ID: 956146695

View in Genome Browser
Species Human (GRCh38)
Location 3:66198064-66198086
Sequence GTCAGCCAGCATCATGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956146695 Original CRISPR GTCAGCCAGCATCATGGTGA AGG Intronic
900177685 1:1298087-1298109 GTCATCCACCACCACGGTGAGGG + Exonic
902125648 1:14208746-14208768 CTCAGCCAGCAACATGCTGAGGG + Intergenic
903539197 1:24087240-24087262 GGCAGCCTGCATCAAGGTTATGG - Intronic
905799143 1:40832307-40832329 GTCAGCCAGCAGCATCTTGAGGG - Intronic
905844428 1:41216446-41216468 GCCTGCCTTCATCATGGTGAAGG - Intronic
915585387 1:156841314-156841336 GTGAGCCAGAATCATGGGGCCGG + Intronic
916532732 1:165673644-165673666 GTCAGAAAGCGTCAGGGTGAGGG - Intronic
917809441 1:178643556-178643578 GACATTGAGCATCATGGTGAGGG - Intergenic
917915450 1:179696439-179696461 ATCAGCTAGCATCATAATGACGG + Intergenic
922811429 1:228417274-228417296 GGCAGTCAGCATCAGGCTGAGGG + Intergenic
923227902 1:231956375-231956397 GTCAGCCATGACCCTGGTGATGG + Intronic
924878432 1:248130759-248130781 ACCAGCTAGCATCATGATGACGG + Intergenic
924893832 1:248314925-248314947 ACCAGCTAGCATCATGATGATGG - Intergenic
924952671 1:248898715-248898737 ACCAGCTAGCATCATGATGACGG + Intergenic
1065507158 10:26439946-26439968 GCCAGCCAGCATCATCGTCCTGG - Intronic
1066226345 10:33387085-33387107 GTCAGCCAAAAGCATGCTGATGG - Intergenic
1066438784 10:35417927-35417949 GTCACACAGCATCTTGCTGAAGG - Intronic
1066509564 10:36081615-36081637 ACCAGCTAGCATCATGATGATGG - Intergenic
1068423662 10:56827646-56827668 CACAGCCAACATCATGCTGAAGG + Intergenic
1070623152 10:78029398-78029420 GGCAGCGGTCATCATGGTGAAGG - Exonic
1070934094 10:80280248-80280270 GTGAGCAAGGATGATGGTGAGGG + Exonic
1071022776 10:81078496-81078518 GACAGCCGGCATCATACTGATGG - Intergenic
1072854620 10:98934309-98934331 ACCAGCCAGCATCATGATGATGG - Intronic
1073533596 10:104254940-104254962 GTCAGCCAGGAGCTTGGGGAAGG + Exonic
1076130255 10:128009053-128009075 GACAGCCAGCACCATGTTGGAGG - Intronic
1079979090 11:27130231-27130253 TTCATCTAGCTTCATGGTGAAGG + Intergenic
1082909523 11:58354370-58354392 CTCAGCCAGCACCTTGGTGCAGG - Intergenic
1083286035 11:61659664-61659686 GTCAGCTAGCCTCTTGGTGGGGG - Intergenic
1084177505 11:67430915-67430937 GTCAGCCACCATCATTTTCAGGG - Intronic
1084540164 11:69781588-69781610 GGCAGACAGCAGCATGGTCAGGG - Intergenic
1085025632 11:73234896-73234918 GACAGCCAGCACCACGGCGATGG - Exonic
1087767015 11:102166030-102166052 GTCAGACAGTATGATGGGGAAGG + Intronic
1088078093 11:105876947-105876969 ATCAGCTAGCATCATAATGATGG - Intronic
1088740310 11:112761897-112761919 CTCAGTCATTATCATGGTGAGGG + Intergenic
1089643954 11:119865718-119865740 GTCAGCCAGCTTCCAGGGGAGGG - Intergenic
1091290256 11:134435548-134435570 CTCAGCCAGGCTCATGGTGTAGG + Intergenic
