ID: 956126410

View in Genome Browser
Species Human (GRCh38)
Location 3:66015026-66015048
Sequence CTGGGTGAGGGGATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1122
Summary {0: 1, 1: 1, 2: 5, 3: 99, 4: 1016}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956126410_956126419 0 Left 956126410 3:66015026-66015048 CCCACCACCATCCCCTCACCCAG 0: 1
1: 1
2: 5
3: 99
4: 1016
Right 956126419 3:66015049-66015071 CACCCTCTCCCAGACCAGACAGG 0: 1
1: 0
2: 3
3: 21
4: 243
956126410_956126423 4 Left 956126410 3:66015026-66015048 CCCACCACCATCCCCTCACCCAG 0: 1
1: 1
2: 5
3: 99
4: 1016
Right 956126423 3:66015053-66015075 CTCTCCCAGACCAGACAGGGTGG 0: 1
1: 0
2: 0
3: 27
4: 215
956126410_956126420 1 Left 956126410 3:66015026-66015048 CCCACCACCATCCCCTCACCCAG 0: 1
1: 1
2: 5
3: 99
4: 1016
Right 956126420 3:66015050-66015072 ACCCTCTCCCAGACCAGACAGGG 0: 1
1: 1
2: 3
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956126410 Original CRISPR CTGGGTGAGGGGATGGTGGT GGG (reversed) Intronic
900141521 1:1141133-1141155 CTGGGGGCGGGGACGGGGGTGGG - Intergenic
900194910 1:1371258-1371280 CTGGGTGAGGGGCCAGAGGTGGG - Intergenic
900338258 1:2175472-2175494 CTGGGGGTTGGGTTGGTGGTGGG - Intronic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900536565 1:3180682-3180704 CTGGGTGAGGGGCTGAAGTTCGG - Intronic
900654798 1:3751167-3751189 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006702 1:6175199-6175221 ATGGATGAGTGGATGGTGGTTGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901190095 1:7404629-7404651 CAGGGTGAGGGGACGGACGTGGG - Intronic
901225899 1:7612849-7612871 TTGGGTGAGAGGAAGGCGGTGGG + Intronic
901449063 1:9325216-9325238 CGGGGGGGGGGGGTGGTGGTGGG - Intronic
901480283 1:9520445-9520467 CTGGCTGAGGGGATAGAGGTGGG - Intergenic
901502041 1:9658431-9658453 CTGGGTGAGGTGGTGGTTTTAGG + Intronic
901624801 1:10617831-10617853 CTGGGTGGGGGCACGGGGGTGGG - Intronic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
901960857 1:12825543-12825565 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901967452 1:12880145-12880167 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901975251 1:12939276-12939298 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901982853 1:13050409-13050431 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901986168 1:13076929-13076951 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
901995642 1:13149838-13149860 AGGGGTGAGTGGAGGGTGGTGGG + Intergenic
901999236 1:13178509-13178531 AGGGGTGAGTGGAGGGTGGTGGG - Intergenic
902009924 1:13262488-13262510 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902017721 1:13321641-13321663 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902030782 1:13420635-13420657 AGGGGTGAGTGGAGGGTGGTAGG - Intronic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902542743 1:17166227-17166249 CTGATGGTGGGGATGGTGGTGGG - Intergenic
902553271 1:17231883-17231905 TGGGGTGAGGGGATGGGGGAGGG - Intronic
902676388 1:18011405-18011427 CAGGGTGGGGGGATGGGGGAGGG + Intergenic
902741919 1:18444874-18444896 CTGGGGCAGGTGGTGGTGGTAGG - Intergenic
903322792 1:22552796-22552818 CGGGGTGAGGGGAGGGTGCCAGG + Intergenic
903572860 1:24319238-24319260 CTTGGTGAGGGGGTGGGGGGTGG - Intergenic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904842147 1:33379455-33379477 GTGGGTGGGGGGATGGTGGGGGG - Intronic
904851759 1:33464826-33464848 TTGAGTGGGGGGTTGGTGGTGGG + Intergenic
904933141 1:34106525-34106547 CTGGCAGAGGGAAGGGTGGTAGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905323973 1:37137362-37137384 CTGGCTCAGGGGGTGGAGGTGGG + Intergenic
905777607 1:40679284-40679306 CCTGGGGAGGGGATGGTGGGAGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906241959 1:44247796-44247818 ATAGGTGGGGGGATGGTGGAAGG - Intronic
906251990 1:44317831-44317853 CTGGGTGAGGGGAGCTAGGTGGG + Intronic
906510133 1:46405974-46405996 GTGGGTGTGGGGATGGCGGCGGG + Intronic
906545296 1:46616006-46616028 CTCAGTGAGGGCATGGGGGTGGG - Intronic
906582326 1:46946551-46946573 TGGGGTGGGGGGAGGGTGGTGGG - Intergenic
906601272 1:47131326-47131348 TGGGGTGGGGGGAGGGTGGTGGG + Intergenic
907654051 1:56324246-56324268 CTGGGTCAAGGAATGCTGGTGGG + Intergenic
907840317 1:58150833-58150855 TGGGGTGAGGGGACGGTGGGGGG - Intronic
908104764 1:60830029-60830051 CCTGGTGAGGGGATGGTTCTAGG + Intergenic
909398538 1:75198241-75198263 CTGGGTGCAGGGATGGTAGTGGG + Intergenic
909853778 1:80502664-80502686 GTGGGTGGGGGGATGGGGGAGGG + Intergenic
910201293 1:84702633-84702655 TTGGGGGAGGGGCTGGGGGTTGG - Intergenic
910264134 1:85320821-85320843 AGGGGTGAGGGGAGGGTTGTTGG + Exonic
910368430 1:86490287-86490309 CTGGGTAAGGGGATGTGCGTGGG + Intronic
910598490 1:89005371-89005393 GTGGGAGAGGGACTGGTGGTGGG + Intergenic
911055191 1:93702548-93702570 GTGGGGGTGGGGATGGGGGTTGG + Intronic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911335158 1:96573396-96573418 CTGGCTGTGGGGATGAGGGTGGG - Intergenic
911516633 1:98875771-98875793 TGGGGTGGGGGGATGGGGGTGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911995238 1:104758111-104758133 GGGGGTGGGGGGATGGGGGTGGG + Intergenic
912309964 1:108610286-108610308 GTGGGTGAGAGGAGAGTGGTTGG + Intronic
912422000 1:109548835-109548857 CTCGGTGAGGGGCTGGAGGCGGG + Exonic
912728002 1:112076123-112076145 ATGGGTGAGTGGGTGGAGGTGGG + Intergenic
912801158 1:112720476-112720498 CTGGGAGAGGGCAAGGGGGTGGG - Exonic
912954051 1:114140214-114140236 CTGGCTGGGGGGATAGGGGTGGG - Intronic
912954475 1:114144925-114144947 CTTGGGAAGGGGGTGGTGGTAGG - Intronic
913507012 1:119526474-119526496 CTGGGGGATGGGGTGGTTGTGGG - Intergenic
914445935 1:147750840-147750862 ATGGGGTGGGGGATGGTGGTAGG - Intergenic
914852103 1:151322500-151322522 CTGGGTGAGGGGATTGATTTGGG - Intronic
914899340 1:151703510-151703532 CTGGGGGAGGGGAGGGGGCTGGG + Intronic
914911588 1:151791338-151791360 CCGGGGGAGGGGGTGGTGGCGGG + Exonic
915063384 1:153204977-153204999 CTGGGGGAGGGCAGGGAGGTGGG - Exonic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915243603 1:154541284-154541306 GCGGGAGAGGGGTTGGTGGTGGG + Intronic
915297373 1:154930689-154930711 CAGGGTGGTGGGGTGGTGGTGGG - Intronic
915322338 1:155062683-155062705 CTTGGGGAGGGGCTGGGGGTTGG + Exonic
915978899 1:160408150-160408172 CTGGGAGCTGGGATGGGGGTGGG + Intronic
916002963 1:160634287-160634309 CTGGGTGAGGGATTGCAGGTGGG - Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916912253 1:169363618-169363640 CTGGGTGGTGGGATGGTGCAGGG - Intronic
916938599 1:169656809-169656831 CTGGGAGAAGGGATGGCTGTGGG + Intergenic
917796405 1:178535916-178535938 ATGGGTGTGGGGATGGGGCTGGG + Intronic
918123105 1:181557045-181557067 CTGGGAGAAGGGATTTTGGTGGG + Intronic
918278426 1:182978338-182978360 GTGGGTGTGGTGATGCTGGTGGG - Intergenic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918475508 1:184919917-184919939 CTGGGGGAGGGGGAGGTGTTGGG + Intronic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
918632030 1:186730191-186730213 CTGGGGGAAGGGATGGCTGTGGG - Intergenic
918816376 1:189190896-189190918 TGGGGTGGGGGGATGGTGGAGGG - Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919723641 1:200866977-200866999 CGGGGGGCGGGGAGGGTGGTAGG - Intergenic
919806973 1:201386073-201386095 CTGGATGAGGATATGGTGGGGGG + Intronic
919931776 1:202225797-202225819 CTTGGGGAGGGGCTGGTGGCTGG - Intronic
920043973 1:203121649-203121671 CTGGTTGGGGGGATGGGGGATGG - Intronic
920214161 1:204350466-204350488 CCTGCGGAGGGGATGGTGGTGGG - Intronic
920438907 1:205965509-205965531 CTGGGGGTGGGAATGGGGGTAGG + Intergenic
920704301 1:208240594-208240616 CTGGGTGGGGCGGTGGTGATTGG + Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920917943 1:210273014-210273036 CTGGGGGCGGGGATGGGGGCTGG + Intergenic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922272147 1:224043837-224043859 GTGGGGGAGGGGATGCTGGTGGG - Intergenic
923034665 1:230277265-230277287 CTGTCTGATGGGATTGTGGTTGG - Intronic
923112720 1:230904999-230905021 CCAGGTGGGGGGACGGTGGTGGG + Intergenic
924242907 1:242057319-242057341 CTGGGGGTGGGGGTGGAGGTGGG + Intergenic
924274502 1:242372011-242372033 GGGGGTGTGGGGAGGGTGGTAGG - Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799883 10:371192-371214 TAGGGTGAGGGGATGGTGCAGGG - Intronic
1062844113 10:690962-690984 CGGGGTGGGGGGGTGGTGGGGGG - Intergenic
1063050020 10:2436967-2436989 TTTGGTAAGTGGATGGTGGTTGG + Intergenic
1063676108 10:8141685-8141707 GTGGGGGTGGGGATGGGGGTGGG - Intergenic
1063907960 10:10799592-10799614 CTGGGGGTGGGGGTGGGGGTAGG - Intergenic
1064368160 10:14726823-14726845 CAGGGTGTGGGGATGGTTTTAGG + Intronic
1065754646 10:28919970-28919992 CTGGGGCAGGGGATGGTTTTGGG + Intergenic
