ID: 956146362

View in Genome Browser
Species Human (GRCh38)
Location 3:66194967-66194989
Sequence CACCCACTCCTCCCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 280}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956146355_956146362 -9 Left 956146355 3:66194953-66194975 CCCACCCAGCCACTCACCCACTC 0: 1
1: 2
2: 75
3: 626
4: 2555
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280
956146353_956146362 0 Left 956146353 3:66194944-66194966 CCTGGGGTCCCCACCCAGCCACT 0: 1
1: 0
2: 5
3: 48
4: 482
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280
956146351_956146362 12 Left 956146351 3:66194932-66194954 CCCTGTGGTCTACCTGGGGTCCC 0: 1
1: 0
2: 2
3: 15
4: 166
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280
956146356_956146362 -10 Left 956146356 3:66194954-66194976 CCACCCAGCCACTCACCCACTCC 0: 1
1: 1
2: 11
3: 310
4: 2335
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280
956146352_956146362 11 Left 956146352 3:66194933-66194955 CCTGTGGTCTACCTGGGGTCCCC 0: 1
1: 0
2: 2
3: 22
4: 153
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280
956146354_956146362 -8 Left 956146354 3:66194952-66194974 CCCCACCCAGCCACTCACCCACT 0: 1
1: 0
2: 23
3: 237
4: 1525
Right 956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956146362 Original CRISPR CACCCACTCCTCCCCTTGGT GGG Intronic
901027486 1:6286283-6286305 CATCCACACCTCTCCTAGGTGGG - Intronic
901326865 1:8371870-8371892 CACCCACTTGGCCCCTGGGTCGG - Intronic
902261278 1:15226597-15226619 CATCCACTCCTCTTCATGGTGGG - Intergenic
902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG + Intronic
903778086 1:25805936-25805958 CACTCTCTCCTCCCCTCTGTGGG + Intronic
904576949 1:31511051-31511073 CACCCACTCCTCCAAATGGATGG - Intergenic
904738228 1:32651338-32651360 CACCCACTGCCCTCCTGGGTCGG - Intronic
905519818 1:38589178-38589200 CACCCACCCCTCCCACCGGTGGG + Intergenic
906858199 1:49330984-49331006 CACTCACTGCTTCCCTTGGCTGG - Intronic
907385554 1:54123114-54123136 CACCCACTCCTCCTCTGATTTGG - Intergenic
910240966 1:85085662-85085684 CACCCGCTCCTCCTCTTTGGAGG - Intronic
910645334 1:89508357-89508379 CTCCCATTCTTCCGCTTGGTTGG - Intergenic
911329884 1:96514847-96514869 CTCCCACTTCTCCTCTTGGAGGG + Intergenic
913210609 1:116579468-116579490 CAGCCACTCCTCCACATGGCAGG + Exonic
913309450 1:117473649-117473671 CAGCCACTACTCCCTTTGCTTGG + Intronic
917289655 1:173459998-173460020 CACTCACTGCTTCCCTTGGCTGG - Intergenic
917296296 1:173522839-173522861 CACCCACTACTCCCTTTGCCTGG + Intronic
917305137 1:173616944-173616966 CACTCACTGCTTCCCTTGGCTGG - Intronic
920108228 1:203569461-203569483 CATACGCTCTTCCCCTTGGTTGG + Intergenic
921580365 1:216889427-216889449 CACCCACTTCTGACCTTGCTGGG + Intronic
921741318 1:218688135-218688157 TAACCACTCCTCCCATGGGTAGG - Intergenic
924404904 1:243732376-243732398 CACCATCTCTTCCCTTTGGTAGG - Intronic
