ID: 956125603

View in Genome Browser
Species Human (GRCh38)
Location 3:66008355-66008377
Sequence TCGGTTCACCAGATGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956125603 Original CRISPR TCGGTTCACCAGATGGTGTA GGG (reversed) Intronic
900080646 1:854761-854783 TTGGTTCATCAAATGGTTTAAGG - Intergenic
903011740 1:20336120-20336142 TCTGTTCAAGAGATGGTGAATGG - Intronic
905231220 1:36515945-36515967 TCAGGTCACCAGATGGTGCTGGG + Intergenic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
918277929 1:182972109-182972131 TCAGTTCACAAGAAGGTGTGAGG + Intergenic
922703007 1:227772792-227772814 CTGGTTTACCAGATGGTGTTGGG - Intronic
1063310396 10:4946544-4946566 TTGGGTCCCCAGATGATGTAAGG - Intronic
1068678660 10:59794870-59794892 TCTCTTCAACAGATGGTGTTGGG + Intronic
1075784174 10:125037490-125037512 TAGGTTCACCAGATTGTATGGGG - Intronic
1077234514 11:1473410-1473432 TGGGGTTCCCAGATGGTGTAGGG + Intronic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1105730242 13:23207226-23207248 TCTGTTCAACAGATGGTGCTGGG + Intronic
1107889396 13:44901093-44901115 TCTGTTCAACAAATGGTGAATGG - Intergenic
1110569979 13:76992369-76992391 TCGGGTCACGAGATGGTGCGGGG + Intronic
1113210942 13:107980051-107980073 TCTGTTCAACAGATGGTGCAGGG - Intergenic
1141041509 16:80676447-80676469 GTGGTTCACCAGATAGTGTGGGG + Intronic
1144036964 17:11375906-11375928 TCAGTTCAGCAGGTGGTGGAAGG + Intronic
1144158010 17:12526788-12526810 TCTGTTCAACAGATGGTGCTGGG - Intergenic
1150027722 17:61695223-61695245 TCTTTTCAACAGATGGTGTTGGG - Intronic
1150627091 17:66848720-66848742 TTGGGTCACCAGCTGGGGTAGGG - Intronic
1152355477 17:79804811-79804833 CCGGTTTAGCAGAGGGTGTAGGG + Intergenic
1157601980 18:48898884-48898906 TCTTTTCAACAGATGGTGTTGGG + Intergenic
1160105837 18:75975319-75975341 TTGGTTCAGCGGTTGGTGTATGG + Intergenic
1168379168 19:55905809-55905831 TTGGTTGTCCTGATGGTGTAGGG - Intronic
937626627 2:124051252-124051274 TCAGTTCAACAGGTGGTCTAAGG + Intronic
940901966 2:159133999-159134021 TCTGTTCAAAAGATGGTTTATGG - Intronic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
942078494 2:172379190-172379212 TCGGCTCCCCAGCTGGTGAAAGG - Intergenic
943871230 2:193003636-193003658 CAGATTCACTAGATGGTGTAGGG + Intergenic
1168737199 20:151234-151256 TCACTTCAACAGATGGTGTTGGG + Intergenic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1180613388 22:17111908-17111930 TCTGTGTCCCAGATGGTGTATGG + Exonic
956125603 3:66008355-66008377 TCGGTTCACCAGATGGTGTAGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
966009544 3:175057543-175057565 TCTGTTCCCCAGATGGTGCAGGG - Intronic
966579837 3:181548216-181548238 TCTCTTCAACAGATGGTGTTGGG - Intergenic
986780557 5:11061544-11061566 TCCCTTGCCCAGATGGTGTAAGG + Intronic
992459567 5:76947772-76947794 TCTGTTCAACAAATGGTGTTGGG + Intergenic
1002760141 6:195404-195426 TCTGTTCAGCAGATGGTGCTGGG + Intergenic
1010632280 6:78212418-78212440 TCTTTTCACCAAATGGTGTTAGG - Intergenic
1030894542 7:115041053-115041075 TAGGTTCCCCAGATTGTGTGGGG + Intergenic
1030910085 7:115236496-115236518 TGGTTCCACCAGATGATGTAAGG + Intergenic
1035524622 8:302718-302740 TTGGTTCATCAAATGGTTTAAGG + Intergenic
1038863710 8:31415572-31415594 TCTGTTCACCCGATGGTAAAGGG + Intergenic
1041278215 8:56185689-56185711 TCGGTTCACCTGTTGCTTTATGG + Intronic
1043751379 8:83940244-83940266 TCAGTTCAACAGGTGGTGTTGGG - Intergenic
1044198781 8:89410149-89410171 TCTCTTCACTAAATGGTGTAGGG + Intergenic
1044789244 8:95829817-95829839 TTGGTTCACCAGATCGTACACGG - Intergenic
1196716505 X:118816424-118816446 TCTGTTCAACAAATGGTGCAGGG - Intergenic