1065756735 10:28937433-28937455 ATGGGTGAGTGGATAGAGGTTGG - Intergenic
1066315439 10:34241391-34241413 CCGGTGGAGGGGAGGGTGGTGGG + Intronic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067709648 10:48637704-48637726 ATGGGTGAATGGATGGTGCTGGG + Intronic
1068134132 10:52934997-52935019 CTGGGGGTGGGGTTGGGGGTGGG + Intergenic
1068620605 10:59177108-59177130 TGGGGTGAGGGGAGGGCGGTGGG - Intronic
1068632087 10:59308562-59308584 CTGGTGGTGGTGATGGTGGTTGG - Intronic
1068866477 10:61900655-61900677 GCGGGGGAGGGGATGGGGGTGGG + Intergenic
1068877021 10:62007928-62007950 CTGGGTGATGGGATAGAGCTGGG - Intronic
1069182840 10:65384984-65385006 CGGGGTGAGGGAATGGGGGGGGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1070161318 10:73868313-73868335 CATGGTGTGGGGATGGAGGTGGG - Intronic
1070555268 10:77522538-77522560 GTGGGTGAGGGGCTGTTGCTAGG - Intronic
1070682650 10:78459689-78459711 GTGAGTGAGGGGATGGGGTTAGG + Intergenic
1070828673 10:79405661-79405683 CTGGCTGGAGGGAAGGTGGTGGG + Intronic
1070862139 10:79679592-79679614 CTGGGAGGGTGGATGGTGGGAGG - Intergenic
1070874998 10:79794864-79794886 CTGGGAGGGTGGATGGTGGGAGG + Intergenic
1071064447 10:81614269-81614291 CTGGGCATGGGGATGGGGGTCGG + Intergenic
1071090580 10:81913393-81913415 CTGAGTGAGAGTATGGTGCTGGG - Intronic
1071190109 10:83089726-83089748 CTGGGGGAAGGGGTGGTTGTGGG + Intergenic
1071466248 10:85942334-85942356 CTGGTTCAGAGGATGTTGGTGGG + Intronic
1071641922 10:87317029-87317051 CTGGGAGGGTGGATGGTGGGAGG + Intergenic
1071945991 10:90645560-90645582 GTGGGTGAGGGGCTGGGGGAGGG - Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073047801 10:100651060-100651082 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047843 10:100651186-100651208 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047884 10:100651312-100651334 GTGGGAGTGGGGGTGGTGGTGGG - Intergenic
1073047903 10:100651366-100651388 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047915 10:100651402-100651424 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047938 10:100651474-100651496 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047957 10:100651528-100651550 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048005 10:100651675-100651697 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048022 10:100651720-100651742 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048039 10:100651765-100651787 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048056 10:100651810-100651832 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048073 10:100651855-100651877 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048090 10:100651900-100651922 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048107 10:100651945-100651967 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073457605 10:103647053-103647075 AGGGGTGGGGGGATGGAGGTAGG + Intronic
1074349528 10:112722360-112722382 TTGGGTGGGGGGATGGGGGAGGG + Intronic
1074382128 10:112989906-112989928 TGGGGTGAGGGGAGGGTGGTGGG + Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074767893 10:116714032-116714054 ATGGGTGGGTGGATGGTGGGTGG + Intronic
1074853122 10:117454550-117454572 CTGGGGAAGGGGATGGCTGTGGG + Intergenic
1075016044 10:118910573-118910595 GTGGGGGGGGGGATGGGGGTGGG + Intergenic
1075046638 10:119151416-119151438 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075118972 10:119651004-119651026 ATGGGGGAGGGGGTGGAGGTGGG + Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075589923 10:123684013-123684035 TTGGGGGAGGGGATGGAGCTGGG - Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1075719116 10:124574738-124574760 CTGGGGGAGGGCATGGTCGGAGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1076640067 10:131909370-131909392 TTTGGAGAGTGGATGGTGGTGGG + Intronic
1076755744 10:132570772-132570794 CTGGGTGACTGGCTGGTGCTGGG + Intronic
1076770338 10:132659395-132659417 CTGGGTGAGGCGGGAGTGGTGGG + Intronic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077166040 11:1139291-1139313 CTGGGGGAGGCGGGGGTGGTGGG + Intergenic
1077308793 11:1879491-1879513 CTGTGAGCGGGGCTGGTGGTGGG + Intronic
1077311143 11:1889606-1889628 ATGGGTGAGGGCCTGATGGTGGG + Exonic
1077353159 11:2102245-2102267 GTGGGTGAATGGATGGAGGTTGG + Intergenic
1077404855 11:2378280-2378302 CTGGGTGAGGAGAGGGAGATCGG - Intronic
1077405294 11:2379859-2379881 CTGGGTGAGGTGGGGTTGGTGGG + Intronic
1077465810 11:2733201-2733223 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1077488223 11:2848742-2848764 CTGGGCGAGGGGTTGGAGGCGGG - Exonic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078643133 11:13114447-13114469 CTGGGGGAGGTGATGAGGGTGGG - Intergenic
1078936586 11:15956783-15956805 CTGGTTGGGGAGAGGGTGGTGGG - Intergenic
1079044728 11:17091118-17091140 TTGGGGGATGGGATGGTGGGAGG + Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080033553 11:27688004-27688026 CTGGGAGAGGGGGTGGCTGTGGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1080139030 11:28892295-28892317 TAGGGTGAGGGGCTGGTGCTTGG - Intergenic
1080174247 11:29342987-29343009 CCTGGTGAGGGAATGGTGGTGGG - Intergenic
1080710113 11:34738391-34738413 CTGGGAGAAGGGGTGGTTGTGGG + Intergenic
1081409706 11:42743210-42743232 CTGGGAGTGGGCATGGTGGTGGG - Intergenic
1081656580 11:44861471-44861493 CTGGGCGGGGGGTCGGTGGTTGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1082787449 11:57324720-57324742 CGGGTTGAGGTGGTGGTGGTCGG - Intronic
1082812106 11:57484618-57484640 CTGGGTTAGGGGTTGGGGGTCGG - Exonic
1082835875 11:57649802-57649824 GTGGGTGGGGGGAGGGTAGTTGG + Intronic
1083485608 11:62981384-62981406 CTGGGAGCGGGGGTGGGGGTGGG + Intronic
1083485622 11:62981434-62981456 CTGGGTGGGGGGCTGGGGCTGGG + Intronic
1083581534 11:63828269-63828291 CTGGGCATGGGCATGGTGGTGGG - Intergenic
1083727551 11:64636393-64636415 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1083764622 11:64835982-64836004 CTAGGCCAGGGGATGGTGGCTGG - Intronic
1083765246 11:64838482-64838504 CTGGGCCAGCGGATGGTGGCTGG + Intronic
1083826449 11:65206693-65206715 CTGGGAGAGGGGAGAGTGGCAGG - Intronic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084208890 11:67611813-67611835 CTGGGGGAGGGGCTGCTGCTAGG + Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084796690 11:71510894-71510916 TTGGGAGAGGGGAAGGTGTTCGG + Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1084940890 11:72612686-72612708 ATGGGTGGGTGGATGGTGGGTGG + Intronic
1084953826 11:72680932-72680954 TTGGCTGGGGGGATGGGGGTGGG + Intergenic
1085173611 11:74468201-74468223 TTGAGTGAGGGCATGGTGGTGGG - Intergenic
1085279611 11:75321272-75321294 AGAGGTGGGGGGATGGTGGTGGG - Intronic
1085306429 11:75488583-75488605 CTGAGTGAAGGCATGGAGGTGGG - Intronic
1085346221 11:75769531-75769553 CTGGGCGAGAGGATGGATGTGGG - Intronic
1085665426 11:78411158-78411180 TTGGGGGGGGGGATGGTGGAAGG + Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086735601 11:90302237-90302259 CTGGGGGAAGGGGTGGTTGTGGG - Intergenic
1087712267 11:101567410-101567432 CTGGGGGAAGGGGTGGTTGTAGG + Intronic
1088328969 11:108629766-108629788 CTGGGTGTGGTGGTGATGGTAGG - Intergenic
1088598092 11:111454819-111454841 CTGGGTTGGGGGTTGGGGGTTGG + Intronic
1088604065 11:111512387-111512409 GTGGGGGAGGGGATGGGGGGGGG - Intergenic
1089197894 11:116705856-116705878 CTGGGTGAGGGAATGATGCTGGG + Intergenic
1089606481 11:119644395-119644417 CTGGCTGAGAGGGGGGTGGTCGG - Intronic
1089622603 11:119730154-119730176 CAGGGGGAGGGGATGGGGATAGG - Intergenic
1089643700 11:119864336-119864358 CTGGGGGAGGTGGTGGTGTTAGG - Intergenic
1089752518 11:120661437-120661459 CTGGGGGTGGGGTTGGGGGTGGG + Intronic
1089758633 11:120706550-120706572 CCAGGTGAGGGGCTGTTGGTGGG + Intronic
1089793118 11:120958531-120958553 CTGGGTGAGGAGGTCGAGGTAGG - Intronic
1090212847 11:124935137-124935159 CTGGTGGAGGGGGTGTTGGTAGG - Intronic
1090401301 11:126449960-126449982 CTTGGTGAGGGGATGTGAGTCGG + Intronic
1090876239 11:130791343-130791365 CTGGTTCAGGGGGTGGTTGTAGG + Intergenic
1090915710 11:131160371-131160393 CTGGGTGCTGGGATGCTGGCTGG + Intergenic
1091827762 12:3526021-3526043 CTGGAAGAGGGAATGGGGGTTGG - Intronic
1091838568 12:3602978-3603000 CTGGGTGGAGGAATGGGGGTGGG - Intergenic
1092280758 12:7096291-7096313 CTGGGGTAGGGGTTGGGGGTGGG - Exonic
1092361508 12:7840526-7840548 CTGGGTGTGGGTGTGGTGGCGGG - Intronic
1092504601 12:9083240-9083262 TGGGGTGAGGGGATGGGGGAGGG + Intronic
1092595370 12:9998305-9998327 CTGTGCGTGGGGATGGTTGTCGG - Exonic
1092661491 12:10743428-10743450 GTGGGTGGGGGGATGGGGGAGGG - Intergenic
1092923886 12:13256838-13256860 CTGGGTGAGGTTGTGGTGGAGGG + Intergenic
1092981179 12:13795932-13795954 TGGGGTGAGGGGATGGGGGAGGG + Intronic