1062868202 10:875714-875736 CATCCACTCCTCCACTTGTGAGG + Intronic
1064600370 10:16986409-16986431 CACACACTCCTCCCCAAAGTAGG - Intronic
1064746604 10:18484548-18484570 CACTCTCTTCTTCCCTTGGTTGG - Intronic
1065060811 10:21899059-21899081 CACTCACTGCTTCCCTTGGCTGG - Intronic
1067757125 10:49013670-49013692 CTCCCAATCCTCCCCTTTGTGGG - Intergenic
1069772475 10:70908379-70908401 CACCCACTCGCCCCATTGTTTGG + Intergenic
1070857691 10:79620254-79620276 CACACACCCCTTCCCTTGGCTGG + Intergenic
1072443412 10:95477318-95477340 CACCCAGCCCTGCCCTGGGTGGG + Intronic
1073105952 10:101032177-101032199 CAGCCCCTCCTCCCTTTGGCTGG + Intronic
1073604430 10:104879810-104879832 GACCCACGCTTCCCCTTGATGGG + Intronic
1077020474 11:415057-415079 CACCCACCCCTTCCCTAGGCGGG + Intronic
1077113576 11:872840-872862 CACACACTCCTCCTCCTGGGGGG + Intronic
1077996004 11:7453264-7453286 TACCCACTCCTCCCCATAGTGGG - Intronic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1081627783 11:44665860-44665882 TCCCCACTCCTTCCCTTGGTTGG + Intergenic
1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG + Intronic
1083228557 11:61300349-61300371 AACCCACGCCTCCCCCTGGGTGG + Intronic
1083516462 11:63263417-63263439 CACTCACTCCCTCCCTTGGCTGG + Intronic
1085409220 11:76281708-76281730 TGCCCACACCTCCCCTAGGTGGG + Intergenic
1087354289 11:97074457-97074479 CACTCACTGCTTCCCTTGGCTGG + Intergenic
1087881232 11:103418753-103418775 CACTCACTGCTTCCCTTGGCTGG - Intronic
1091304915 11:134530721-134530743 CCCCAACTACTCCCCTTGCTGGG + Intergenic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1092040347 12:5378713-5378735 AACCCACTCTTCCCCCAGGTAGG - Intergenic
1092578918 12:9819022-9819044 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1096614251 12:52822839-52822861 CCATCACTCCTCTCCTTGGTTGG - Intronic
1096788825 12:54032836-54032858 CACTCCCTCTCCCCCTTGGTTGG + Exonic
1097064511 12:56311058-56311080 CACCCATTTCTCCCTTGGGTTGG - Intronic
1097358440 12:58629547-58629569 CTCCCACTTCTACCCTTGATTGG - Intronic
1097679880 12:62638644-62638666 CAGCCACTCCTGCCCTTATTTGG - Intergenic
1098520679 12:71432028-71432050 CACCCACCCCTACCCTTGCCAGG - Intronic
1100186726 12:92146572-92146594 CCCCTACTCCTCCCCTAGGGTGG - Intergenic
1101736356 12:107466204-107466226 GACCCACTCTTTCCCTTGCTTGG - Intronic
1101892637 12:108730947-108730969 CACCCACTCGTTCCCTGGGGCGG + Intronic
1103506349 12:121444154-121444176 CACTCACTCCTCCGCTTGGCAGG + Exonic
1104469959 12:129022023-129022045 CCCCCCCTCCCCGCCTTGGTGGG + Intergenic
1105335145 13:19460274-19460296 CACTCACTGCTTCCCTTGGCTGG + Intronic
1105859772 13:24399112-24399134 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1106425441 13:29624777-29624799 CACTCACTACTTCCCTTGGCTGG - Intergenic
1108629682 13:52269335-52269357 CACTCACTGCTTCCCTTGGCTGG + Intergenic
