ID: 956143038

View in Genome Browser
Species Human (GRCh38)
Location 3:66164849-66164871
Sequence TAACTGGATCTGCCACAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956143035_956143038 -7 Left 956143035 3:66164833-66164855 CCAGTTATCATGGTGGTAACTGG 0: 1
1: 0
2: 5
3: 104
4: 1043
Right 956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 112
956143031_956143038 23 Left 956143031 3:66164803-66164825 CCTGCACAAAATCAGGGTTCTCT 0: 1
1: 1
2: 6
3: 38
4: 262
Right 956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 112
956143034_956143038 -6 Left 956143034 3:66164832-66164854 CCCAGTTATCATGGTGGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956143038 Original CRISPR TAACTGGATCTGCCACAGAA GGG Intronic
902219428 1:14955486-14955508 TAACTGCATCTGCCCCAGCTGGG - Intronic
903214675 1:21837143-21837165 TGAATGAATCTGCCACTGAACGG - Intronic
908123164 1:61004797-61004819 TAACTAGATCTGTCAGAAAAAGG + Intronic
908532899 1:65050456-65050478 GAAATGCATCTGACACAGAAAGG + Intergenic
913700845 1:121373173-121373195 TAACTGGAATTGCCACAGGAGGG - Intronic
914041395 1:144053640-144053662 TAACTGGAATTGCCACAGGAGGG - Intergenic
914136690 1:144906850-144906872 TAACTGGAATTGCCACAGGAGGG + Intronic
915018884 1:152761170-152761192 TAACTGGATGGGCCACAGTAGGG - Exonic
917783206 1:178422789-178422811 TAACTGGAAGTTCCACAGATTGG - Intronic
920488264 1:206391909-206391931 TAACTGGAATTGCCACAGGAGGG - Intronic
922669212 1:227495951-227495973 TACCTGAATCTCCTACAGAAAGG + Intergenic
922670384 1:227505351-227505373 TACCTGAATCTCCTACAGAAAGG - Intergenic
922800577 1:228362947-228362969 CATCTGAATCTGGCACAGAATGG + Intronic
922956349 1:229604526-229604548 GAACTGGAACTGCTACACAATGG + Intronic
923893334 1:238239506-238239528 TATCTAGCTCTCCCACAGAAAGG + Intergenic
923963710 1:239111935-239111957 TGAATGGATGTTCCACAGAAAGG - Intergenic
1068883300 10:62072861-62072883 TAATTGGTTCTACCAAAGAAGGG + Intronic
1068910608 10:62374702-62374724 TAAGTGACTCTGCCAGAGAAGGG - Intronic
1073520899 10:104128100-104128122 TAACTGGATCAGACACAGTATGG - Intergenic
1074323401 10:112424157-112424179 TCTCTGTATCTTCCACAGAAAGG - Intronic
1074610563 10:115017196-115017218 TAACTGCACCTGCCTCAGAGGGG - Intergenic
1077975681 11:7246159-7246181 AAGCTTGATGTGCCACAGAATGG + Intronic
1077997973 11:7470183-7470205 TAACTGGAACAGCTGCAGAATGG + Intergenic
1078579275 11:12525986-12526008 CAACTGGAACTGCCACAGCCTGG - Intronic
1080025141 11:27605347-27605369 TAGCTGTATCTGCCTCAGGAAGG - Intergenic
1089176226 11:116550837-116550859 CACCTGGATCTCCCACAGCAGGG - Intergenic
1089491013 11:118884156-118884178 TATCTGCTTCTTCCACAGAATGG - Intronic
1099211997 12:79802280-79802302 TTACTGAATATGCCACAAAATGG - Intronic
1101134685 12:101730275-101730297 TAACTGGATGTGACAGAGAAAGG + Intronic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1106865793 13:33962251-33962273 TTGATGGATCTGCCAAAGAAAGG + Intronic
1108078424 13:46707121-46707143 AAACTGGATCTTACACTGAAAGG - Intronic
1108488625 13:50955412-50955434 TAAGTGGCACTCCCACAGAAGGG - Intronic
1109088807 13:58011946-58011968 CAACAGCATCTGCCAAAGAATGG + Intergenic
1115015456 14:28606610-28606632 TAAATTTATCAGCCACAGAAAGG - Intergenic