1094066226 12:26363444-26363466 GGGGGTGAGGGGGTGGAGGTGGG - Intronic
1094148325 12:27254171-27254193 TTGAGGGAGGGGATTGTGGTAGG + Intronic
1094517412 12:31145922-31145944 TGGGGTGGGGGGATGGTGGAGGG - Intergenic
1095944880 12:47748161-47748183 CAGGGTGAGGGGATGGGAGGAGG + Intronic
1095953257 12:47792962-47792984 CTGGGTGGTGGGATACTGGTTGG + Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096564369 12:52465224-52465246 CTGGGAGAGGGGGTGGAGATGGG + Intergenic
1096812756 12:54182274-54182296 CTGGGGGTGCGGCTGGTGGTGGG - Exonic
1097323094 12:58246838-58246860 TTGGGGGAGGGGGTGGTGGTGGG + Intergenic
1097802375 12:63928652-63928674 CTGGGGGTGGGGGCGGTGGTGGG + Intronic
1097989966 12:65824369-65824391 CTTGGGGAGGGGGTGGTGGTGGG - Exonic
1098167395 12:67712206-67712228 TGGGGTGAGGGAATGCTGGTGGG + Intergenic
1098924773 12:76337342-76337364 TTGGGTTAGGGGGTGGTGGCTGG + Intergenic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1099986607 12:89672691-89672713 GTGGGTGTGGAGATAGTGGTTGG - Intronic
1100415958 12:94375122-94375144 TGGGTTGAGGGGAAGGTGGTGGG + Intronic
1100824781 12:98464429-98464451 CTGAGTGTGGGGGTGGGGGTGGG - Intergenic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101860002 12:108475174-108475196 CGGGGTGGGGGGGGGGTGGTGGG + Intergenic
1101890019 12:108704962-108704984 ATTGGTGATGGGATGGTGGCAGG + Intronic
1101916444 12:108899737-108899759 CTGGGAGTGGGGATGGTAGCTGG + Intronic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1102080531 12:110094318-110094340 ATGGGGGTGCGGATGGTGGTGGG + Intergenic
1102795417 12:115685061-115685083 ATGGGTGGGTGGATGGTGGGTGG + Intergenic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103253198 12:119518712-119518734 TTGGTGGTGGGGATGGTGGTGGG + Intronic
1103772461 12:123338719-123338741 CTGGGTGTGGTGGTGGTGGTGGG + Intronic
1104038346 12:125114036-125114058 CGGGGTGAGGGGGATGTGGTGGG - Intronic
1104224307 12:126816365-126816387 AAGGGTGAGGGGATGGGGGAGGG - Intergenic
1104426663 12:128683442-128683464 CTGCGTGAGGGCCTGGAGGTAGG - Intronic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104656083 12:130574963-130574985 CTGGGGGTGGGGGTGGCGGTGGG - Intronic
1104746112 12:131211399-131211421 ATTGGTTAGGGGATGGTGGGGGG + Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104933753 12:132353775-132353797 TTCAGTGAGGGGATGGTGGCAGG - Intergenic
1106478980 13:30122953-30122975 GTGGTTGTGGGGATGGGGGTTGG - Intergenic
1106783886 13:33087849-33087871 ATGGGTGAGGGGATGGTCTTGGG + Intergenic
1107628170 13:42312588-42312610 ATGGGTGAGGGGATGTTGGGGGG - Intronic
1108452677 13:50582989-50583011 CTGGGTGCGGGGGTGGGGGCTGG + Intronic
1108588820 13:51894497-51894519 GGGGATGAGGCGATGGTGGTTGG + Intergenic
1110162108 13:72390855-72390877 TTGGGGGAGGGGTTGGTGATTGG - Intergenic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1112092646 13:96098356-96098378 GTGGCTGAGGTGGTGGTGGTTGG + Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113631994 13:111894135-111894157 CTGGGAGAGGGGGTGGTAGCAGG + Intergenic
1113751563 13:112780246-112780268 CTGGGTTGGAGGGTGGTGGTGGG - Intronic
1113788240 13:113014176-113014198 CTGGGTGGGGGGATGGGTGTGGG + Intronic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1113982545 13:114288521-114288543 ATGGGTGAGGGCAGCGTGGTTGG + Intronic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1114613651 14:24057241-24057263 CTTGGTGAGGAGTTGGTGATGGG + Exonic
1114665054 14:24372722-24372744 CTGGGGGAGGGGCTGGAGTTGGG + Intronic
1114863749 14:26560982-26561004 CAGGGTGGGGGGATGGTTTTGGG + Intronic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115578587 14:34735971-34735993 CTGGTGAGGGGGATGGTGGTAGG - Intergenic
1115823820 14:37241574-37241596 GGGGGTGAGGGGGTGGGGGTGGG + Intronic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117472267 14:56057803-56057825 TTGGGGCAGGGGATGGGGGTTGG - Intergenic
1117547578 14:56805715-56805737 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1118365447 14:65091521-65091543 ATGAGTGAAGGGATGGTGGCAGG - Intronic
1118620726 14:67611773-67611795 CAGGGTGGGGGGATGGTTTTGGG + Intergenic
1118895616 14:69943073-69943095 CTTGGGGAGGGGGTGGTGGTGGG + Intronic
1119484071 14:74977032-74977054 CTGGTGGTGGGGATGATGGTGGG + Intergenic
1119770108 14:77215253-77215275 CAGTGTGAGGTGGTGGTGGTGGG - Intronic
1120140008 14:80919467-80919489 CTGGGTGAAGGAGGGGTGGTTGG - Intronic
1120246056 14:82008225-82008247 CGGGGCGAGGGGATGGGGGGCGG - Intergenic
1120815393 14:88851692-88851714 CTGGCTGGGGGCAGGGTGGTGGG + Intronic
1121023237 14:90594910-90594932 TTTGGTGAGGGGTTGGTGGATGG + Intronic
1121050195 14:90815431-90815453 GTGGGTGAGGGGTTGGTGCCTGG - Intronic
1121131748 14:91453626-91453648 GTGGGTGGGGGGATGGTTTTGGG + Intergenic
1121170635 14:91851137-91851159 AGGGGTGAGGGGATGGTTTTGGG - Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121798237 14:96753402-96753424 CTGGGTGGGGGGATAGTTTTGGG - Intergenic
1121816229 14:96931157-96931179 CTGGGAGAGAGGGTGGTAGTGGG + Intronic
1121870628 14:97403888-97403910 CTGGGTGGCGGGATGGTGTCTGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122781634 14:104146253-104146275 CTGGGTGTTGGGATGGTGCCAGG + Intronic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124109722 15:26773811-26773833 CTGGGGGTGGGGGTGGGGGTAGG - Intronic
1124373097 15:29114505-29114527 TTGGGAGGGGGGATGGTGCTGGG + Intronic
1124466991 15:29949031-29949053 GTGGCGGAGGTGATGGTGGTGGG - Intronic
1124687101 15:31792029-31792051 GTGGGAGAGGGAGTGGTGGTAGG - Intronic
1124940552 15:34213624-34213646 CGGGGTGAAGGGTGGGTGGTAGG + Intergenic
1124984197 15:34589961-34589983 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125523861 15:40363577-40363599 TTGGGGTGGGGGATGGTGGTGGG - Intronic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125686026 15:41563875-41563897 GTGGGAGATGGGATGGAGGTGGG + Intronic
1125730883 15:41892306-41892328 CAGGGTGAGGGGCTGGTGCAGGG - Intronic
1125741166 15:41965955-41965977 CTGGGTGGGGTGGTGGGGGTAGG - Intronic
1126856027 15:52840264-52840286 CTGGGCCAGGGGATGGCTGTGGG + Intergenic
1127155254 15:56117622-56117644 CTGGGAAAGGGGATGGGGATAGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127981526 15:64038569-64038591 CTGGCTGACTGGATGGTGGGTGG - Intronic
1128383539 15:67130900-67130922 GGGGGTGAGGAGGTGGTGGTGGG + Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129514173 15:76146848-76146870 CTGGGTGTGGTGATGGAGGTAGG - Intronic
1130109591 15:80953665-80953687 CCTGGTGAGGGAATGGTGCTGGG + Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1131156113 15:90076800-90076822 TTGGGTGGTGGGATGGGGGTGGG - Intronic
1132071341 15:98778908-98778930 CTGGTTTTGGGGCTGGTGGTGGG - Intronic
1132074696 15:98810146-98810168 CTGGCGGAGGGGGTGGTGGGTGG + Intronic
1132306781 15:100820788-100820810 TTAGGTGGGGGGATGGTGGAAGG - Intergenic
1132496623 16:266431-266453 CAGCGTGAAGGGATGATGGTAGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1132644924 16:994357-994379 ATGGGTGAGTGGCTGGTGGTTGG - Intergenic
1133275930 16:4638511-4638533 CTGGGTGGGGGACTGGTAGTAGG + Intronic
1133451074 16:5904496-5904518 CAGAATGTGGGGATGGTGGTGGG + Intergenic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133654398 16:7846092-7846114 CTGGGTGAGTGGGTGGGAGTGGG + Intergenic
1134001052 16:10783073-10783095 GTGGGTGAGGGGGTAGTGATTGG + Intronic
1134036886 16:11037781-11037803 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1134205955 16:12238032-12238054 CTGGGTGTGGGGGTTGAGGTTGG + Intronic
1134224603 16:12381012-12381034 GTGGGTGGGTGGATGGTGGGTGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1135304491 16:21356419-21356441 AAGGTTCAGGGGATGGTGGTGGG + Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135933307 16:26757770-26757792 CTGGCTTAGGTGATGGGGGTTGG + Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136893138 16:33981937-33981959 CTGGGCTGGGGCATGGTGGTGGG + Intergenic
1137555250 16:49466239-49466261 CTCGGGGAGGGGATGTTAGTAGG + Intergenic
1137609995 16:49811747-49811769 CTGGGGGCGGGGGTGGGGGTAGG - Intronic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137710397 16:50562977-50562999 CGGGGGGGGGGGGTGGTGGTGGG - Intronic
1137788025 16:51152715-51152737 CGGGGTGGGGGGAGGGCGGTGGG + Intergenic
1137825723 16:51493208-51493230 CTGGGTGAAGGGTTTGGGGTTGG - Intergenic
1137983724 16:53090830-53090852 CTGGGACAGGGCATGGGGGTTGG - Intronic
1138277212 16:55743737-55743759 GTGGGTGTGGGGGAGGTGGTCGG + Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138647746 16:58437487-58437509 CTAGGTGAGGGTATGAGGGTGGG + Intergenic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138916337 16:61469219-61469241 ATGGATGGGGGGATTGTGGTTGG + Intergenic
