTCTTCAAGGATTGTGG - Intergenic
982171984 4:152671100-152671122 TGGGAGTTCTTCAAGCAAAGAGG + Intronic
982707580 4:158726750-158726772 GTGTAATTCATAAAGGAAAGAGG + Intergenic
983365697 4:166785643-166785665 ATATAGTTCTACAAAGAAAGGGG - Intronic
983396858 4:167209553-167209575 CAGGAGCTCTTTAAGGAAAGTGG - Intronic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
984717800 4:182942143-182942165 CTGGAGTTGTTCAAAGATAGGGG - Intergenic
987748828 5:22013115-22013137 GTGTAATTCATAAAGGAAAGAGG + Intronic
988186599 5:27872240-27872262 TTGATGTTCTTCAAGGAAATTGG - Intergenic
988351063 5:30107609-30107631 TTGTAGTTATCCAAGGAAAAAGG + Intergenic
990200530 5:53367584-53367606 CTTTTGTGCCTCAAGGAAAGTGG - Intergenic
991632071 5:68666195-68666217 CTTTAGTTCTTCAGTGACAGAGG - Intergenic
992214496 5:74512543-74512565 CTGTAGTCAATCAAGCAAAGGGG - Intergenic
993208957 5:84922437-84922459 CAGTAATTTTTAAAGGAAAGAGG - Intergenic
993683659 5:90911206-90911228 GTGAAGTTCTTCAGGAAAAGGGG + Intronic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
997862952 5:137435614-137435636 ATGTATTTCTTTAAGTAAAGTGG + Intronic
998014054 5:138718245-138718267 CTGTACAGATTCAAGGAAAGAGG + Intronic
998606745 5:143643116-143643138 CTGGAGCTGTTTAAGGAAAGAGG - Intergenic
998648329 5:144089629-144089651 CTCTAATTCTCCAAGGAACGTGG - Intergenic
1004072063 6:12308785-12308807 CTGTAATTTTTCAAGGGCAGGGG - Intergenic
1005301130 6:24471508-24471530 TTGTAGATCAGCAAGGAAAGGGG + Intronic
1007555604 6:42763504-42763526 TTGTAGTATTTCAAGAAAAGCGG - Intronic
1007624822 6:43239363-43239385 TTGGAGTCCTTGAAGGAAAGGGG + Intergenic
1007826372 6:44603883-44603905 TTGATGTTCTTCAAGGGAAGTGG + Intergenic
1009034101 6:58095789-58095811 TTAGAGTTCTTCAAAGAAAGAGG + Intergenic
1010098234 6:72072396-72072418 CTATAGTCATTCAAAGAAAGTGG + Intronic
1010349191 6:74851379-74851401 CTCTAGCTCTTCTAGGAAAGTGG - Intergenic
1010515028 6:76762191-76762213 GTGTAATTCATAAAGGAAAGAGG + Intergenic
1011341637 6:86321799-86321821 GTGGAGTTCTTCAAGGAATAGGG - Intergenic
1011830984 6:91371094-91371116 CTGTAATTTATAAAGGAAAGAGG - Intergenic
1012787497 6:103650272-103650294 GTGTAATTCATTAAGGAAAGAGG - Intergenic
1014240177 6:119008742-119008764 CTGTAGTGTTGCAAGGAGAGTGG - Intronic
1015223535 6:130831086-130831108 CTGTCCTTCTTACAGGAAAGGGG - Intronic
1017089951 6:150750405-150750427 CTGCAGAACTTCAAGGAAAACGG - Intronic
1017845654 6:158255843-158255865 CTGTACTTCTTCATGCAATGAGG - Intronic
1018420670 6:163638158-163638180 CTGAAATTTCTCAAGGAAAGTGG - Intergenic
1018489592 6:164278652-164278674 CTGTAATTTATAAAGGAAAGGGG - Intergenic
1020143014 7:5622704-5622726 CAGTAGCCCTTCTAGGAAAGGGG + Exonic
1020689399 7:11336192-11336214 CTGTAATTGTTTAATGAAAGTGG - Intergenic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1021752393 7:23815849-23815871 TTTTAGTTCTGCAAAGAAAGGGG + Intronic
1022476247 7:30712153-30712175 CTGTACTTCTTGAAGGCTAGTGG - Intronic
1023670303 7:42569634-42569656 GTGCAGTTCTACAGGGAAAGAGG + Intergenic
1023777422 7:43621022-43621044 GTGTAGTTCTTGAAGGACTGAGG + Intronic
1024624739 7:51196425-51196447 CTGATGTTCATCAAGGATAGTGG + Intronic