1108656375 13:52537153-52537175 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1110632875 13:77729941-77729963 CACCTCCTCCTCCCGTTGGATGG - Intronic
1117503192 14:56374592-56374614 CACTCACTGCTTCCCTTGGCTGG + Intergenic
1117829040 14:59732524-59732546 CACTCACTGCTTCCCTTGGCTGG - Intronic
1119536791 14:75409305-75409327 CCCCCACTCCACCACTTGGTAGG - Intergenic
1119688773 14:76654328-76654350 CACCACCTCCTCCCCTTTGGGGG + Intergenic
1121704627 14:95982264-95982286 TCCCCTCCCCTCCCCTTGGTTGG + Intergenic
1122983095 14:105200352-105200374 ACCACACCCCTCCCCTTGGTGGG + Intergenic
1126398233 15:48242216-48242238 CAGCCACACCTCCTCCTGGTTGG + Intronic
1127099728 15:55552583-55552605 CACTCACTGCTTCCCTTGGCTGG - Intronic
1127673718 15:61220489-61220511 CAGCCACTCCTCCCCATGACTGG + Intronic
1129001755 15:72341404-72341426 CAACCTCTCCTCTCCTTGGTAGG - Exonic
1129272037 15:74424093-74424115 CACCCACAGCTGACCTTGGTGGG - Intronic
1130261286 15:82355743-82355765 GACTCACTCCTCCCCTGGGGCGG + Intergenic
1130279949 15:82513275-82513297 GACTCACTCCTCCCCTGGGGCGG - Intergenic
1130326938 15:82888943-82888965 CATCCACTCCTTCCCTGGGGAGG + Intronic
1130371066 15:83285274-83285296 CACACACCCCTTCCCTTGGGTGG + Intergenic
1130471324 15:84229461-84229483 GACTCACTCCTCCCCTGGGGCGG - Intergenic
1130478818 15:84344032-84344054 GACTCACTCCTCCCCTGGGGCGG - Intergenic
1130492952 15:84444099-84444121 GACTCACTCCTCCCCTGGGGCGG + Intergenic
1130593618 15:85234088-85234110 GACTCACTCCTCCCCTGGGGCGG - Intergenic
1131359749 15:91780208-91780230 CACCTCATCTTCCCCTTGGTAGG - Intergenic
1132712609 16:1276280-1276302 CACTCCCACCTCCCCTTGGTGGG + Intergenic
1132951177 16:2563259-2563281 CACCATCTCCTCTCCTCGGTGGG - Intronic
1132963173 16:2636911-2636933 CACCATCTCCTCTCCTCGGTGGG + Intergenic
1133013835 16:2929828-2929850 CACCCCATCCTCATCTTGGTCGG - Exonic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133209717 16:4256780-4256802 CATCCTCTCCTCCCCTAGGAGGG - Intergenic
1135340775 16:21646082-21646104 CAGCAACTCCTCGCCTTGTTGGG - Intronic
1135652981 16:24223085-24223107 CTCCAACTCATCTCCTTGGTGGG - Intergenic
1138099060 16:54237169-54237191 CACACTCTCCTCCTCTTCGTGGG - Intergenic
1138261411 16:55626004-55626026 CACCCACTTTGCCCCTTAGTGGG + Intergenic
1139663231 16:68436382-68436404 TATTCACTCCTCCCCCTGGTAGG + Intronic
1140479150 16:75253227-75253249 CACCCACTCCTCAGCCTGGCTGG + Intronic
1141558667 16:84852699-84852721 CACCCACCCCACCCCTTGTCGGG - Intronic
1142108438 16:88318545-88318567 ACCCCACTCCTGCCCTTGGCAGG - Intergenic
1142135892 16:88451944-88451966 CCCCCACTTCTCCCCTTCCTTGG + Intergenic
1142481648 17:222463-222485 CATCCTCACCTCCCCTTGCTGGG - Intronic
1144965283 17:19073427-19073449 CACCCTCTCCAGCCCTTGTTGGG + Intergenic
1144982684 17:19178756-19178778 CACCCTCTCCAGCCCTTGTTGGG - Intergenic
1144985539 17:19199483-19199505 CACCCTCTCCAGCCCTTGTTGGG + Intergenic