1115462967 14:33682655-33682677 CCCCTGGAACTGCCACAGAAGGG + Intronic
1117288895 14:54313375-54313397 TAACTGGATGATCCAGAGAAGGG + Intergenic
1117973292 14:61273141-61273163 TAGTCTGATCTGCCACAGAAGGG - Intronic
1119265531 14:73261578-73261600 GCACTGGCTCTGCCTCAGAAGGG - Intronic
1119272575 14:73321901-73321923 TACCTGAATCTGTCATAGAAGGG - Intronic
1122328224 14:100895504-100895526 TAGGTGGATCTGCCGCCGAATGG + Intergenic
1122464754 14:101924231-101924253 TAACTGTATCTGCAATAAAAGGG - Intronic
1122724749 14:103742923-103742945 TTAATGGATCTGCATCAGAATGG - Intronic
1126757448 15:51938471-51938493 AGACAGGATTTGCCACAGAAGGG + Intronic
1129300980 15:74625331-74625353 TCAGTGTGTCTGCCACAGAAAGG - Intronic
1130312245 15:82765834-82765856 GCACTGGGTCTGCCACAGAGTGG + Intronic
1137916418 16:52435525-52435547 TAATTGGATATGACACAGCATGG - Intergenic
1149622707 17:58058161-58058183 TACCTGGATTTCCTACAGAAAGG - Intergenic
1155635817 18:27954269-27954291 TAACACAATCTACCACAGAAGGG - Intronic
1160313877 18:77822204-77822226 TCACTGAAGCTGCCACAGACGGG - Intergenic
1165989763 19:39803567-39803589 TAACTGAATATTCCACATAATGG + Intergenic
1166648772 19:44553996-44554018 TATCTGGATCTGCCACATTAAGG + Intergenic
925724656 2:6861347-6861369 TAAGTGAATCTGCCACTGACTGG + Exonic
930617334 2:53607242-53607264 CAACTGCATCAGCCACAGCAGGG + Intronic
933216780 2:79639298-79639320 TAACTGGAGCTTGCACACAATGG + Intronic
935842106 2:107124827-107124849 TTGGTGGATCTGCCACAGAGTGG - Intergenic
936486214 2:112928160-112928182 CAACTGGATCTGGCACAAACAGG - Intergenic
938183515 2:129206824-129206846 TAACTGGAATTGCTACATAATGG + Intergenic
941941707 2:171045905-171045927 TAACTGATTCAGACACAGAAGGG + Intronic
1169818218 20:9680740-9680762 TAACTGGGTCTGCTCCAGACCGG + Intronic
1173048000 20:39531040-39531062 GAACAAGATCTGGCACAGAATGG - Intergenic
1173352638 20:42259411-42259433 TAAAAGGATATGCCATAGAAGGG - Intronic
1173731016 20:45328660-45328682 GAACTCAATCTGCCACAGAAGGG - Intronic
1174660044 20:52204462-52204484 TAATTGTCTCTGCCACAGAAAGG + Intergenic
1175134080 20:56809937-56809959 GAACTGCATCTGCTACAAAAGGG - Intergenic
1175274065 20:57755409-57755431 TAACTGGAACAGTCACATAAGGG - Intergenic
1180411499 22:12614235-12614257 TAACTGGATATGCCATATTAAGG - Intergenic
1183572170 22:38661812-38661834 TAACTGGATCTGACAAGAAATGG - Intronic
950315044 3:11994743-11994765 AAACTGAATCTGACACAGCAGGG + Intergenic
952017461 3:28974998-28975020 TAACTAGATCTTCAAGAGAATGG - Intergenic
955776581 3:62440268-62440290 TTACTGGATCTCCCACAAATTGG + Intronic
956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG + Intronic
959344930 3:105182073-105182095 TAATTCAATCTGCCACTGAATGG - Intergenic
960500445 3:118431304-118431326 TAAATGGATGACCCACAGAATGG - Intergenic
961643779 3:128381637-128381659 TTCCTGGAGCTTCCACAGAAGGG + Intronic
964898651 3:161629598-161629620 AAACTGGTTTTGCCACAGATAGG - Intergenic
968979134 4:3837275-3837297 TAATGGGAGGTGCCACAGAAAGG - Intergenic
971243258 4:24907530-24907552 TCACAGGATCTGCTAGAGAAGGG + Intronic
972950198 4:44312322-44312344 TAATTGCATCTGCAATAGAAAGG + Intronic
973590599 4:52437020-52437042 TAACAGGAGCTTGCACAGAAAGG + Intergenic