1091835961 12:3585973-3585995 GTTAGACATCATCCTGGTGATGG - Intronic
1092243377 12:6849353-6849375 GTCATCCTGCAGGATGGTGAGGG + Exonic
1093722482 12:22461001-22461023 GTCAGTGAGCATGATGGTCAGGG - Intronic
1097960263 12:65525706-65525728 GTCAGCCAGATTCAAGGGGAGGG - Intergenic
1098384729 12:69906903-69906925 GTGAGGCAGCATGATGCTGATGG + Intronic
1103110755 12:118276225-118276247 GACAGCCAGCACCAAGGTGCTGG + Intronic
1103788191 12:123449398-123449420 GTCAGCCAGCATCAGAGTCCAGG + Intergenic
1106625999 13:31421568-31421590 GACAGACAGCATCATGGGGATGG + Intergenic
1107576950 13:41734700-41734722 GAGAGCCAGGATTATGGTGATGG - Intronic
1111348573 13:86996018-86996040 ACCAGCTAGCATCATGATGATGG + Intergenic
1114282122 14:21202860-21202882 GTAAGCCAGGAGCAAGGTGATGG + Intergenic
1116262386 14:42647023-42647045 ACCAGCTAGCATCATAGTGACGG + Intergenic
1118026269 14:61772233-61772255 ATTAGCCAGCATGGTGGTGAGGG - Intronic
1119940690 14:78638064-78638086 AACAGCCAGCATCCTGGTGAGGG - Intronic
1121742811 14:96266077-96266099 GCCCGCCACCATCAGGGTGAGGG + Intronic
1121823067 14:96987323-96987345 CTCAGAAAGCTTCATGGTGATGG + Intergenic
1121994054 14:98588296-98588318 GCCAGCCACCACCATGCTGAGGG + Intergenic
1122348260 14:101073571-101073593 GGCAGCCACCATCCTGCTGAGGG + Intergenic
1122819823 14:104335775-104335797 GTCTGCCAGCATCCTGTCGATGG + Intergenic
1123626298 15:22229075-22229097 GTCACTCAGCATCATGTTCAAGG - Intergenic
1125616794 15:41021630-41021652 GTCAGTCAGCAACCTGGTCAGGG - Intronic
1129898132 15:79123627-79123649 GCCAGCCAGAATCAAGGAGAAGG + Intergenic
1130065821 15:80604283-80604305 GTCAGGCATCAACATGGTAACGG - Intergenic
1133677796 16:8091786-8091808 GTCATCAGGCATTATGGTGAAGG - Intergenic
1134083788 16:11342681-11342703 CTCTGCCAGCAACATGGTGTTGG + Intronic
1134597717 16:15509275-15509297 GTAATCCAGCCTCCTGGTGAGGG - Intronic
1134677594 16:16101547-16101569 CGCAGCCAGCAGCATGGTCAGGG - Intronic
1135576545 16:23590327-23590349 GAGAGCCAGCACCATGGTGCAGG - Intronic
1136418290 16:30116746-30116768 GTCATCCAGCTCCATGGCGAAGG + Exonic
1136570229 16:31092462-31092484 GTCAGCCAGGACCATGGTGCTGG + Intronic
1136774433 16:32864101-32864123 GTCAGCCAGGGACATGGTGTGGG - Intergenic
1136896179 16:33997413-33997435 GTCAGCCAGGGACATGGTGTGGG + Intergenic
1137253292 16:46755815-46755837 ATCTGCCATCATCATGCTGATGG - Intronic
1139106350 16:63831285-63831307 CTCAGTCAGCCTCAGGGTGAAGG - Intergenic
1141519786 16:84571153-84571175 GTCAGCCAGACTGAAGGTGAAGG - Intronic
1203076860 16_KI270728v1_random:1126237-1126259 GTCAGCCAGGGACATGGTGTGGG - Intergenic
1142780443 17:2177320-2177342 GTCTGCCAGCTTCATAGGGAAGG + Intronic
1143767873 17:9149480-9149502 GACCCCCAGCAGCATGGTGAGGG - Intronic
1144835970 17:18156927-18156949 GTCAGCCAGAGGCAGGGTGAGGG - Intronic