1139344443 16:66293508-66293530 CTGGGGGTGGGGGTGGTGATGGG - Intergenic
1139545478 16:67647784-67647806 GGGGGTGAGGGGAGGGGGGTGGG + Intronic
1139699029 16:68695849-68695871 ATGGGTGTCGGGATGATGGTTGG - Exonic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1140165294 16:72544049-72544071 CTGGGGGAAGGGGTGGTTGTGGG + Intergenic
1140409950 16:74735401-74735423 CTGGGTGACGGGAGGGTCATAGG - Intronic
1140727098 16:77823209-77823231 TTGGGTGTGGGAATGGTGGGTGG - Intronic
1141030594 16:80584441-80584463 TGGGGTGAGGTGGTGGTGGTTGG - Intergenic
1141039113 16:80656287-80656309 CTGGGTGTGGGGTTGGGAGTAGG - Intronic
1141399197 16:83732408-83732430 CAGGGTGAGTTGATGGTGGGAGG + Intronic
1141576176 16:84964697-84964719 CTGGGTGTGGGTATGGGAGTGGG + Intergenic
1141606564 16:85157297-85157319 ATGGATGAGTGGATGATGGTTGG - Intergenic
1141659680 16:85435299-85435321 GTGGGGGAGGGGGTGGTGGGAGG - Intergenic
1141789621 16:86225768-86225790 ATGGGTGAATGGGTGGTGGTGGG - Intergenic
1141875260 16:86819809-86819831 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
1142286488 16:89173503-89173525 CTGGGGGAGGTGGTGGAGGTGGG + Intronic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143052930 17:4141601-4141623 CTGGGTGATGGGATGCTGTGTGG + Intronic
1143465855 17:7135789-7135811 CAGGGGGAGGGGTTGGTGGGCGG + Intergenic
1143485760 17:7252643-7252665 CTGGCTGAGGGGACGGAAGTGGG + Intronic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1143590706 17:7884770-7884792 GTGGGTGGGGGGGTGGTGGGGGG + Intronic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1143648513 17:8248078-8248100 TTGGGGGTGGGGATGGGGGTGGG + Intronic
1143660674 17:8322701-8322723 GTGGTTGTGGCGATGGTGGTGGG + Intergenic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1144037670 17:11382005-11382027 CTGGGTTTGAGGTTGGTGGTTGG + Intronic
1144559006 17:16306447-16306469 GTGGGTGGTGGGGTGGTGGTTGG - Intronic
1144765846 17:17731986-17732008 CTGGGGGAGGTGGTGGTGGGGGG + Intronic
1144892340 17:18501194-18501216 CTGGGGGAGGTGCTGGTGGCTGG - Intergenic
1144965856 17:19076926-19076948 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1144982112 17:19175256-19175278 CTTGGTCAGGGGAGGATGGTCGG - Intergenic
1144986111 17:19202983-19203005 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145139874 17:20443094-20443116 CTGGGGGAGGTGCTGGTGGCTGG + Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146380482 17:32323785-32323807 TTGGGAGAGGGGATGGAGGTGGG - Exonic
1146568451 17:33933265-33933287 CAGGGTGAAGGGATAGTGATTGG - Intronic
1146635354 17:34500104-34500126 GTGAGTCAGGGGATGGTCGTAGG - Intergenic
1146643183 17:34556455-34556477 CTGGGTGAAGAGTTAGTGGTAGG - Intergenic
1146659291 17:34653687-34653709 CTGGAGGAGGGGATGGGGTTGGG - Intergenic
1146941589 17:36847346-36847368 TTGGGTGTGGGGAGGGAGGTGGG + Intergenic
1147017786 17:37506363-37506385 CTGGCTTGGGGGATGGGGGTAGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147384970 17:40075660-40075682 ATGGGGGAGGGGAAGGTGATGGG - Intronic
1147943373 17:44066136-44066158 TTAGGAGAGGGGGTGGTGGTGGG - Intronic
1148152675 17:45405572-45405594 ACGGGTGAGGGGGTGGTGATGGG - Intronic
1148211828 17:45813314-45813336 CTGGGTCAGGGGCTTGGGGTGGG - Intronic
1148542548 17:48492306-48492328 GTGGGTGGGGGGCTGGGGGTGGG - Intergenic
1148560331 17:48602383-48602405 GTGGGGGTGGGGATGGCGGTGGG + Intronic
1148793102 17:50184651-50184673 CTGGGGGCGGGGATGGGGGCAGG - Exonic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1148884348 17:50760703-50760725 CAGGGTGAGCTGATGGTGCTAGG - Intergenic
1148919514 17:51018266-51018288 CCGGGGGAGGGGGTGGGGGTGGG + Intronic
1149454621 17:56777755-56777777 CTAGGTGTGGGGATATTGGTGGG - Intergenic
1149936288 17:60810352-60810374 CTGGTTGTGGGGATGGCGGGGGG + Intronic
1150273680 17:63882485-63882507 CGGGGCGTGGGGATGGGGGTGGG + Intergenic
1150481983 17:65517755-65517777 CTGGGTGTGGAGGGGGTGGTAGG - Intergenic
1150802751 17:68294644-68294666 CTGGGTGGGAGCATGGTGGGTGG - Intronic
1150837281 17:68575958-68575980 CTGGGGAAGTGGATGGTGTTAGG + Intronic
1151166169 17:72205654-72205676 CCGTGGGAGGGGGTGGTGGTGGG - Intergenic
1151365432 17:73613586-73613608 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151558296 17:74858337-74858359 CTGGGTTGGGGGTTGGGGGTCGG + Intronic
1151635594 17:75345698-75345720 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1151705635 17:75765509-75765531 CTGGCTGTGTGGGTGGTGGTGGG - Exonic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151902537 17:77026167-77026189 GAGGGAGAGGGGGTGGTGGTGGG + Intergenic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152370204 17:79883103-79883125 CTGGGGGTGGGGGTGGGGGTAGG - Intergenic
1152553728 17:81042715-81042737 ATGGGGGTGGGGATGGTGGTGGG + Intronic
1152802840 17:82339908-82339930 CTGGGGGAGGGGTTGGGGGCAGG - Intergenic
1152887950 17:82863583-82863605 CTGGTTGAGGGGTTAGTGCTCGG + Intronic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1154216671 18:12420793-12420815 CGGGGTGGGGGGACGGTGGGGGG + Intronic
1155222978 18:23702150-23702172 CGAGGTGAGGGGAAGGGGGTGGG + Intronic
1155380618 18:25218332-25218354 CGTGGTAAGGGGATGGTGGGAGG + Intronic
1156168742 18:34456191-34456213 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1156839519 18:41594926-41594948 TTGGGAGAGGGGATGGTGAAAGG + Intergenic
1157432903 18:47644208-47644230 GAGGGTGAAGGGAAGGTGGTTGG + Intergenic
1157689425 18:49668878-49668900 CCAGGTGAGGGGCAGGTGGTAGG + Intergenic
1158659295 18:59371715-59371737 CTGGGGGAAGGGGTGGTTGTGGG - Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1158875204 18:61727178-61727200 ATGGGTGAGGACATGATGGTTGG - Intergenic
1158922308 18:62206792-62206814 CGGGGAGAGGGGGTGGTGGGTGG - Intronic
1159971868 18:74665396-74665418 TTGGCTGAGAGCATGGTGGTGGG + Intronic
1160590737 18:79943616-79943638 CTGGGAGAGGCGATGTGGGTGGG - Intronic
1160687114 19:442266-442288 ATGGGTGAGTGGATGATGGATGG + Intronic
1160692340 19:465817-465839 GTGGGTGGGTGGATGGTGGATGG + Intronic
1160762793 19:794070-794092 CTGGGTGAGGTGGAGGCGGTGGG + Intergenic
1160788870 19:913529-913551 CTGGGTGTAGGGATCGTGGCCGG - Intergenic
1160844804 19:1161498-1161520 CTGGGGGTGGAGATGGGGGTGGG + Intronic
1160859281 19:1230878-1230900 CTGGGTAAGGGTAGGGCGGTGGG - Exonic
1160960383 19:1718267-1718289 GTGGGTGGGTGGATGGTGGGTGG + Intergenic
1161207934 19:3051474-3051496 TTGGGTGAGGCGGTGGGGGTTGG + Intergenic
1161283515 19:3457781-3457803 CTGGCTGAGCGGATGGGGGCGGG + Intronic
1161290357 19:3490780-3490802 TTGGGTGAGGGGAGCGTGGGAGG - Intergenic
1161294457 19:3512656-3512678 CTGGGTGGGGTGGTGCTGGTGGG + Intronic
1161335165 19:3709036-3709058 CAGGGTGAGGGGTTGGGGGGCGG - Intronic
1161347763 19:3776669-3776691 GTGGATGAGTGGATGGTGGGTGG + Intergenic
1161347797 19:3776813-3776835 ATGGATGAGTGGATGGTGATTGG + Intergenic
1161473800 19:4473676-4473698 CTGAGTGAGGGGCTGGGGGTGGG + Intronic
1161535450 19:4816433-4816455 CTGGCTGTGGGGAGGGCGGTGGG + Exonic
1161846294 19:6713630-6713652 CCAGGTGAGGGGCTGGAGGTGGG - Intronic
1161846327 19:6713701-6713723 CCAGGTGAGGGGCTGGAGGTGGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846372 19:6713796-6713818 CAAGGTGAGGGGCTGGGGGTGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161868948 19:6855739-6855761 AAGGGTGAGTGGATGGTGGTCGG - Intronic
1162176297 19:8832570-8832592 CTGGGGGCGGGGCTGGTTGTGGG + Intronic
1162302815 19:9853803-9853825 CTGGGGGTGGGGGTGGGGGTGGG + Exonic
1162322493 19:9978532-9978554 CTGGGTGGGGGCAGGGTGGAGGG - Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162773675 19:12965737-12965759 CTTGGTGTGGGGGTGGAGGTTGG - Intronic
1162830089 19:13278930-13278952 TGGGCAGAGGGGATGGTGGTGGG + Intronic
1162929938 19:13952725-13952747 CGGGGTGAGGGGTTGGGGGCGGG + Intronic
1163054053 19:14705376-14705398 CTGGGGGAGGGTCTGGTTGTTGG + Intronic
1163353738 19:16796094-16796116 ATGGGGGAGGGGCAGGTGGTAGG + Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163610009 19:18295776-18295798 GTGGATGAGTGGATGGTGGATGG - Intergenic
1163633911 19:18429802-18429824 CTGGGGGAGGGGCTGGAGGCGGG - Intronic
1163729598 19:18941322-18941344 CTGGGAGAGGGTATGGGGGAGGG + Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164398701 19:27888118-27888140 CAGAGTGGGGAGATGGTGGTGGG + Intergenic
1164794034 19:31012068-31012090 ATGGGGGAGGGGATGGTTTTGGG - Intergenic
1165149849 19:33753936-33753958 GTTGGTGTGGGGATGGTGGGAGG - Intronic
1165333570 19:35154588-35154610 AGGGGTGAGGGCATAGTGGTGGG - Intergenic
1165749367 19:38250981-38251003 CTGGGACTGGGGATGGGGGTGGG + Intronic
1165796511 19:38523129-38523151 CTGGTTGTGGGGAGGGCGGTTGG - Intronic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