974875587 4:67700033-67700055 TAACTAGCTCTGCCACTTAATGG + Intronic
980639394 4:135555922-135555944 TAACTGGGCCTGCAACAGATTGG - Intergenic
982306413 4:153936160-153936182 TAACTGTAGCTGCCATAGCAGGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985957059 5:3273733-3273755 CAAATGCATCTGCCTCAGAAGGG - Intergenic
986519075 5:8594518-8594540 TAAGTGGAGCTGCCCCAGAAAGG - Intergenic
987061139 5:14245175-14245197 CAAATGGATATACCACAGAACGG - Intronic
992728999 5:79639242-79639264 TAACTGTATTTGCTAGAGAAAGG + Intronic
993152994 5:84184294-84184316 TAAATGGATCTGCGAAATAAAGG + Intronic
1000368155 5:160510152-160510174 AAACTGGGACTGCCAGAGAAAGG - Intergenic
1001400659 5:171444548-171444570 TACCTAGATCTGGCCCAGAAGGG + Intronic
1001654865 5:173341514-173341536 TCATGGGATCTGCCAGAGAATGG - Intergenic
1003992450 6:11499454-11499476 TAGCTGGGTCTGGCACAGAGTGG - Intergenic
1007760448 6:44130233-44130255 TATCTGGGTCTACCACAGACTGG + Intronic
1008872305 6:56287148-56287170 GAACTTGATCTGCCACTAAATGG + Intronic
1009495540 6:64341828-64341850 GAACTCAATCTGCAACAGAATGG + Intronic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1012114389 6:95276981-95277003 TAACTGGAGCACACACAGAAAGG - Intergenic
1012707744 6:102554297-102554319 TAACTGGTTCGGCAAGAGAATGG + Intergenic
1013578606 6:111510043-111510065 CAACTGGAGTTCCCACAGAATGG + Intergenic
1015924313 6:138294083-138294105 CAACTGTATCTGTAACAGAATGG - Exonic
1017263198 6:152412100-152412122 TAGCTGGATATTCCACTGAATGG - Intronic
1019645186 7:2125118-2125140 ACACAGGACCTGCCACAGAAAGG + Intronic
1022136648 7:27455708-27455730 ACACTGTATCAGCCACAGAATGG - Intergenic
1024699165 7:51888332-51888354 TAACTTAATCTACTACAGAAAGG - Intergenic
1026390140 7:69892513-69892535 TAAATAGATAAGCCACAGAATGG - Intronic
1031618767 7:123910852-123910874 TAATGGGATCTGAAACAGAAAGG - Intergenic
1032459939 7:132102937-132102959 TAGCTGGCTATGCCTCAGAAAGG - Intergenic
1033289860 7:140074447-140074469 AAACTGGACCTGAAACAGAAAGG - Intergenic
1034035129 7:147811676-147811698 TAAATGGATCTGTCAAAGGATGG - Intronic
1036568419 8:9958054-9958076 TAACTGGAGCTGTCAAACAATGG - Intergenic
1038106193 8:24437493-24437515 CAACTGGATTTGCTAAAGAATGG + Intergenic
1039829270 8:41200074-41200096 TAACTGCATCTCACTCAGAAGGG + Intergenic
1051612250 9:18972629-18972651 GAACCAGATCAGCCACAGAAGGG + Intronic
1058140594 9:101353456-101353478 TATCTGGATCAGCCACAGTGAGG + Intergenic
1059501387 9:114756940-114756962 CAGCTGGATCTGCCACACCAGGG + Intergenic
1060154754 9:121311793-121311815 CAACTGAATCTTCCACAGCAAGG - Intronic
1060776567 9:126378975-126378997 TATCTGGAAGTGCCACAGAGGGG - Intronic
1062058838 9:134483693-134483715 AAACTGGACCTGCCACAGCGCGG + Intergenic
1186580893 X:10817095-10817117 TATCTGGCACTTCCACAGAAAGG + Intronic
1188904377 X:35774506-35774528 TCAATGGATTTGCCCCAGAAAGG - Intergenic
1191077354 X:56469186-56469208 AAACGGGAACTGCTACAGAAAGG - Intergenic
1194299355 X:92165820-92165842 TAAATGAATCTGCCATAGGAGGG + Intronic
1194620219 X:96162021-96162043 CATCTGGATCTGCCACCGAAGGG + Intergenic
1195569209 X:106380310-106380332 TAACTGGCTCTGCCCCAGTAAGG + Intergenic
1200616960 Y:5390654-5390676 TAAATGAATCTGCCATAGGAGGG + Intronic