1145921597 17:28614042-28614064 CTCCCTCTCCTCCCCTCAGTAGG + Intronic
1146854525 17:36251944-36251966 CCCCCACACCTCCCCTCGGCCGG + Intronic
1146866094 17:36336432-36336454 CCCCCACACCTCCCCTCGGCCGG - Intronic
1146877783 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147073309 17:37976460-37976482 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147080488 17:38016581-38016603 CCCCCACACCTCCCCTCGGCCGG - Intronic
1147084830 17:38055998-38056020 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147100778 17:38179964-38179986 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1148441532 17:47714037-47714059 CACACACCCCTCCCCTTGTTAGG - Intergenic
1150083711 17:62263011-62263033 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1151676528 17:75601631-75601653 CACCCACTCCTCTCCGCTGTCGG - Intergenic
1151811028 17:76442002-76442024 CACCCAGTCCTCACCTTAGGAGG - Intronic
1152020643 17:77778641-77778663 CACCCACTCCTCCCCACAGCAGG - Intergenic
1152228306 17:79102698-79102720 GCCCCACTCCACCCCTTGTTTGG - Intronic
1153460201 18:5324912-5324934 CACTCACCACTCCCCTTGGTTGG - Intergenic
1153683948 18:7526806-7526828 CACTAACTCCTCCCCTTGAGAGG + Intergenic
1153858537 18:9174576-9174598 CACTCACTGCTTCCCTTGGCTGG + Intronic
1154410732 18:14140843-14140865 CTCCCACTCCTGCCCTCTGTGGG + Intergenic
1157067947 18:44373975-44373997 CACTCACCACTTCCCTTGGTTGG + Intergenic
1161485571 19:4533907-4533929 GCCCCACTCCTCTCCTTGCTGGG - Intronic
1161822000 19:6535216-6535238 CACCCACTCCTTCCCCAAGTTGG + Exonic
1162481083 19:10927557-10927579 CAGCCACTCTTCCCCTGGGCAGG - Intronic
1163321456 19:16577267-16577289 CTCCCACTGATCCCGTTGGTGGG + Exonic
1163772025 19:19197065-19197087 CTCCTACTCCTCTCCTTGTTGGG - Intronic
1163886251 19:19967247-19967269 CACTCACTGCCCCCCTTGGCTGG + Intergenic
1164686326 19:30168913-30168935 CTCCCACTCCACCCCTAGCTGGG + Intergenic
1165485537 19:36093242-36093264 TACCCACCCCTCCCCTTGGCTGG - Intronic
1166302949 19:41922484-41922506 CACCCACTTCTCCCCATTTTTGG - Intronic
1166588037 19:43968797-43968819 CACTCACTGCTTCCCTTGGGTGG - Intronic
1166678097 19:44751395-44751417 CAACCACCCCTCCCCTTAATAGG - Intronic
1167437809 19:49490050-49490072 CAGCCACTCTTCCCCAGGGTTGG + Intronic
1167439722 19:49501050-49501072 CACCCACTCCACCCTATGCTGGG + Intergenic
1167524865 19:49977361-49977383 CACTCACTCAGCCCCTTGGTTGG - Intronic
1168716601 19:58532096-58532118 AACCCACTCCTGGACTTGGTGGG - Intronic
928169680 2:28995233-28995255 CTCCCACTACCCCACTTGGTTGG - Intronic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
931341282 2:61403660-61403682 CACTCACTCCTGCTCTGGGTGGG - Intronic
931731409 2:65156785-65156807 CTCCCTCTCCTCCCTTTTGTTGG - Intergenic
932055253 2:68436968-68436990 AACCCACTCCTCCCAATGGCAGG - Intergenic
932379451 2:71269243-71269265 CACTCACTACTTCCCTTGGCTGG - Intergenic
932856171 2:75236080-75236102 TACCCACCCCTCCCCTTTTTAGG + Intergenic
933764469 2:85697405-85697427 CACCCAGTACTCCCATTGCTAGG + Intronic
934721189 2:96578032-96578054 CACCCCCTCCTCCCCCAAGTAGG - Intergenic
935187602 2:100748138-100748160 CACCCTCTCCTCCCCCTGCCTGG - Intergenic
935344236 2:102090214-102090236 CACCCAAAACTCCCCATGGTAGG - Intronic
935596190 2:104879767-104879789 CACCCCCTGCACCTCTTGGTAGG - Intergenic
936746227 2:115579971-115579993 CCCCCACTCCACCCCCTGGCAGG + Intronic
936929427 2:117772203-117772225 CACCCTCTCTTACTCTTGGTGGG - Intergenic
937155587 2:119716538-119716560 CACCCATTTCTCCCCTGGCTGGG - Intergenic
938101136 2:128498917-128498939 CACCCTCGCCTCCCCTTTCTGGG - Intergenic
941694452 2:168535419-168535441 CACTTACTGCTTCCCTTGGTTGG + Intronic
942077940 2:172374176-172374198 AACCACCTTCTCCCCTTGGTTGG - Intergenic
943612179 2:190046016-190046038 CACTCACTGCTTCCCTTGGTGGG + Intronic
944167980 2:196743310-196743332 CACTCACTGCTTCCCTTGGCTGG + Intronic
944535158 2:200701972-200701994 CACCCATGCCTCTCCTTGTTGGG - Intergenic
946842884 2:223836156-223836178 CACCCACTCCTGCCTCCGGTGGG + Intronic
947613639 2:231540042-231540064 CCCTGTCTCCTCCCCTTGGTGGG - Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948156633 2:235788573-235788595 CTCCCACTCCTCTCCTTGCCCGG - Intronic
948518767 2:238522680-238522702 CGCCCATTCCTCCCTCTGGTGGG + Intergenic
949055758 2:241927599-241927621 CTCCCACTCCTCACAGTGGTGGG + Intergenic
1171282274 20:23910819-23910841 CACTCACCCCTTCCCTGGGTGGG + Intergenic
1173145400 20:40520154-40520176 CAGAGACTCCTCCCTTTGGTTGG - Intergenic
1175155302 20:56967353-56967375 CAGCCTCTCCTCCCCTAGGCAGG + Intergenic
1175606693 20:60317112-60317134 CACCCACCCCACCCCTAAGTTGG + Intergenic
1176738432 21:10574712-10574734 CACTCACTGCTTCCCTTGGCTGG - Intronic
1176862331 21:14017575-14017597 CTCCCACTCCTGCCCTCTGTGGG - Intergenic
1179818271 21:43921903-43921925 CACTCACCCCACACCTTGGTGGG - Intronic
1179983906 21:44910745-44910767 CCCCCACTGCTCGCCCTGGTGGG - Exonic
1180934903 22:19619027-19619049 CACTCCTTCCTCCCCGTGGTGGG + Intergenic
1182125926 22:27815819-27815841 CAGCCCTTCCTCCCCTTGGGAGG + Intergenic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183334297 22:37237827-37237849 CTGCCACTCCTCCTCTTGGATGG - Intronic
1184894481 22:47399253-47399275 GCCACACTTCTCCCCTTGGTGGG - Intergenic
1185367517 22:50443723-50443745 CTCTCACTCCTGCCCTTTGTGGG - Intronic
949558528 3:5181445-5181467 CACACACTCACCCCCTTGGTAGG - Intergenic
949954523 3:9256669-9256691 CATCCACTCCTCCCCAGGGGAGG + Intronic
950467443 3:13163602-13163624 CACCCCCACCTACCCTCGGTTGG + Intergenic
950615220 3:14152657-14152679 CCACCACTCCTCCCCTTCATAGG + Intronic
950967409 3:17155800-17155822 CACTCACCCCTGGCCTTGGTAGG + Intergenic
953390201 3:42529576-42529598 CCCCCACCACTCCCTTTGGTTGG - Intronic
953635161 3:44657196-44657218 CACCCACTCATATCATTGGTTGG + Intronic
955767532 3:62360462-62360484 CTTCCACTCCTCCCCATGGGTGG - Intergenic
955857545 3:63289569-63289591 CACACACCCCTCCCCTAGGGAGG + Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
958759729 3:98292456-98292478 CACTCCCTGCTTCCCTTGGTTGG + Intergenic
959205727 3:103304106-103304128 CACTCACTCCTCCCTTGGCTTGG + Intergenic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963981486 3:151543232-151543254 GACCCACTCCTCCCCTTGGACGG - Intergenic
964395760 3:156243984-156244006 CACCCACTATTCCACTTGGGTGG + Intronic
965839459 3:172887187-172887209 CAGCCACTCCTCTGCTTGGGAGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968793809 4:2688515-2688537 CACACAGGCCTCCCCTTGGCCGG - Intronic
969202276 4:5615757-5615779 CTCCCTCTGCTCCCTTTGGTGGG - Intronic
969952765 4:10854666-10854688 CACTCACTGCTTCCCTTGGCTGG + Intergenic
970485479 4:16520761-16520783 CAAGCACTTCTCCCCTGGGTGGG - Intronic
975031921 4:69631639-69631661 TACACACTCCTCTCCTTGCTTGG - Intronic
975228200 4:71899342-71899364 CACCCACTCCTCCCAATGCACGG - Intergenic
976395412 4:84550155-84550177 CACTCACTGCTTCCCTTGGTGGG - Intergenic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
982397359 4:154926481-154926503 CACTCACTGCTTCCTTTGGTTGG + Intergenic
984019801 4:174471385-174471407 CTCCCCCTGCTCCCCTTGGCAGG + Intergenic
987380030 5:17276095-17276117 CACCCCCTCCCTCCCTTGATGGG - Exonic
990502087 5:56407114-56407136 CAGTCACTCCTCTCTTTGGTTGG + Intergenic
991135463 5:63176868-63176890 CACTCACTGCTTCCCTGGGTAGG + Intergenic
991298094 5:65102654-65102676 CACGGATTCCTCCCCATGGTGGG - Intergenic
993376085 5:87150563-87150585 CACTCACTGCTTCCCTTGGCTGG + Intergenic
995039019 5:107567559-107567581 CACCCACCCCTGCCCCAGGTTGG + Intronic
995579077 5:113574951-113574973 CACTCACTGCTTCCCTTGGCTGG + Intronic
995694769 5:114866639-114866661 CACTCACTGCTTCCCTTGTTTGG - Intergenic
997096857 5:130923493-130923515 CACTCACTGCCTCCCTTGGTTGG - Intergenic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
997463429 5:134071209-134071231 CACCCTCCCCTTCCCTTGGAAGG + Intergenic
998761338 5:145435351-145435373 CACTCACTCCTCCCACTGTTTGG - Intergenic
999197368 5:149791549-149791571 CACACACTCTTCCCATAGGTTGG - Intronic
999241724 5:150131878-150131900 CTCCCACTCCTCCCATGGGTGGG + Intronic
1001274340 5:170339379-170339401 CACACTCTGCTCCCCTTGCTGGG + Intergenic
1001770624 5:174293292-174293314 CCCCCACCCCTCCCCTAGGGAGG - Intergenic
1002352122 5:178590433-178590455 CGGCCGCTCCTCCCCTGGGTGGG - Exonic
1002594923 5:180315859-180315881 CCCCCACACCTCCCCCTGCTGGG + Intronic
1003968999 6:11280477-11280499 CACCCAGTCCTCCCCATGGTGGG - Intronic
1003972713 6:11314387-11314409 CACCCACTCCTTTCTTTGGAAGG - Intronic
1005135966 6:22570069-22570091 CTCCGCCTCCTCCTCTTGGTCGG - Exonic
1005885029 6:30091176-30091198 CACCAACTCCAACCCCTGGTAGG - Intergenic
1005972048 6:30769229-30769251 CACCCACTCTGCCACTTGGCCGG - Intergenic
1006197667 6:32255753-32255775 CACTCACTTCTTCCCTTGGCTGG + Intergenic
1006440026 6:34048227-34048249 CCCCCACTCAGCCCCTTGCTGGG + Intronic
1006626965 6:35404509-35404531 TCCCCACTCATCCCCTGGGTAGG + Intronic
1007215484 6:40234408-40234430 CACTCACTGCTTCCCTGGGTAGG - Intergenic
1008033105 6:46719140-46719162 CACCCATTCCTTCCATTGGATGG + Intronic
1012867431 6:104634859-104634881 CTCCCACCACTGCCCTTGGTGGG + Intergenic
1013164976 6:107581483-107581505 CAGCCACTCCTGCCTCTGGTGGG - Intronic
1013465217 6:110412010-110412032 CTCCCAATCCTCCCACTGGTGGG - Intronic
1015488763 6:133801001-133801023 CACTCACTGCTTCCCTGGGTAGG + Intergenic
1017071649 6:150580346-150580368 CACCCACCCCTCCTCTTGCCTGG + Intergenic
1019164834 6:170091261-170091283 CATACACTGCTCCCCTTGGAAGG - Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019408013 7:893994-894016 CACCCACTCCAGCCCTGGGTCGG + Intronic
1019746832 7:2705530-2705552 AATCCACTCCTCCCCATCGTGGG + Intronic
1020013964 7:4820509-4820531 CAACCCCTCCTGGCCTTGGTGGG - Intronic
1022357705 7:29631357-29631379 CACCCACTCCTCCCTCTCATAGG + Intergenic
1022368024 7:29744312-29744334 CACCCACTCCTCCCTCTCATAGG + Intergenic
1022427279 7:30281413-30281435 CACCCATTAGTCCTCTTGGTCGG - Intergenic
1023627997 7:42135957-42135979 CACCACCTCCTCCCCTGGGTGGG + Intronic
1023631537 7:42169588-42169610 GGCCCAATCCTCCCCTTGCTGGG + Intronic
1023835517 7:44065194-44065216 CACCTGCTCCTCCCCGTGCTTGG + Exonic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1027708232 7:81562809-81562831 TTTCCACTCCTCCCCTTGGATGG - Intergenic
1028027608 7:85866486-85866508 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1032353196 7:131185048-131185070 CACCCTCTCCTCCTCTCGGGTGG - Intronic
1032700476 7:134374386-134374408 CACCCACTCCACCCACTGTTTGG - Intergenic
1033977318 7:147117365-147117387 CACTCACTGCTTCCCTTGGCAGG + Intronic
1034150278 7:148909952-148909974 AACTCACTCCTCCCTTTGGGTGG + Intergenic
1034541516 7:151761499-151761521 CACTGACTCCTCCTCTGGGTGGG - Intronic
1035392631 7:158515574-158515596 CACCCACTGCTCCCAATGGGAGG + Intronic
1036786246 8:11689684-11689706 CACCCACCCCCACCCTTGGCTGG + Intronic
1037438371 8:18888827-18888849 CACTCTTTCCTCCCCTTGGAAGG - Intronic
1037904001 8:22704747-22704769 CAGCCCCTCTTCCCCTGGGTGGG + Intergenic
1038040758 8:23722414-23722436 CAACCACTCCTTCTCTGGGTGGG + Intergenic
1038050591 8:23806668-23806690 CACCCACTCCTCCTCTAAATTGG + Intergenic
1039468959 8:37802027-37802049 CAGCCTCTTCTCCCCTAGGTGGG - Intronic
1041621006 8:59969424-59969446 CAGTCACTCCTCTCCATGGTAGG + Intergenic
1042108768 8:65356627-65356649 CACCCACCACTTCCCTGGGTTGG + Intergenic
1042271442 8:66961072-66961094 CCCCCATTTCTCACCTTGGTAGG + Intronic
1042489369 8:69380760-69380782 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1045020441 8:98038790-98038812 CCCCCACTCCTCCCTTTTCTGGG - Intronic
1045705385 8:104916537-104916559 CACTCACTGCTTCCCTTGGCTGG + Intronic
1047254054 8:123202232-123202254 CCCCCACTCCTCCACTGTGTTGG + Intronic
1048799986 8:138186439-138186461 CCCCCACTCCTGCCAGTGGTGGG - Intronic
1049150269 8:141030616-141030638 CACCCTCTCCTCCCCTGGCATGG + Intergenic
1051913776 9:22184577-22184599 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1056180266 9:84076128-84076150 GAACCACTCATCCCATTGGTTGG + Intergenic
1056331316 9:85523337-85523359 CACCCACACCTGCCCTGGGAGGG - Intergenic
1057007128 9:91570136-91570158 CACCCACTCCACCCGTTTGTGGG - Intronic
1058513984 9:105751301-105751323 CACTCACTGCTTCCCTTGGCTGG - Intronic
1059503277 9:114775152-114775174 CCCCCACCCCTCCCCTTGGTGGG + Intergenic
1060528306 9:124332903-124332925 CACCGCCCCCTCCTCTTGGTGGG - Intronic
1061195224 9:129103620-129103642 CAGCCACTGGTCCCCATGGTGGG - Intronic
1061208977 9:129179744-129179766 CACCTACTTCATCCCTTGGTGGG + Intergenic
1061838888 9:133346502-133346524 CAGACTCTGCTCCCCTTGGTGGG + Intronic
1062427589 9:136513007-136513029 CACCCACCCCTCACCTGTGTAGG + Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1185536439 X:864988-865010 AACCCACTTTCCCCCTTGGTTGG + Intergenic
1185934198 X:4237210-4237232 CACCCACTCTGCTCCTTGGAGGG - Intergenic
1186593147 X:10952795-10952817 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1187818111 X:23255709-23255731 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1188884254 X:35530993-35531015 CACTCACTCCTTCCCTTGGCTGG - Intergenic
1188906930 X:35801066-35801088 CACCCACTCCTCCTTTTTGAGGG + Intronic
1188981793 X:36733471-36733493 TACCCAGTCCTCCCCCTGTTTGG + Intergenic
1189854836 X:45213999-45214021 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1190053937 X:47171152-47171174 CTCCTCCTCCTCCCCTTGCTCGG - Exonic
1190458379 X:50646510-50646532 CACACTCTTCCCCCCTTGGTTGG - Intronic
1190977059 X:55416325-55416347 CACTCACTGCTTCCCTGGGTTGG - Intergenic
1191093971 X:56655332-56655354 CACTCACTGCTTCCCTTGGTTGG + Intergenic
1192980101 X:76330298-76330320 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1193258680 X:79379923-79379945 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1193281512 X:79656167-79656189 CAGACACCCCTCCCCTTGCTAGG + Intergenic
1194506476 X:94739453-94739475 CACTCACTGCTTCCCTTGGCTGG + Intergenic
1194867325 X:99085474-99085496 TACTCACTGCTCCCCTGGGTAGG - Intergenic
1194928685 X:99861283-99861305 TTCCCTCTCCACCCCTTGGTAGG + Intergenic
1194947843 X:100090712-100090734 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1195983049 X:110600706-110600728 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1196381726 X:115098443-115098465 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1200344469 X:155435163-155435185 CACTCACTGCTTCCCTTGGCTGG - Intergenic
1202081959 Y:21092782-21092804 CACTCACTGCTTCCCTTGGCTGG - Intergenic