1166263236 19:41657584-41657606 CTGGGGGAAGGGATGGCTGTGGG + Intronic
1166427928 19:42696533-42696555 CTGGGTCAGGGTCTGCTGGTTGG + Intronic
1167132211 19:47594279-47594301 GTTGGTGAGGGGCTGGTGGAAGG - Intergenic
1167173387 19:47848815-47848837 CTGGGGGAAGGGAGGGTGTTTGG - Intergenic
1167475368 19:49697497-49697519 CTGGGTGAAGGGAGAGTGATTGG - Intronic
1167606205 19:50482222-50482244 GTGGGGGTGGGGGTGGTGGTGGG + Exonic
1167650799 19:50727636-50727658 CTGGGGGAAGGGCTGGTTGTTGG - Intergenic
1167684656 19:50949201-50949223 CCGGGGGTGGGGATGGGGGTGGG - Intronic
1168100490 19:54138502-54138524 CGGGGAGGGGGGGTGGTGGTCGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168614888 19:57829733-57829755 CTTGGTGAGGGGAGTGTGGCAGG - Intronic
1168641625 19:58034750-58034772 CTGGTTGGGGGGAGGATGGTGGG - Intronic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925347806 2:3183040-3183062 CTGGGTGGGTGGATGGTGAGTGG - Intergenic
925347887 2:3183339-3183361 GTGGGTGAGTGGATAGTGGATGG - Intergenic
925369306 2:3332535-3332557 ATGGCTGTGGGGATGGTGGCAGG - Intronic
925519164 2:4722474-4722496 CGGGGTGGGGGGTTGGTGGAGGG - Intergenic
925917231 2:8615410-8615432 CCGGGTCAGGGGATGGAGGGCGG + Intergenic
926696535 2:15773071-15773093 CTGGGTGAGGTGGGGGTGGCTGG + Intergenic
926701531 2:15807427-15807449 GTGGGGGTGGGGATGGTGGTAGG - Intergenic
926702610 2:15813758-15813780 GTGGGGGTGGGGATGGGGGTGGG + Intergenic
926803827 2:16686191-16686213 CTGGGAGAGGAGATGTTGCTGGG + Intergenic
926823538 2:16879733-16879755 CTGGGGAAGGGGATGGTTTTGGG + Intergenic
927089621 2:19700643-19700665 CTGGGTGGTGGCCTGGTGGTGGG - Intergenic
927155997 2:20222188-20222210 ATGGGTGAGGGGAGGCTGCTAGG - Intronic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927552230 2:24010341-24010363 CTGGGAGCGGGGAGGCTGGTAGG + Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927945492 2:27132824-27132846 CAAGGTGAGGGGCTGGGGGTGGG - Exonic
928245184 2:29620496-29620518 CGGGGTGGGGGGGTGGTGGGTGG + Intronic
929118538 2:38465183-38465205 CTGGGTGAGGGAGTTGGGGTAGG - Intergenic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929591489 2:43150454-43150476 CTGGGTGAGAGGGTGCTTGTCGG + Intergenic
929686471 2:44039496-44039518 GTGGGTGTGGGGATGGCGATAGG + Intergenic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930385966 2:50695178-50695200 CTGGGTAAGGGGGTGGCGGTGGG + Intronic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931404621 2:61963959-61963981 GTTGGTGATGGGATGGTGGCTGG + Intronic
932340522 2:70960349-70960371 ATGAGTGCAGGGATGGTGGTAGG - Intronic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932414898 2:71567742-71567764 CTTGGTGAGGGGTAGGGGGTGGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932597110 2:73101018-73101040 CTGGGAGAAAGGTTGGTGGTGGG + Intronic
932763512 2:74455933-74455955 CTGGGTGAGGATCTGGAGGTGGG + Exonic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
933729088 2:85443964-85443986 CTGGGCGAGGTGGTGGTGGTTGG + Intergenic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
936469228 2:112783794-112783816 CTGGCTGAGCTGATGGTGGCTGG - Intronic
936522847 2:113222435-113222457 CTGGGGCAGGGGATGGAGCTCGG + Intronic
936858228 2:116985344-116985366 TTGGGTGGGGGGATCGTGGAGGG + Intergenic
937221185 2:120344154-120344176 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
939453255 2:142400225-142400247 CCCAGTTAGGGGATGGTGGTTGG - Intergenic
940453274 2:153867552-153867574 CTGGGAGAGGGGATGGTTTCAGG + Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
941518672 2:166511177-166511199 CTGGGAGAAGGGATGGCTGTGGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942226992 2:173825741-173825763 CTGGGTGAGGGCAGGATGGAAGG + Intergenic
942235814 2:173903997-173904019 CGGGGGGTGGGGATGGTTGTAGG + Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
943014444 2:182494418-182494440 CTGGGCTAAGGGATGGTGGTTGG - Intronic
943049211 2:182895037-182895059 CTTGGTGTGGTGGTGGTGGTTGG - Intergenic
943095633 2:183425799-183425821 TTGGGTGGGGGGATGGGGGAGGG - Intergenic
943444153 2:187962657-187962679 AGGTATGAGGGGATGGTGGTGGG + Intergenic
943906752 2:193508843-193508865 CTGGGTCGGGGGATGGTTTTGGG - Intergenic
944524871 2:200608780-200608802 GGTGGTGAGGCGATGGTGGTAGG - Intronic
944881994 2:204022702-204022724 GTTGGCGAGGGGATGGTGGTGGG - Intergenic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
946178819 2:217937898-217937920 CTGGGTTAGGGGATAGGGGTGGG - Intronic
946189239 2:217999066-217999088 CAGGGTCAGGGCATGGTGTTGGG - Intronic
946366164 2:219250452-219250474 GTGGGTGAGGGCATGGAGGAGGG - Exonic
946366567 2:219252745-219252767 CAGGGTGCGGGGGTGGAGGTGGG - Intronic
946369498 2:219272013-219272035 GTGGGTGAGGGCATGGAGGAGGG + Intronic
946397385 2:219449763-219449785 ATGGGTCAGGGGATGGTGCCCGG - Intronic
946458852 2:219851592-219851614 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
947235654 2:227938171-227938193 CTGGGTGATGGGAAGATCGTTGG + Intergenic
947451502 2:230212902-230212924 TTGGTTGAGGGGGTTGTGGTGGG + Exonic
947864454 2:233386545-233386567 CTAGGGGAGGGGGTGGGGGTGGG + Intronic
948444690 2:238023171-238023193 CTGGGTCACTGGATGGTGGCAGG - Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948555041 2:238803763-238803785 CTGGGTGCGGGAATGGTGTCTGG + Intergenic
948671771 2:239573337-239573359 CTGGGTGATTGGATGGGGCTGGG - Intergenic
948840214 2:240645068-240645090 GTGGGACTGGGGATGGTGGTCGG + Intergenic
1168811838 20:709807-709829 TCGGGGGAGGGGATGGTGGGGGG + Intergenic
1168811868 20:709900-709922 TCGGGGGAGGGGATGGTGGGGGG + Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169141826 20:3230914-3230936 ATCGGTGAGGGGCTGGCGGTGGG - Exonic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169722384 20:8692840-8692862 CAGATTGAGGGGATGGAGGTGGG - Intronic
1170569704 20:17625781-17625803 CGGGGGGAGGGGAGGGTGTTGGG - Intronic
1170739183 20:19038983-19039005 GGGGGTGAGGGGATGGGGGAGGG + Intergenic
1171356757 20:24552448-24552470 TGGGGTGAGGGGATGGGGGAGGG - Intronic
1171365092 20:24617845-24617867 CTGGGGGAGGGTATGGGAGTGGG + Intronic
1171483388 20:25469513-25469535 CTGGGGGAGGGGATGGGCGTGGG - Intronic
1171875410 20:30570628-30570650 GGGGGTGTGGGGATGGGGGTGGG + Intergenic
1172176191 20:32973178-32973200 ATGAGTGAGGAGTTGGTGGTTGG - Intergenic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1172289995 20:33769356-33769378 GGGGGTGAAGGGGTGGTGGTGGG + Intronic
1172757084 20:37293144-37293166 CTGGGGGTGGGGATGGTTTTGGG + Intronic
1172780992 20:37437081-37437103 CTGGGAGTGGGGGTGGGGGTAGG - Intergenic
1172944795 20:38678836-38678858 CTGGGTGCAGGGGAGGTGGTGGG - Intergenic
1173205650 20:40991194-40991216 CTGGTTGAGGAGTTGGTGGGGGG - Intergenic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173558471 20:43984834-43984856 CTGGGGGAGGGGATAGCAGTGGG + Intronic
1173577753 20:44123999-44124021 CTGGGTGAGGGTCTGGAGGATGG + Intronic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174459116 20:50670364-50670386 CTGGGTGGGTGGGTGGGGGTGGG - Intronic
1175013822 20:55766649-55766671 CAGGGAGTGGGGGTGGTGGTGGG + Intergenic
1175199784 20:57268891-57268913 CAGGGTGAGGTGATGGAGGGTGG + Intergenic
1175332511 20:58175214-58175236 CTGGGGCGGGGGATGGAGGTGGG - Intergenic
1175337663 20:58206731-58206753 CTGGGGGAGGGGAGGGGTGTGGG - Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175889393 20:62309634-62309656 AGGGGTGGGGGGAGGGTGGTAGG + Intronic
1176057958 20:63158651-63158673 GTGGATGAGTGGATGGTGGATGG + Intergenic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176137038 20:63528553-63528575 CTGGGTGTGGTGGTGGGGGTGGG - Exonic
1176158625 20:63637011-63637033 CTGGGTGGGGGGATATTGGGAGG - Intergenic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177367608 21:20157727-20157749 TGGGGTGAGGGGATGGGGGAGGG - Intergenic
1178215541 21:30593263-30593285 CTTGGAGTGGGGATGGTGGGGGG - Intergenic
1178478970 21:32962592-32962614 GTGGGGGTGGGGATGGAGGTCGG + Intergenic
1178615576 21:34130111-34130133 GTGGGTGGGGGGATGGGGGAGGG - Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179251261 21:39673480-39673502 GTGGGAGAGGAGATGATGGTGGG - Intergenic
1179587755 21:42384495-42384517 CTGTGTGTGGGGGTGGGGGTAGG - Intronic
1179648813 21:42793326-42793348 GTGCGAGAGGGGATGGTGCTGGG + Intergenic
1179908067 21:44434387-44434409 CTGGTGGCGGGGATGGTGGCGGG + Intronic
1180017890 21:45099198-45099220 CTTGAGGAGGGGGTGGTGGTAGG + Intronic
1181440578 22:22933422-22933444 CATGTTGAGGGGACGGTGGTGGG - Intergenic
1181455868 22:23059844-23059866 GAGGGTGAGGGCATGTTGGTGGG - Intronic
1181484574 22:23222605-23222627 CTGGGAGAGGGGAGCGTGGCAGG + Intronic
1181603654 22:23967044-23967066 CGGGGCGAGGGGAGGTTGGTGGG + Intronic