1146128922 17:30253102-30253124 TTCAGCCTGCATTGTGGTGAGGG - Intronic
1147323089 17:39657710-39657732 GTCAGCCTGCAGCAGGGTGGGGG + Intronic
1147633250 17:41946286-41946308 GGCAGCCAGTGTCATGGAGAGGG - Intronic
1149365669 17:55941079-55941101 ACCAGCCAGCATCAGGATGATGG + Intergenic
1151511150 17:74560963-74560985 GTCAGGCAGCCCCATGCTGAGGG + Intergenic
1151986761 17:77548666-77548688 GTCAGCCAACTTCAAGGTGGAGG + Intergenic
1156295331 18:35784192-35784214 CACAGCCAGCACCATGGTGTTGG - Intergenic
1158499009 18:57983299-57983321 CTCAGCCAGGTCCATGGTGAAGG + Intergenic
1158548811 18:58417631-58417653 CTCAGCGAGCATCAGGCTGAAGG + Intergenic
1160056449 18:75486393-75486415 AACAGCCAACATCATGCTGAAGG - Intergenic
1161637124 19:5395905-5395927 CTCAGCCAGCACCAGGGTGAGGG + Intergenic
1164121325 19:22268062-22268084 ACCAGCTAGCATCATGATGATGG + Intergenic
1168530627 19:57125799-57125821 ACCAGCTAGCATCATGATGATGG - Intronic
926337695 2:11876606-11876628 TTCAGCCAGGAACATGCTGAGGG + Intergenic
928319586 2:30272485-30272507 GTTAACCAGCACCAAGGTGATGG + Intronic
930263901 2:49177570-49177592 ATTATCCAGCAGCATGGTGAAGG + Intergenic
931932678 2:67158231-67158253 GACAGACAGCATCATAGTGTAGG - Intergenic
932614124 2:73221186-73221208 GACTGCAAGCATCATGTTGATGG + Exonic
934915755 2:98299809-98299831 GTCTGCCAGCAAGATGGTGAGGG - Intronic
935545503 2:104395890-104395912 ATCATCCAGAATCATGTTGAGGG + Intergenic
936052165 2:109232701-109232723 GATAGGAAGCATCATGGTGATGG + Intronic
938604403 2:132877449-132877471 GTGCGCCAGCATCATCGGGAGGG + Intronic
938685122 2:133730629-133730651 CTCAGCAAGCATCATGGTCCAGG - Intergenic
943118303 2:183702700-183702722 GACAGCCAATATCATGCTGAAGG + Intergenic
947915385 2:233828981-233829003 CTCAGCCAGGATCTTGGTCAGGG - Exonic
949050543 2:241895373-241895395 GACAGCCAGCCCCATGGTGGTGG + Intronic
1171249311 20:23636502-23636524 GTCAGCCGGCCTGAGGGTGAAGG + Intronic
1171255785 20:23688258-23688280 GTCAGCCTGCCTGAGGGTGAAGG + Intronic
1171263126 20:23750178-23750200 GTCAGCCGGCCTGAGGGTGAAGG + Intronic
1171272215 20:23826054-23826076 GTCAGCCGGCCTGAGGGTGAAGG + Intronic
1171278631 20:23878971-23878993 GTCAGCCAGCCTGAGAGTGAAGG + Intronic
1171283718 20:23921461-23921483 GTCAGCCAGCCTGAGGGTGAAGG + Intergenic
1172215508 20:33232942-33232964 GTCAGCCACCATCATAATCAGGG - Intergenic
1172357895 20:34292410-34292432 GTCGTCCAGAATCATGTTGAGGG + Exonic
1173207296 20:41005150-41005172 GTCACCCAGCATGTTGGTGTTGG - Intergenic
1173799584 20:45886712-45886734 GCCAGCGATCATCATGGCGAGGG + Exonic
1174854701 20:54032431-54032453 ACCAGCCAACATCATGATGACGG + Intronic
1175617417 20:60412559-60412581 CTCTGACAGCATCATGGAGAGGG + Intergenic
1175698833 20:61123040-61123062 GTAGGCCGTCATCATGGTGACGG - Intergenic
1176114653 20:63426339-63426361 GCCAGACAGCCTCATGCTGAAGG - Intronic