1025093992 7:56083824-56083846 CTGTGGTTCTCCACGGAGAGTGG - Intronic
1026112373 7:67468846-67468868 TTGTCGTTATTTAAGGAAAGTGG + Intergenic
1027718179 7:81701712-81701734 TTCTAATTCTTAAAGGAAAGAGG - Exonic
1030618288 7:111761519-111761541 CTGGAGATCTTCAAGTTAAGGGG + Intronic
1031809858 7:126352979-126353001 ATGTAGATCTACATGGAAAGAGG - Intergenic
1037385546 8:18336500-18336522 CTGATGTTCCTCAAGGAAGGTGG - Intergenic
1038535087 8:28347918-28347940 CAGGAGTTCCTCGAGGAAAGAGG + Exonic
1039254881 8:35708018-35708040 CTGCAGTTGTTCAGTGAAAGAGG + Intronic
1041405729 8:57497301-57497323 ATGTATTTATTCAAGCAAAGAGG + Intergenic
1041426310 8:57724660-57724682 CTGTGGTTATTTTAGGAAAGTGG + Intergenic
1041976953 8:63810480-63810502 CTGTAATTTATAAAGGAAAGAGG + Intergenic
1042371188 8:67992248-67992270 CTGTGGTTCTGCAAGGATATGGG + Intronic
1043646410 8:82525714-82525736 ATGTAAATCTTCAAGAAAAGAGG - Intergenic
1043704582 8:83332097-83332119 CTGGTCATCTTCAAGGAAAGTGG + Intergenic
1044400227 8:91761815-91761837 CTCTAGGTCTTAAAGGAAACAGG + Intergenic
1045128556 8:99122405-99122427 TTATATTTCTTCAAGTAAAGGGG - Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1049653476 8:143787624-143787646 CTGTAGCTCTTCCAGGAGACTGG - Intergenic
1050101146 9:2120967-2120989 AATTAGTTCTTCAAGGACAGAGG - Intronic
1050112750 9:2233691-2233713 CTGTTGTGATTCAAGGAGAGGGG + Intergenic
1051539181 9:18195204-18195226 CACTAGTTCTTCAATGGAAGTGG + Intergenic
1051707694 9:19898104-19898126 CACTAGTGCTTCAGGGAAAGTGG - Intergenic
1052391982 9:27890044-27890066 CGGTATTTCTTAAAGAAAAGAGG - Intergenic
1055325397 9:75123086-75123108 TTGCTGTTCTTCAAGGAGAGAGG + Intronic
1055406872 9:75984171-75984193 CTATAGTTCATCTAGGAAAATGG + Intronic
1055471599 9:76617413-76617435 CTGTAGGCCATCAAGGACAGAGG - Intronic
1056437007 9:86584406-86584428 CCTTAGTTATTAAAGGAAAGAGG + Intergenic
1057827317 9:98381022-98381044 CTGTAAATCTTAAAGGACAGGGG - Intronic
1059506286 9:114802705-114802727 CTGAAGTTCTTCAATGGGAGAGG + Intronic
1186559231 X:10592861-10592883 TTGTAGTTATGCAAGTAAAGTGG - Intronic
1188527947 X:31106567-31106589 CTGTAATTTATAAAGGAAAGAGG + Intronic
1188755009 X:33952019-33952041 GTGTAATTTTTAAAGGAAAGAGG + Intergenic
1189137788 X:38567240-38567262 CTGTAATTTATAAAGGAAAGGGG + Intronic
1190650562 X:52564549-52564571 AAGTATTTCTTGAAGGAAAGTGG + Intergenic
1192111337 X:68367921-68367943 GGGTAGTTCATAAAGGAAAGAGG - Intronic
1193630511 X:83881106-83881128 CTGTTGCTATTCAAGGAAAGTGG + Intronic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1195427156 X:104747358-104747380 CAGTAATTGTTGAAGGAAAGAGG - Intronic
1195457503 X:105085094-105085116 CTGTAATTTATAAAGGAAAGAGG - Intronic
1197198897 X:123732305-123732327 CGGTGGTTCTTCAGGGAAAGCGG + Intronic
1197752054 X:129971508-129971530 TTTTAGTTCTTTAAGGAAAGAGG + Intergenic
1198094736 X:133367963-133367985 CTATAATTTTTCAAGAAAAGTGG + Intronic
1198194649 X:134347887-134347909 ATGGAGTTCTTCAAGCAAAAGGG + Intergenic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1199909427 X:152270383-152270405 CTGTAATTTATAAAGGAAAGAGG - Intronic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic