ID: 956127695

View in Genome Browser
Species Human (GRCh38)
Location 3:66026852-66026874
Sequence ATGTCTCTCTGGCAGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956127691_956127695 -6 Left 956127691 3:66026835-66026857 CCGTGGGGTCACCAAGCATGTCT 0: 1
1: 0
2: 0
3: 11
4: 144
Right 956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG 0: 1
1: 0
2: 3
3: 18
4: 218
956127687_956127695 20 Left 956127687 3:66026809-66026831 CCATTTTTTATTTATCGGACTAT 0: 1
1: 0
2: 4
3: 21
4: 309
Right 956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG 0: 1
1: 0
2: 3
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956127695 Original CRISPR ATGTCTCTCTGGCAGCAAAA GGG Intronic
902166378 1:14575158-14575180 AGGTCACTCTGGCAGCAGAGTGG + Intergenic
902249658 1:15145994-15146016 ATGTCTTTCTACCAGCCAAATGG - Intergenic
904019474 1:27451595-27451617 AGCTCTCTCTGGCAGCAGTATGG + Intronic
905092964 1:35444293-35444315 ATGTCTCTGCAGCACCAAAATGG - Exonic
905103172 1:35543664-35543686 AAGTGTCCCTGGCAGGAAAAAGG - Intronic
905421041 1:37844533-37844555 TTCTCTATCTGGCAGCACAAAGG - Intronic
905852797 1:41286615-41286637 ATGTTTCCCTGGCAGCACCAAGG - Intergenic
908460005 1:64339970-64339992 AGGTCCCTCTGGCTGCAACATGG - Intergenic
909988524 1:82192394-82192416 ATGATTGTCTGGCAGCACAAAGG - Intergenic
915327281 1:155086867-155086889 ATGTCTCTCTGGGGGGACAAAGG - Exonic
917529597 1:175822853-175822875 TTGTCATTCTGGGAGCAAAAAGG + Intergenic
920460333 1:206134812-206134834 ATCTCCCTCTAGCAGCAAAAAGG - Intergenic
920516483 1:206588130-206588152 ATTTCTCTCTGAAAACAAAAAGG - Intronic
921060898 1:211583684-211583706 AGATCACTCTGGCAGTAAAATGG - Intergenic
921277412 1:213533467-213533489 CTGTCTCTCTGGAAGGAACATGG + Intergenic
923828340 1:237525269-237525291 ATGTCCTTCTTGCAGCAACATGG - Intronic
1064618543 10:17190987-17191009 ATGTCTCTTTAGCAGCAACCTGG + Intronic
1064947023 10:20801933-20801955 AAGACTCTCTCACAGCAAAATGG + Intronic
1065093529 10:22259214-22259236 ATCTCTCTCTGCCTCCAAAATGG + Intergenic
1066559233 10:36650991-36651013 ATGTCTCTCTGGTAACTAGAGGG + Intergenic
1066809935 10:39316799-39316821 ATGTGTATTTGGGAGCAAAAGGG - Intergenic
1068140520 10:53000888-53000910 AGGTCTCTCTTGCAGGCAAATGG - Intergenic
1068819236 10:61353771-61353793 ATATCTTTTTGGCAGCAACAAGG - Intergenic
1069358359 10:67613801-67613823 ATGGGTCTCTGGTACCAAAAAGG - Intronic
1071222476 10:83485449-83485471 ATGTCTCTGAGGCAGAAAGAGGG + Intergenic
1071439731 10:85679660-85679682 ATGTCTTACTGGCAGGAGAATGG + Intronic
1075409269 10:122215376-122215398 ATGTGTCACTGGAAACAAAATGG - Exonic
1075567416 10:123514745-123514767 CTGTCTCTTTGTCTGCAAAATGG + Intergenic
1076444806 10:130507179-130507201 ACGCCACTCTGGCAGGAAAAGGG + Intergenic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1078828333 11:14953222-14953244 ATGACTCTCTGGAAAGAAAAGGG + Intronic
1080480785 11:32647690-32647712 CTAACTCTCTGGCAGAAAAATGG - Intronic
1081020476 11:37941413-37941435 ATGTGTCTTTTGCAGCAACATGG - Intergenic
1083519171 11:63291818-63291840 AGATCTCTGTGGCAACAAAATGG - Intronic
1084075013 11:66767759-66767781 AAGTCTCCCTGACACCAAAAGGG - Intronic
1085623705 11:78056248-78056270 ATGTCTCCCTGGCAGACAGAAGG - Intronic
1085709206 11:78813889-78813911 ATGTCTCTCTGGCCTGTAAATGG - Intronic
1086585211 11:88443517-88443539 ATATGTCTCTGGCTGCAGAATGG + Intergenic
1090058029 11:123439972-123439994 ATTTTTCTATGGCTGCAAAAAGG - Intergenic
1090508700 11:127348127-127348149 ATGTATTTCTGGCACCAGAATGG + Intergenic
1091159761 11:133409304-133409326 AGGGCTCTCTGGCAGCTAAGTGG + Intronic
1093118395 12:15238624-15238646 ATTACTCTCTGGGAGAAAAAAGG + Intronic
1094364247 12:29663273-29663295 ATGTATCAATGGCAGCAGAAAGG + Intronic
1096045148 12:48555691-48555713 TTGTCCCACTGGCAGGAAAATGG - Intergenic
1097313582 12:58148749-58148771 ATTTCTCTCTGGCAGAGAACTGG - Intergenic
1098056418 12:66510876-66510898 ATGTCTCACTGGCAATGAAAAGG + Intronic
1100536644 12:95517449-95517471 ATTTTTGTCTGGCAGCAAACAGG - Exonic
1101106160 12:101442778-101442800 ATGTATCACTGGCATAAAAACGG - Intergenic
1101671919 12:106883604-106883626 ATGACTCACTGGGAGGAAAAGGG - Intronic
1101958487 12:109230870-109230892 ATGTCTCTCTGGGTCAAAAAAGG - Intronic
1103063629 12:117878605-117878627 ATGTCTCTCTGGCTGCTACTTGG - Intronic
1105832399 13:24175271-24175293 TTGTTTCTTTGGCAGAAAAAAGG + Intronic
1106073224 13:26434332-26434354 ATATTACTCTGGAAGCAAAAAGG + Intergenic
1106800541 13:33252091-33252113 ATGGCCCTCTGGCACTAAAAAGG + Intronic
1107816046 13:44245462-44245484 AGGTCTCTCTGTCAGGAAAGAGG - Intergenic
1107916575 13:45157962-45157984 ATGTATCACTGGCAGAAACATGG - Intronic
1109271436 13:60260358-60260380 ATCTTTCTCTGTCAGGAAAAGGG + Intergenic
1110059591 13:71024877-71024899 ATGTATATATGGCAGCAACAGGG - Intergenic
1110298827 13:73901391-73901413 ATATTTCTATGGCAACAAAAAGG - Intronic
1110647829 13:77908779-77908801 CTGTCTCTCTGATCGCAAAAAGG + Intronic
1112237642 13:97650722-97650744 ATGTCTCTCTGACAGAGAACAGG - Intergenic
1115566337 14:34628755-34628777 ATGTCTCTCTCACATTAAAACGG + Intronic
1116546539 14:46173473-46173495 ATCTCTCTCTTGCAGTGAAAAGG + Intergenic
1116643382 14:47495103-47495125 TTGTCTCTTTTGCAGCAACATGG + Intronic
1117947509 14:61044322-61044344 ATATCTCTCTGGTCCCAAAAGGG + Intronic
1121928078 14:97947441-97947463 TTCTCTCTCTGGCAGCAATGGGG - Intronic
1124033957 15:26036370-26036392 ATCTCCCTCTGGAAGCACAATGG - Intergenic
1124420977 15:29521654-29521676 TTGTCTCTGGGGCAGAAAAAGGG + Intronic
1127891234 15:63253186-63253208 ATGTTTTTCTGGTTGCAAAAAGG + Intronic
1130415839 15:83693987-83694009 TTATCTCTCTGGCAGAGAAAAGG - Intronic
1130814430 15:87416115-87416137 ATTTGTCTGTGGCAGCAAAGAGG + Intergenic
1130852943 15:87815787-87815809 ATGCCTTTCTGTCAACAAAAAGG + Intergenic
1131363297 15:91814795-91814817 ATGTATCTTTGGTATCAAAATGG - Intergenic
1131494922 15:92900071-92900093 ATTTCTCTCTGGCTTAAAAAGGG + Exonic
1132631122 16:917974-917996 ATGTCTTGCGGGCAGCAGAAGGG - Intronic
1132757252 16:1491698-1491720 GAGTCTCACTGGCAGGAAAACGG - Intergenic
1139136296 16:64208380-64208402 ATTCTTCTCTGGCAGGAAAATGG + Intergenic
1141084284 16:81080510-81080532 GTGTGTCTTTGGCAGGAAAAGGG + Intergenic
1143326462 17:6101619-6101641 CTGACTCTCTGCCAGCAAGAGGG + Intronic
1144322913 17:14147954-14147976 AGATCTCTCTGGAAGGAAAAAGG + Intronic
1144592925 17:16540117-16540139 TTGTCCCACTGGCAGGAAAACGG + Intergenic
1145064189 17:19750929-19750951 ATGTCTCTCTGGCAGCCACTTGG - Intergenic
1146085673 17:29826706-29826728 AGGTCTCTCTGGAGGTAAAAAGG - Intronic
1151243176 17:72774067-72774089 GTGTCTCTCTGTTTGCAAAATGG + Intronic
1151948187 17:77330742-77330764 ATGCCTGTCCGGCAGCAGAAGGG + Intronic
1153294563 18:3533361-3533383 GTGTTTCTTTGGCAGCTAAAGGG + Intronic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1153895962 18:9560460-9560482 TTGTATCTCAGGAAGCAAAATGG + Intronic
1156284512 18:35678156-35678178 AAATATCTCTGACAGCAAAATGG + Intronic
1157883955 18:51348322-51348344 ATGTCTTTTTGGTAGGAAAATGG + Intergenic
1159101993 18:63968253-63968275 AGGTCCCTCTGGCTGCAACATGG - Intronic
1159794398 18:72823835-72823857 ATGTCTCTGTGGCAGCTACTGGG - Intronic
1159864598 18:73689396-73689418 ATGTCTGTGTGACAGCAAACAGG - Intergenic
1162265189 19:9567476-9567498 ATCAGTCTCTGGTAGCAAAAAGG - Intronic
1164244101 19:23415753-23415775 AGGTCCCTCTGGCCGCAAGATGG - Intergenic
1167785939 19:51636363-51636385 ATGTTTCTCTGGCTTCCAAAGGG + Intronic
1168511101 19:56974247-56974269 ATGCCTCTTTGTAAGCAAAATGG - Intergenic
928419487 2:31126861-31126883 ATGTCTCTCTGTCTATAAAAGGG + Intronic
932148763 2:69348839-69348861 TTGTCTCTCTGAGAGCCAAAGGG - Intronic
934942902 2:98515394-98515416 CTGTCACTGTGGCAGCAAATGGG - Intronic
935967311 2:108493607-108493629 ATGTCTTCCTGGAAGCAGAATGG - Intronic
938846222 2:135212143-135212165 ATGTCTTTCTTAGAGCAAAAAGG + Intronic
940406114 2:153304552-153304574 ATGTCTCACTGGTAGCATATTGG - Intergenic
941284599 2:163593789-163593811 TTGTTTCTCTTGCAGCAACATGG - Intronic
942620625 2:177841754-177841776 ATGGCTCTCTGGCTGAAAAATGG + Intronic
943012037 2:182461834-182461856 GTATCTCATTGGCAGCAAAAAGG + Intronic
943733394 2:191327271-191327293 ATGTCTCTGTGGCATAAACATGG + Intronic
943806021 2:192127205-192127227 ATGATTCTCTGTCAGCAAGAAGG + Intronic
944846547 2:203674151-203674173 ATCTCTCTCTGGCTGCCAGATGG + Intergenic
945019966 2:205560551-205560573 ATATCTCCCTGGAAGAAAAAAGG + Intronic
945638079 2:212384474-212384496 TTGTCTCTTTGGAAGCAGAATGG - Intronic
945818892 2:214638789-214638811 ATGTCTCTGAGGCTGTAAAATGG - Intergenic
947268589 2:228308045-228308067 TTGTCCCACTGGCAGGAAAATGG - Intergenic
1170195365 20:13683703-13683725 TTGTTTCTCAAGCAGCAAAATGG + Intergenic
1175733043 20:61367038-61367060 ATGGCTCTCTGTCAGCAATGGGG - Intronic
1177595508 21:23235883-23235905 ATGTCCCACTGTCAGCAAAATGG + Intergenic
1178480687 21:32977229-32977251 TTGTCTCTCTGGGTGGAAAAAGG + Intergenic
1178500042 21:33118209-33118231 AGGTGGCTCTGGCCGCAAAATGG - Intergenic
1179380509 21:40894845-40894867 CAGTCTCTCTAACAGCAAAAGGG - Intergenic
1182530081 22:30948652-30948674 AGGTCTTTCTGACTGCAAAATGG - Intronic
1182639136 22:31753030-31753052 AGGTCTCTCTGGCTTCAAGAGGG + Intergenic
1185214073 22:49588389-49588411 ATGTCTCCCAGGAAGCTAAACGG - Intronic
949386772 3:3511507-3511529 ATGTCACACAGGCAGAAAAATGG - Intergenic
950579909 3:13855310-13855332 CAGTCTCTCTGGCTGTAAAATGG + Intronic
952093836 3:29924323-29924345 ATCTATATCTAGCAGCAAAAGGG + Intronic
952113714 3:30154782-30154804 ATGGCTCTTTGGCAGCTCAAAGG + Intergenic
953182370 3:40608038-40608060 AGGTCTCTCTGGGAGCCTAAAGG + Intergenic
954160360 3:48717195-48717217 TTGTTTCTCTCGCACCAAAATGG + Exonic
954906132 3:54064603-54064625 ATGTTTGTCTGACAGAAAAAAGG - Intergenic
955500418 3:59577688-59577710 GTCTTTCTCTGGCAGCAGAAAGG - Intergenic
955595853 3:60589619-60589641 ATAACTCTGTGGAAGCAAAATGG + Intronic
955655651 3:61242389-61242411 AAGTCTCTCTGGTAGGGAAAGGG - Intronic
956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG + Intronic
956885795 3:73558517-73558539 CTGTGTCTCTTGCTGCAAAAGGG - Intronic
959371375 3:105530838-105530860 ATGTCTCTGCGGTAGCAAAATGG - Intronic
961566137 3:127764380-127764402 ATGTCTCCCTGCCTGCAGAATGG + Intronic
963994483 3:151692229-151692251 ATTGCTCTCTGGGAGCAAGATGG - Intergenic
965598341 3:170430203-170430225 CTTTTTCTCTGTCAGCAAAAGGG - Intronic
965845727 3:172959111-172959133 ATATCTTTCTGGAAGCAAACTGG - Intronic
966529945 3:180965712-180965734 ATGTTTCTGTGATAGCAAAAAGG - Intronic
966620634 3:181959817-181959839 ATTTCTCTCAGGCAGTAAAAAGG + Intergenic
971788510 4:31136592-31136614 GTGTCACTCTGGCCACAAAAAGG - Intronic
972154767 4:36145970-36145992 ATGTCTCTTTGGTGGCAAAGTGG - Intronic
972189318 4:36570851-36570873 CTGTCTCCCTGCCAGCAATAAGG + Intergenic
972215707 4:36895041-36895063 TTGTCCCACTGGCAGGAAAACGG + Intergenic
973290739 4:48467959-48467981 AGCTCTCTCTGGCAGCAACCTGG - Intergenic
973547655 4:51998023-51998045 ATGTCTCTATGGAGGCAATATGG + Intronic
974116804 4:57589051-57589073 ATTTCTGTCTGGTAGCAGAAGGG - Intergenic
974720484 4:65731707-65731729 ATGTGTTACTGGCATCAAAAGGG + Intergenic
975622625 4:76308930-76308952 ATGTATATCTGACAACAAAAGGG - Intronic
975961061 4:79905928-79905950 ATGTCTCTCTGTGAGCACAAAGG - Intronic
978124231 4:105116902-105116924 TTGTACCTCTGACAGCAAAAGGG - Intergenic
978540854 4:109815286-109815308 TTGCTTCTCTGGCTGCAAAATGG - Intergenic
980013397 4:127622132-127622154 ATGTCTTTCTGGCTGCCAAGTGG - Intergenic
982997914 4:162374715-162374737 ATCTCTCTCTGGAAGTAAAACGG + Intergenic
985146817 4:186902225-186902247 TTTTCTTTCTGGCAGGAAAAAGG + Intergenic
986111249 5:4720777-4720799 ATGTCTGTCAGGCATCCAAATGG - Intergenic
986312186 5:6559348-6559370 TTGTCTTTCTGGCAACAAGAAGG - Intergenic
986471889 5:8084086-8084108 ATGGGTCTCTAGCAGCAATATGG - Intergenic
987425528 5:17768486-17768508 ATCTGTCTATGGAAGCAAAAGGG - Intergenic
988950689 5:36256734-36256756 ATGTGTACCTGGCAGGAAAATGG - Intronic
989132352 5:38119846-38119868 GTGTATCTCTGAGAGCAAAATGG + Intergenic
990823640 5:59872616-59872638 ATGTTTCACTGTTAGCAAAAGGG - Intronic
991159828 5:63485146-63485168 ATGTTTCTTTAGCAGCAAAAAGG + Intergenic
993771662 5:91935746-91935768 AAGACCCTCTGCCAGCAAAAAGG - Intergenic
994060654 5:95472912-95472934 ATGTCCCCCTTGCAGCAACATGG - Intronic
994443383 5:99839073-99839095 ATCTCTCACTGGCATCAAGAAGG - Intergenic
994676841 5:102833911-102833933 ATGTGTTTGTGGAAGCAAAATGG + Intronic
995856175 5:116594625-116594647 ATGTCTATGTGGCATCTAAATGG - Intergenic
1000698205 5:164415760-164415782 TTGTCTCTTTTGCAGCAACATGG - Intergenic
1001609090 5:172985310-172985332 ATGTATCCCAGGGAGCAAAAGGG - Intronic
1002689259 5:181038829-181038851 ATGTCCCTAGGACAGCAAAAGGG - Intergenic
1004419956 6:15460358-15460380 AGTACTCACTGGCAGCAAAAAGG - Intronic
1006842407 6:37037757-37037779 ATGGGTCTCTGGCAGCAGGATGG - Intergenic
1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG + Intergenic
1008868763 6:56247343-56247365 ATGTCATTCTGGCAGCGAGAGGG + Intronic
1011310933 6:85978620-85978642 ATCTATCTCTGTGAGCAAAAGGG + Intergenic
1011651351 6:89509170-89509192 ATGTCTTGCTGGCAGCAAGTGGG + Intronic
1012418657 6:99037468-99037490 CTGCCTCACTGGCATCAAAAAGG + Intergenic
1015262744 6:131256974-131256996 ATGTCTATATGGTAGAAAAATGG + Intronic
1015957924 6:138617328-138617350 AGGTCTCTCTTGTAGCAAACAGG - Intronic
1017166010 6:151409081-151409103 GTGTCTGTCTTGCAGCCAAAGGG + Intronic
1019452884 7:1108607-1108629 ATGTGTCTCCGCCAGCTAAAAGG + Intronic
1020427898 7:8090757-8090779 ATGGCTATCTTGCAGCACAATGG + Intronic
1022965369 7:35466964-35466986 CTGCCTCTATGGCAGAAAAAAGG - Intergenic
1024354709 7:48402780-48402802 CCTTCTCTCTGGCTGCAAAATGG + Intronic
1026353732 7:69539613-69539635 ATTTCTCTCAGGCAGCAAGGAGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1031978599 7:128109455-128109477 ATGTCTCGCTGCCAGCATCAGGG + Intergenic
1032720748 7:134549267-134549289 CTGTCTCTCTGGGAGGGAAACGG + Intronic
1033142987 7:138844371-138844393 AGATCCCTCTGGCAGCAAATGGG + Exonic
1033393877 7:140955791-140955813 CTTTCTCTCTGTCAGCAATAAGG - Intergenic
1034720560 7:153288813-153288835 AAATCTCTATGGAAGCAAAATGG + Intergenic
1036684842 8:10902804-10902826 CTCTCTCTCTGCCAGCAACAGGG + Intronic
1036977304 8:13427981-13428003 TTGTCTCTCTGCAAGCAAACTGG - Intronic
1037481524 8:19310792-19310814 CTGTCTTTCTGGCAACAATAGGG + Intergenic
1038087834 8:24219498-24219520 AGACCTATCTGGCAGCAAAAAGG - Intergenic
1038382851 8:27113078-27113100 ATGCCACTCAGGCAGGAAAAAGG + Intergenic
1038447128 8:27611904-27611926 TTGTCTCTCTGGCATGACAAAGG - Intronic
1040383123 8:46892352-46892374 ATGTCTTTCTGGTAAAAAAAAGG - Intergenic
1042566650 8:70118208-70118230 ATATCTCTATGGGAGAAAAATGG - Intronic
1043476897 8:80614015-80614037 ATGTCTCACTGGAAATAAAATGG - Intergenic
1043886754 8:85609798-85609820 ATGTCTCTTTGGCATTGAAAAGG - Intergenic
1044246387 8:89951784-89951806 TTCTCACTCTGGCTGCAAAATGG + Intronic
1044455630 8:92389618-92389640 TTGTCTCCCTGGGTGCAAAAGGG - Intergenic
1046357305 8:113104927-113104949 ATGTCTCTTTGGAAGGTAAATGG - Intronic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1047564070 8:126022325-126022347 AAGACTTTCTGGTAGCAAAAAGG + Intergenic
1047747305 8:127854500-127854522 GTGTCTCTCTGGCATCAGAGAGG - Intergenic
1047861557 8:128972677-128972699 ATGTCACTCTGGCCTCAATAGGG - Intergenic
1049131568 8:140849268-140849290 CTTTCTCTCTGGCAGCAGAGGGG - Intronic
1049739402 8:144229702-144229724 ATGTCTCCATGCCAGCAATAAGG + Intronic
1051219269 9:14831490-14831512 TTGTCCCACTGGCAGGAAAATGG + Intronic
1051677271 9:19571058-19571080 ATGTCCCTCTGTCAGCCAGATGG + Intronic
1054711502 9:68515647-68515669 ATCTCTCTGTGTCAGCAAGAGGG - Intronic
1056483870 9:87034669-87034691 ATAGCTCTGTGGCAGGAAAAAGG + Intergenic
1060448846 9:123718051-123718073 ATGTCTGTCTGTCAGCAAATTGG + Intronic
1186736492 X:12470513-12470535 ATGTTTTTCTTTCAGCAAAAAGG + Intronic
1187317275 X:18207423-18207445 ATGTCTCAATGGAAACAAAATGG - Intronic
1187470349 X:19564078-19564100 CTGGCTCTCTGGCTCCAAAAGGG + Intronic
1187502460 X:19851117-19851139 ATGTTTCTCTTTCTGCAAAAGGG - Intronic
1188461577 X:30433021-30433043 ATGTCTTTCTGACATCAGAAAGG - Intergenic
1190162483 X:48043197-48043219 ATTCCTGTCTGGCAGCAGAAGGG + Intronic
1190844313 X:54177263-54177285 TCGTGTCTCTGGCAGCAATATGG + Intronic
1194997360 X:100605699-100605721 ATGGCTCTTTGGCAGGAATAGGG + Intergenic
1196044088 X:111238195-111238217 ATGTCTTTTTTGCAGCAACATGG - Intergenic
1197214373 X:123854494-123854516 CAGTCTTTCTGGCAGCAAAGAGG + Intergenic
1197973435 X:132139113-132139135 ATGTGTCTCTTACAGCAACATGG - Intergenic
1198039732 X:132838246-132838268 ATGACTCTCTGGCAGTAAAAGGG - Intronic
1199915563 X:152336413-152336435 ATGTTTGTCTGGCTGCCAAAAGG - Intronic
1201791647 Y:17847810-17847832 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1201799561 Y:17940395-17940417 ATGTTTTTCTGGCAGCAAAAAGG - Intergenic
1201801992 Y:17965561-17965583 ATGTTTTTCTGGCAGCAAAAAGG + Intergenic
1201809907 Y:18058179-18058201 ATGTTTTTCTAGCAGCAAAATGG + Intergenic
1202353256 Y:24017462-24017484 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1202361980 Y:24120216-24120238 ATGTTTTTCTGGCAGCAAAGAGG + Intergenic
1202363093 Y:24132880-24132902 ATGTTTTTCTGGCAGCAAAGAGG - Intergenic
1202507686 Y:25537237-25537259 ATGTTTTTCTGGCAGCAAAGAGG + Intergenic
1202508798 Y:25549897-25549919 ATGTTTTTCTGGCAGCAAAGAGG - Intergenic
1202517523 Y:25652653-25652675 ATGTTTTTCTAGCAGCAAAATGG + Intergenic