1181604859 22:23974263-23974285 CGGGGCGAGGGGAGGTTGGTGGG - Intronic
1182078617 22:27512695-27512717 CTGGGACAGGGGAGGGTTGTTGG - Intergenic
1182093695 22:27612510-27612532 CTGGGGGATGGGGTGGTTGTGGG - Intergenic
1182345232 22:29658614-29658636 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1182351984 22:29704422-29704444 GGGGTTGAGGGGAGGGTGGTGGG - Intergenic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182603910 22:31489319-31489341 CTGCGTGAGGGGCTGCGGGTTGG - Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183197758 22:36365097-36365119 ATGGGGGAGGGGCTGGTGTTCGG - Intronic
1183279504 22:36924400-36924422 CTGGGAGAGGGCATGGTGGGTGG - Intronic
1183297896 22:37043018-37043040 GTGGGTCAGGGGGTGGTCGTAGG - Intergenic
1183510064 22:38229544-38229566 CTGGGTGGGGGCAGTGTGGTGGG - Intronic
1183658411 22:39204377-39204399 ATGGCTGCGGGGATGGTGGGAGG - Intergenic
1183720455 22:39558799-39558821 CTGGGGGAGGGGGCTGTGGTGGG + Intergenic
1184039205 22:41933349-41933371 CAGGGAGAGGGGGTGGGGGTGGG + Intergenic
1184105597 22:42365867-42365889 CTGGGGGTGGGGATTGTGGTAGG - Intergenic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184257354 22:43294819-43294841 CTGTGTGAGGGCTTGGGGGTGGG - Intronic
1184300304 22:43554968-43554990 CTGGGTGATGGCATGGTAATGGG + Exonic
1184729726 22:46365854-46365876 TTGGGTGGGGGGAAGGTGGTGGG + Intronic
1184729766 22:46365945-46365967 CTGGGTGGGGGAAAGGTGGTGGG + Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184746587 22:46459673-46459695 CTGGGGGTGGGGGTGCTGGTGGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185186750 22:49405668-49405690 CTTGGGGTGGGGATGGGGGTGGG + Intergenic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
950185030 3:10939589-10939611 CTGAGAGGGAGGATGGTGGTAGG - Exonic
950202938 3:11057607-11057629 ATGGGTGAGTGGATGGTGAATGG + Intergenic
950345309 3:12287825-12287847 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
950476167 3:13216287-13216309 CTGGTGTAGGGGATGCTGGTTGG - Intergenic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951618321 3:24572788-24572810 TGGGGTGGGGGGATGGTGGAGGG + Intergenic
951672094 3:25196211-25196233 TGGGGTGAGGGGATGGGGGAGGG - Intronic
952043232 3:29285237-29285259 GTGGGGGTGGGGGTGGTGGTGGG + Intronic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
952816339 3:37451261-37451283 CTGGGGGTGGGGATGGGGGTAGG + Intergenic
952835463 3:37598356-37598378 CTGGGGGAGGGGATGGTGCCAGG + Intronic
953013102 3:39047035-39047057 GGGGGTGGGGGGATGGGGGTGGG - Intergenic
953081387 3:39622166-39622188 ATGGGGGAGGGGATGGGGGCAGG + Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953463921 3:43103433-43103455 CTGGGTGAGGGGGCAGTGCTGGG - Intronic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
954315407 3:49798782-49798804 GTGGGTGACAGGATGGGGGTGGG - Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954370994 3:50169523-50169545 CTGGGTGAGAGTATGGGGGTGGG + Intronic
954388888 3:50258713-50258735 CTGGGGCAGGGGCTGGTGTTGGG - Exonic
954409408 3:50363933-50363955 CAGGGCGAGGGGTTGGTGGGAGG - Intronic
954435976 3:50496550-50496572 ATGGATGAGGGGATAGTGGCTGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954783018 3:53074247-53074269 TTGGGAGGGGGGATGCTGGTAGG - Intronic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
955063718 3:55516535-55516557 CTGGGGGCTGGGATGGGGGTGGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
958098033 3:88972997-88973019 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
958883348 3:99697957-99697979 GTGGGTGAGGGGGTGGGGGAGGG - Intronic
959099903 3:101998576-101998598 CTGAATGAGGGAATGGTGGCTGG - Intergenic
959244410 3:103846088-103846110 CAGGGTGAGGGGATAAGGGTAGG + Intergenic
959848132 3:111057204-111057226 CTGGGGGAAGGGATGGCTGTGGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
959991683 3:112638545-112638567 CTGGGTTCTGAGATGGTGGTGGG + Exonic
960156997 3:114306242-114306264 CCAGGTGAGTGGATGGTGCTTGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960450305 3:117798721-117798743 CTGGTGGGTGGGATGGTGGTAGG + Intergenic
960590895 3:119364223-119364245 GGGGGTGGGGGGATGGAGGTGGG + Intronic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960902044 3:122563605-122563627 ATGGGTGAGGGGATGAAGGAGGG - Intronic
960944848 3:122958791-122958813 CTGGGAGAGGGCAAGGGGGTGGG - Intronic
960976351 3:123178352-123178374 TGGGGTGAGGGGATGGGGGAGGG + Intronic
960989468 3:123301339-123301361 CTGGGTGATTGGATTGTGGGGGG + Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961462735 3:127062983-127063005 CGTGGTGTGGGGGTGGTGGTGGG + Intergenic
961557079 3:127703088-127703110 CTGGGGGAGGAGACAGTGGTGGG - Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
961992461 3:131206824-131206846 TGGGGTGAGGGGATGGGGGAGGG - Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962342628 3:134598041-134598063 CTGGGTGAGGGTATGCAGGGTGG - Intronic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963382813 3:144553481-144553503 TTGGCTGGGGGGATGGGGGTGGG - Intergenic
963603740 3:147397358-147397380 GTGTGTGAGGGGGTGGCGGTTGG - Intronic
963853053 3:150226779-150226801 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
963942412 3:151108234-151108256 TGGGGTGAGGGGCAGGTGGTGGG + Intronic
964284817 3:155106652-155106674 GTGGTTGGGGGGATGGTGGGAGG + Intronic
964796297 3:160501321-160501343 TTGGGTGGGGGGAAGGAGGTGGG + Exonic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
966139122 3:176734592-176734614 GGGGGTGGGGGGACGGTGGTGGG - Intergenic
967191459 3:186988560-186988582 TGGGGTGGGGGGGTGGTGGTGGG + Intronic
967732129 3:192916768-192916790 GTAGGTGAGGGGCTGGAGGTGGG + Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
967957079 3:194885573-194885595 CTGGGGGAAGGGATGTTGATAGG + Intergenic
968357769 3:198122079-198122101 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
968760820 4:2442135-2442157 CTGAGTGTGGGGATGGGGTTTGG + Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968877832 4:3283427-3283449 ATGGGTGAGGCCATGGTGTTGGG + Intergenic
968894257 4:3389604-3389626 GTGGGTGAGGGGATTCTGGCAGG - Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969501625 4:7556873-7556895 GTGGGTGGGTGGATGGTGGATGG - Intronic
969510492 4:7614811-7614833 ATGGATGAATGGATGGTGGTTGG - Intronic
969720442 4:8890582-8890604 CTGGTTGGGGGGATGGTGCCAGG - Intergenic
969870229 4:10099952-10099974 CTTGGTGACAGGATCGTGGTGGG - Intronic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
972766172 4:42153455-42153477 CTGGGGCAGGGTATGCTGGTTGG - Intergenic
972793549 4:42395339-42395361 CTGGGCGAGGGGTTGGGGGGAGG - Intergenic
973012180 4:45090536-45090558 CAGGGTGAGGTTATGATGGTAGG - Intergenic
973237101 4:47917184-47917206 CAGGGTGGGGGGCTGGTGGAGGG - Intronic
973321862 4:48817950-48817972 CTGGGGGAAGGGGTGGTTGTGGG + Intronic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
974943875 4:68503483-68503505 CTGGGGGAAGGGGTGGTTGTGGG + Intergenic
975294291 4:72714557-72714579 ATGGTTGAGGGGTTGGTGTTGGG - Intergenic
975473373 4:74794636-74794658 CTGGGTGTGGGTATGGGTGTGGG - Exonic
976111091 4:81674545-81674567 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
977467702 4:97402947-97402969 CTGGGGGAAGGGGTGGTTGTGGG - Intronic
978667384 4:111200585-111200607 GTGGGTGTGGGGATGGGGGTTGG - Intergenic
979573534 4:122258547-122258569 CTGAGTGAGAGGATTGGGGTGGG + Intronic
981289413 4:143056774-143056796 GGGGGTGAGGGGATGCTGGGGGG + Intergenic
981531725 4:145760831-145760853 TTGGGTGAGGGGATGCTGGGAGG + Exonic
981552145 4:145952870-145952892 CAGGGTGGAGGGATGGTGGCAGG - Intergenic
982062211 4:151615937-151615959 ATGGGTGACAGGAGGGTGGTAGG + Intronic
982099206 4:151952173-151952195 ATGGGAGAGGGGGTGGGGGTGGG - Intergenic
982460380 4:155662936-155662958 CAGGGTGGGGGGATGGGGGAGGG - Intergenic
982638023 4:157921788-157921810 TGGGGTGAGGGGATGGGGGAGGG - Intergenic
983406448 4:167337107-167337129 CTGGGAGTGGGCATGGGGGTGGG - Intergenic
983543344 4:168935807-168935829 CTGGGGGAAGGGGTGGCGGTGGG + Intronic
984836595 4:184028301-184028323 CTAGCTGAGGGGATGGTCTTGGG - Intergenic
985149115 4:186928357-186928379 CTGAGTGAAGGGTTGGAGGTAGG + Intergenic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985712911 5:1440002-1440024 CTGGGAGAGGGCTTGGTGCTGGG + Intronic
985881419 5:2641587-2641609 GTGGGTGACGGAATGGTGGCAGG + Intergenic
985961347 5:3305601-3305623 GTGGGTGAGGGGCTGGGGGTGGG + Intergenic
986517902 5:8582441-8582463 CTGTGTGTGAGGATGGTTGTTGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986865041 5:11976493-11976515 CTGGGTGGGAGGATGGGAGTAGG + Intergenic
986879640 5:12154047-12154069 CTGGGTGAAGGGGTGGCTGTTGG + Intergenic
987053805 5:14171778-14171800 CGGGGTGGGGGGATGGTCGGTGG + Intronic
987132958 5:14875711-14875733 CTTGGTGAGGGGTCGGTGGGGGG - Intergenic
988839348 5:35067854-35067876 ATGATTGAGGGGGTGGTGGTGGG + Intronic
989374079 5:40741601-40741623 CTGCGTGAGGAGATGGAGATTGG - Intronic
989795567 5:45467194-45467216 TTTGGGGAGGGGAAGGTGGTGGG - Intronic
990483221 5:56231556-56231578 CAGGAGGAGAGGATGGTGGTGGG + Intronic
991243264 5:64483094-64483116 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
991511553 5:67382912-67382934 AGGGTTGAGGGGGTGGTGGTGGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992350249 5:75921091-75921113 CTGGGTGAGGGCATTGTGCACGG + Intergenic
992484429 5:77181092-77181114 GTGAGGGTGGGGATGGTGGTGGG - Intergenic
992949992 5:81849641-81849663 CTGGGAGTGGGAATGGGGGTGGG - Intergenic
992950628 5:81853694-81853716 CACGGTGGGGGGATGGTGGCAGG + Intergenic
993023341 5:82618178-82618200 TGGGGTGAGGGGATGGAGGAGGG + Intergenic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
993463648 5:88217570-88217592 GTGGGCGAGGGGGTGGTGGGGGG + Intronic
994297700 5:98110879-98110901 CGGGGTGGGGGGAGGGTTGTGGG + Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
995398652 5:111716786-111716808 CTGGGGGAAGGGATGGCTGTGGG - Intronic
996089366 5:119335879-119335901 GGGGGTGAGGGGGTGGAGGTGGG + Intronic
997096448 5:130918631-130918653 GTGGGTGAGGGGCTGGGGGAGGG + Intergenic
997424052 5:133791036-133791058 GTGAGTGAGGGGACTGTGGTAGG - Intergenic
997633753 5:135389722-135389744 CTGGGTGACTGGATGGGGATTGG - Intronic
997647890 5:135493074-135493096 ATGGGTGAATGGATGGTGGCTGG + Intergenic
997724848 5:136111991-136112013 GTGGGTGGGGGGGTGCTGGTGGG + Intergenic
997866554 5:137468891-137468913 GTGGGTGAGGGGACAGTTGTCGG - Intronic
998137407 5:139681504-139681526 TGGGGTCAGGGGATGGGGGTGGG - Intronic
998192835 5:140042195-140042217 GTGGGTGAGGGGGTTGGGGTTGG - Intronic
998543160 5:143002375-143002397 CTGGGTTGGGGGTTGGGGGTTGG + Intronic
999101253 5:149027852-149027874 CTGCGCCAGGGGATTGTGGTGGG - Exonic
999126128 5:149247561-149247583 CTGGGTGGGGGTCTGGTGGTGGG - Intronic
999361897 5:150992552-150992574 GAGGAGGAGGGGATGGTGGTGGG + Intergenic
999570407 5:152913819-152913841 GTGGGTGGGGGGATGGGGGAGGG - Intergenic
999897202 5:156047963-156047985 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1000232464 5:159328885-159328907 CCAGGAGAGGTGATGGTGGTGGG + Intronic
1000666142 5:163999606-163999628 GTAGGTGAAGGGATTGTGGTAGG - Intergenic
1001045306 5:168366740-168366762 CTGGGTGTGAGGATGGAGATGGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002278175 5:178116262-178116284 TTGGGGGAGGGGGTGGAGGTAGG + Intronic
1002303646 5:178271278-178271300 GGGGGTGAGGGGACAGTGGTGGG - Intronic
1002375124 5:178783261-178783283 TTGGGTCAGGGGATGGCTGTTGG - Intergenic
1002381371 5:178832072-178832094 CTGGGGGAGGGGGGGGAGGTGGG - Intergenic
1002467768 5:179416336-179416358 CTGGGTGTGGGGAGGGGCGTGGG - Intergenic
1002796112 6:472173-472195 GTAGGTGTGGGGATGGTGTTGGG - Intergenic
1003169216 6:3708011-3708033 CTGGATGATGGAATGGAGGTTGG + Intergenic
1003350484 6:5313094-5313116 CTGTGTTAGGGGGTGTTGGTTGG - Intronic
1003893425 6:10584144-10584166 CTTGGCGAGGGGAATGTGGTGGG + Intronic
1004136898 6:12976105-12976127 CTGGGGGAGGGGGTGATGGAAGG + Intronic
1004724241 6:18295806-18295828 CTGGGTGAGAGGATTGATGTGGG - Intergenic
1004810331 6:19252932-19252954 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1005740327 6:28785393-28785415 CTGGGGGAGGGGGTGGAGGGCGG - Intergenic
1006197515 6:32254971-32254993 CGGGAAGAGGGGATGGGGGTGGG + Intergenic
1006215654 6:32440287-32440309 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006593069 6:35172293-35172315 CTGGGAGAGTGGCTGGTGCTAGG + Intergenic
1006971630 6:38051182-38051204 TTGAGGGAGAGGATGGTGGTGGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007210180 6:40187398-40187420 CGGGGTGAGGGGGTGGTGGTGGG + Intergenic
1007350071 6:41265882-41265904 AAGAGTGAGGGGATGGGGGTGGG + Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007790202 6:44304348-44304370 CTGGGTGAGGGCAGGGGGTTGGG + Intronic
1008096797 6:47347181-47347203 CTGGAGGAGGTGATGGTGCTGGG + Intergenic
1008147764 6:47912266-47912288 GTGGGGGATGGGATGGGGGTGGG - Intronic
1008465766 6:51829154-51829176 CTGGGTGGGGGAAAGGAGGTGGG - Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009712038 6:67336206-67336228 TTGGGTGTGGGGATGGTGGTGGG + Intergenic
1010193944 6:73222187-73222209 CTGGGAGAGGGGTTTGGGGTGGG - Intronic
1010852828 6:80799357-80799379 CTGGATGAGGGGTTGATGATAGG - Intergenic
1010921302 6:81684341-81684363 GTGGGTGTGGGGAGGGTAGTGGG - Intronic
1011235530 6:85212757-85212779 CTGGGAGAGGGGGTGGCTGTGGG - Intergenic
1011705298 6:89995242-89995264 TGGGGTCGGGGGATGGTGGTGGG - Intronic
1012123765 6:95400239-95400261 CTGGGAGAGGGAATATTGGTCGG + Intergenic
1012403119 6:98861215-98861237 CTGGGGGTGGGGATAGGGGTAGG + Intergenic
1012711325 6:102609839-102609861 TGGGGTGGGGGGATGGTGGAGGG - Intergenic
1013074103 6:106755244-106755266 CTGTGTGAGGGGATCCTGGGTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013946603 6:115729202-115729224 CTGGGGGATGGCATGGGGGTTGG - Intergenic
1014007878 6:116442220-116442242 GTGGGGGAGGGGAGGGTGATAGG + Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015262980 6:131259881-131259903 CTGGGTGATGGGTTGATGGGTGG - Intronic
1015407583 6:132855103-132855125 CTGGGTTGGGGGATGGCTGTGGG + Intergenic
1016326854 6:142912773-142912795 CATGGTGTGGGGATGGTGGATGG - Intronic
1016357498 6:143234129-143234151 CTAGGTCGGGGGTTGGTGGTCGG + Intronic
1016702277 6:147067251-147067273 CTGGGTAGGGGGATGGTTTTGGG + Intergenic
1016755140 6:147676825-147676847 CTGGGGGTGGGGGTGGGGGTAGG + Intronic
1016827777 6:148404581-148404603 CTGGGGGTGGGGCAGGTGGTGGG - Intronic
1017102620 6:150862218-150862240 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
1017649568 6:156568500-156568522 CCAGGTGAGGAGATGGTAGTGGG - Intergenic
1018174814 6:161169337-161169359 CAGCGAGAGGGGATGGTGCTGGG + Intronic
1018230318 6:161669211-161669233 CTGGGTGCTGGGAAGGTGCTGGG - Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018609935 6:165638171-165638193 TTTGGTGGGGGGAGGGTGGTGGG - Intronic
1018916662 6:168136560-168136582 CAGGGAGTGGGGACGGTGGTGGG + Intergenic
1018916674 6:168136591-168136613 CAGGGAGTGGGGACGGTGGTGGG + Intergenic
1018916686 6:168136622-168136644 CAGGGAGTGGGGACGGTGGTGGG + Intergenic
1018916698 6:168136653-168136675 CAGGGAGTGGGGACGGTGGTGGG + Intergenic
1019642125 7:2109145-2109167 GTGGGAGATGGGATGGTGATGGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019667618 7:2259614-2259636 TTGGGTGTGGGGTTGGTGGCCGG - Intronic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019983333 7:4637826-4637848 CTGGGTGTGAGAATGGAGGTTGG - Intergenic
1020007445 7:4790067-4790089 CTGGGTGTGGGGCTGTGGGTGGG - Intronic
1020029488 7:4922865-4922887 CAGGGTGAGGGCAGGGTGATGGG - Intronic
1020175179 7:5876472-5876494 CTGGGCGAGGTGATGCTGGTTGG + Intergenic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1021549796 7:21858703-21858725 CTGGGGCTGGCGATGGTGGTGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022498182 7:30866219-30866241 CTGGGTGAGTGGATAGGGGCAGG - Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1022723610 7:32962005-32962027 CGGGGTGGGGGGATGGTTTTGGG - Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023111272 7:36813383-36813405 CAGGGTGAGAGGAGGGTAGTAGG - Intergenic
1023450344 7:40277829-40277851 TGGGGTGAGGGGATGGGGGAGGG - Intronic
1023460641 7:40392693-40392715 ATGGGTGAGGAGATGGTTTTAGG + Intronic
1023955523 7:44884358-44884380 CTAGCCAAGGGGATGGTGGTTGG + Exonic
1023984397 7:45086479-45086501 CGGTGGGAGGGGCTGGTGGTGGG + Intronic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024064619 7:45722075-45722097 TTGGGTGGGGGGTTGCTGGTGGG - Exonic
1025050018 7:55725912-55725934 CGGGGTGGGGGGATGGTTTTGGG + Intergenic
1026236913 7:68535084-68535106 GTGGGTGGGGGGGTGGTGGGTGG + Intergenic
1026298266 7:69075097-69075119 CTGGGTGAGGGTAAGTTGTTGGG - Intergenic
1026804548 7:73421878-73421900 CTGGGTGTGGGCCTGGGGGTGGG - Intergenic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027224208 7:76233936-76233958 CAGAGTGATGGGATGGGGGTGGG - Intronic
1027353088 7:77331707-77331729 CTGGGAGAAGGGATGTTGGCTGG - Intronic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1029083594 7:97994154-97994176 CTGGGCAAGGTGATGCTGGTTGG - Intergenic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029431679 7:100535212-100535234 CTGGGTTAGGGGGTGCTGATAGG - Intergenic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1029646292 7:101858290-101858312 CTGGTTTTGGGGTTGGTGGTGGG + Intronic
1029796142 7:102896385-102896407 GTGGCTGTGGAGATGGTGGTTGG + Intronic
1029801192 7:102949206-102949228 CTGGGGTAGGGGTTGGTAGTGGG + Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030014599 7:105206145-105206167 CTGGGTGGTGGGGTGGGGGTGGG - Intronic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1031605614 7:123763828-123763850 TTGAGTGAGGGGTTGGAGGTGGG - Intergenic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1032464841 7:132137700-132137722 ATGGGTGGGGAGATGGTGGGAGG + Intronic
1032534986 7:132655661-132655683 CTGGGTGAGTTGCTGGTGTTGGG - Intronic
1033290929 7:140082118-140082140 GGAGGTGAGAGGATGGTGGTAGG + Intergenic
1033292425 7:140098650-140098672 CTCAGTGAGGGGATGTTTGTGGG - Intronic
1033327349 7:140390630-140390652 CTGGCGGTGGGGATGGAGGTTGG - Intronic
1033637808 7:143228245-143228267 CGGGGTGGGGGGCTGGTGGAGGG - Intergenic
1034162288 7:149002418-149002440 TTGGGGGTGGGGATGGGGGTGGG + Intergenic
1034184102 7:149161115-149161137 CAGGGTGAGGAGGTGGTGGTGGG - Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1034774553 7:153813167-153813189 CAGGGTGGGGGGATGGGGGAAGG - Intergenic
1035182333 7:157098430-157098452 AGGGGTGAGGGGATGGGAGTTGG - Intergenic
1035683673 8:1507793-1507815 GTGGGTGGAGGGAGGGTGGTGGG - Intronic
1036528474 8:9556772-9556794 CTGGGTGATGGGGGCGTGGTTGG + Intronic
1036599954 8:10251670-10251692 GTGGGTGTGGGGAAGATGGTTGG - Intronic
1037088347 8:14880803-14880825 TGGGGTCAGGGGATGGGGGTGGG + Intronic
1037496271 8:19443877-19443899 CTGGGGGTGGGGGTGGAGGTGGG + Intronic
1037618556 8:20543165-20543187 CTGGGTGAAGGGGTTGTGGGCGG + Intergenic
1037637197 8:20710715-20710737 CTGGGGGTGGGGGTGGTGGCTGG + Intergenic
1037827420 8:22167672-22167694 CTGGGTGAAGTGAGGCTGGTGGG + Intronic
1038008773 8:23457515-23457537 GTGGGTGAGGGGAGGGCGGGCGG - Intronic
1038520578 8:28228994-28229016 CTGGTTGCGGGGGTGGTGGCGGG - Intergenic
1038570362 8:28657078-28657100 CTGGGTGTGGTGGTGGTGGTGGG - Intronic
1040428013 8:47308634-47308656 GTGGGGGTGGGGATGGGGGTGGG + Intronic
1040792938 8:51254594-51254616 GTTGGTGATGGGATGGTGGGAGG + Intergenic
1041043536 8:53870154-53870176 TTGGGTGAGAGAATGGTGGTTGG - Intronic
1041536016 8:58926239-58926261 CTGGGTGAGAGGAAGATGGCTGG + Intronic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1043052972 8:75405138-75405160 AGGGGTGGGGGGATGGGGGTGGG + Intergenic
1043445235 8:80313064-80313086 TGGGGTGAGGGGATGGTTTTGGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1043791589 8:84475051-84475073 CTGGGTGGGGGGCTGGGGGAGGG - Intronic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044721775 8:95157612-95157634 CTGGTTGAGGGGTTGGGGGTGGG + Intergenic
1045102389 8:98858561-98858583 CTGGCTGAAGGGATAGTGGGAGG + Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046131872 8:109975575-109975597 CGGGGTGAGGAGGTGGGGGTGGG + Intronic
1048035650 8:130674811-130674833 CGTGGTGAGTGGATGCTGGTAGG - Intergenic
1048714011 8:137246580-137246602 TAGGGTGAGGGGATGGGGGAGGG + Intergenic
1049223151 8:141436960-141436982 CTGGGTGGGGGGGTGGGGGGTGG + Intergenic
1049274808 8:141714838-141714860 CTGGGAGAGTGGTTAGTGGTGGG + Intergenic
1049301404 8:141872536-141872558 CAGGGTCAGGTGAGGGTGGTGGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049320665 8:141994596-141994618 GGGGGTGAGTGGATGGTGGATGG - Intergenic
1049521806 8:143095229-143095251 CTGGGGGAGGGGACGGGGGCTGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049688279 8:143947979-143948001 CTGGGTGAGGAGAGCGTGATGGG - Intronic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049971601 9:826602-826624 CCGGGGGCGGGGATGGAGGTGGG - Intergenic
1050111634 9:2222836-2222858 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1050501377 9:6301361-6301383 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051079575 9:13279266-13279288 GTGGGGGCGGGGATGGGGGTGGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052125084 9:24764992-24765014 CTGGGGGAAGGGGTGGTTGTAGG - Intergenic
1052879753 9:33594159-33594181 TAGGGTGATGGGAGGGTGGTGGG + Intergenic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053496228 9:38550070-38550092 TAGGGTGATGGGAGGGTGGTGGG - Intronic
1055127026 9:72730632-72730654 CTGGGTGAGGAGATGGTTTCAGG + Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055469307 9:76595389-76595411 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1055541366 9:77309139-77309161 TTGGGTGAGCTGGTGGTGGTGGG - Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056812021 9:89772308-89772330 GTGGGAGCGGGGAAGGTGGTGGG + Intergenic
1057739761 9:97701160-97701182 AAGGAGGAGGGGATGGTGGTGGG - Intergenic
1057820084 9:98323526-98323548 GTGGGGGAGAGGGTGGTGGTTGG + Intronic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058104394 9:100954081-100954103 TGGGGTGAGGGGAGGGGGGTGGG + Intergenic
1058210982 9:102169940-102169962 TGGGGTGAGGGGATGGCGGAGGG - Intergenic
1058424249 9:104862734-104862756 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1058727663 9:107818613-107818635 CAGGATGGGGGGGTGGTGGTGGG + Intergenic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1060304879 9:122402406-122402428 ATGGGGGAGTGGAGGGTGGTAGG + Intergenic
1060527441 9:124328474-124328496 CTGGGGAAGCGGATGCTGGTGGG - Intronic
1061124572 9:128666231-128666253 CCGGGCGTGGGCATGGTGGTGGG + Intergenic
1061328519 9:129878485-129878507 CTGGGAGATGGGATGCTGGCAGG + Intronic
1061492627 9:130954490-130954512 CTGGCTAAGGGTGTGGTGGTGGG - Intergenic
1061500154 9:130997379-130997401 CAGGGAGAGGGGTTGGAGGTTGG + Intergenic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1062314114 9:135957217-135957239 CAGGCTGAGGGGATGTTGGGGGG + Intronic
1062360664 9:136186494-136186516 CTGGCGGAGGCGGTGGTGGTCGG - Intergenic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1185455470 X:308157-308179 CTGGGTGGGTGGGTGGTGGTTGG - Intronic
1186021684 X:5263705-5263727 TTGGGTGATGGGGTGGTGGTAGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186356809 X:8799612-8799634 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1186357136 X:8800727-8800749 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1186705024 X:12131987-12132009 CTGGGAGAGGGACTGGGGGTTGG - Intergenic
1186835865 X:13437171-13437193 AAGGGTGAGGGGATGGGAGTTGG + Intergenic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189961938 X:46332583-46332605 CTAGGTAACCGGATGGTGGTGGG - Intergenic
1189978448 X:46486098-46486120 CTTGGTGAGGGGAGGGGGGTTGG - Intronic
1190550046 X:51570609-51570631 CTGGGGGAGGAGATGGAGTTTGG + Intergenic
1191164048 X:57368225-57368247 CTGGGTTTGGGGGTGGGGGTGGG - Intronic
1191852293 X:65594405-65594427 TGGCATGAGGGGATGGTGGTGGG + Intronic
1192318062 X:70067179-70067201 GTGGGTGAAGGGATCCTGGTGGG + Intergenic
1192437421 X:71151559-71151581 CAGGGTCTGGGAATGGTGGTCGG + Intronic
1192707465 X:73541429-73541451 CTGGGTGAAGGGGTGGCTGTGGG + Intergenic
1193351989 X:80474748-80474770 CTGGGGGAAGGGATGGCTGTGGG - Intergenic
1193425750 X:81338451-81338473 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1195068463 X:101258167-101258189 CTGGGGGTGGGGATGGGGGTGGG + Intronic
1195580233 X:106493414-106493436 CTGGGGGAAGGGATGGCTGTGGG - Intergenic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1195969554 X:110458410-110458432 GTGGGTGAGAGGATGGTAGAAGG - Intergenic
1196192102 X:112805666-112805688 TTGGGTTAGGGGGTGGTGTTGGG - Intronic
1196630075 X:117927813-117927835 CAGGGTTTAGGGATGGTGGTGGG + Intronic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1197142245 X:123130191-123130213 CTGGGAGAAGGGATGGCTGTGGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198019041 X:132640367-132640389 CTAGGTGCGTGTATGGTGGTGGG + Intronic
1198296621 X:135293474-135293496 CAGGGTGAATTGATGGTGGTGGG - Intronic
1198533944 X:137568706-137568728 CTGGGTTTGGGAGTGGTGGTCGG - Intronic
1198683623 X:139205577-139205599 CTGCGTGTGGGGGTGGGGGTGGG - Intronic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199086748 X:143636233-143636255 CTGGGGAAGGGGGTGGTAGTTGG + Intergenic
1199743945 X:150760193-150760215 CTAGGTGTGGGAATGGGGGTGGG + Intronic
1199985056 X:152944513-152944535 CTCGGTGTGGGGCTGGTGATGGG + Intronic
1200000402 X:153056864-153056886 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200098894 X:153678782-153678804 CTGAGAGAGGGGATCGTGCTTGG - Intronic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200230731 X:154442747-154442769 GTGGGTGATGGGAACGTGGTGGG - Exonic
1201293286 Y:12442407-12442429 CTGGGTTAGGTGAGGGAGGTAGG - Intergenic
1201526941 Y:14946866-14946888 TGGGGTGGGGGGATGGTGGAAGG - Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201684832 Y:16689209-16689231 TAGGGTGAGGGGAAGGGGGTGGG + Intergenic