1176673585 21:9756489-9756511 GTCAGCCAGCATCAGCAAGAAGG - Intergenic
1177866537 21:26519311-26519333 GTCAGCCAGGATCAGGGGAAGGG + Intronic
1178830107 21:36048865-36048887 ATTAGGCACCATCATGGTGATGG - Intronic
1178894047 21:36544154-36544176 GGCAGGCAGCACCATGGTAATGG - Intronic
1179242040 21:39601325-39601347 CTCAGCCAGCATGATGCAGAAGG + Intronic
1179302292 21:40123629-40123651 GTCAGCCTGGTTCATTGTGAAGG - Intronic
1179655945 21:42844854-42844876 GCCTGCCAGCCTCATGGTGGGGG - Intronic
1181640946 22:24198168-24198190 ACCACCCAGCAACATGGTGAAGG - Intergenic
1185011392 22:48316595-48316617 GAGAGCCTGCATCATGCTGAAGG - Intergenic
950461482 3:13124860-13124882 GTCGTTCAGCATTATGGTGAGGG + Intergenic
950611136 3:14127357-14127379 CTCAGCCAGCATCAAGATAAGGG - Intronic
953023333 3:39129981-39130003 GTCAGCCAGAATCAGTGGGAAGG + Intronic
956046828 3:65204622-65204644 TTCAGCAATCCTCATGGTGAAGG - Intergenic
956146695 3:66198064-66198086 GTCAGCCAGCATCATGGTGAAGG + Intronic
959988218 3:112600529-112600551 GTCACCCAGGATGATGATGATGG + Intergenic
960922249 3:122759083-122759105 GTCAGCCTGCCTCATGATTAGGG - Intronic
966971531 3:185049559-185049581 GCCAGGCAGCAGCATGGAGAGGG - Intronic
968009287 3:195263091-195263113 GACAGCCAGCATCAAGGTCAAGG + Intronic
969378368 4:6778206-6778228 GTCAGCCAGGAACATGCTGGGGG + Intergenic
970396821 4:15676632-15676654 CTCAGCCAGAATTATTGTGAAGG - Intronic
972945914 4:44255158-44255180 GAAAGCCAGCATCATAGTGAAGG - Intronic
975024136 4:69528834-69528856 GTCAGCCAATCTCATGATGAGGG - Intergenic
975977724 4:80117682-80117704 ACCAGCTAGCATCATGATGACGG + Intronic
977629903 4:99231153-99231175 ACCAGCTAGCATCATGATGATGG - Intergenic
977717033 4:100194438-100194460 GTCAGCCAGGAACATGGAGTGGG + Intergenic
979350998 4:119644492-119644514 GTCAGCCATAATCCTTGTGATGG + Intergenic
980114169 4:128663429-128663451 GTCAGCCAGATTCAAGGGGAAGG + Intergenic
983957940 4:173718604-173718626 GCCAGCCAGCATCATGATGACGG + Intergenic
984606789 4:181795254-181795276 GTCAGCCAGCACCTTGATGCTGG - Intergenic
985401129 4:189595174-189595196 GTCAGCCAGCATCAGCAAGAAGG + Intergenic
985769983 5:1803422-1803444 GTCTACCAGGATCATGGTGGTGG + Intronic
985794136 5:1949519-1949541 GACAGCCAGCGTCATGGAGTGGG - Intergenic
986717979 5:10537834-10537856 GTGAGGCAGCATCATGGAGCTGG - Intergenic
987861384 5:23492273-23492295 GTGTGCCAGCAACATGGTGTGGG + Intergenic
988123180 5:26993857-26993879 GTCACCCAGAACCATGGGGATGG + Intronic
988851583 5:35186374-35186396 ATCAGTCAGCGTCATGCTGAGGG - Intronic
989164792 5:38423628-38423650 GTCAGCCAGCATCTCTGTGGAGG + Intronic
989641576 5:43588220-43588242 GTTCGCCAGTCTCATGGTGATGG - Intergenic
990339533 5:54808726-54808748 GTCAGGCGGCACTATGGTGAAGG + Intergenic
992180931 5:74197696-74197718 CTCACCCAGCTTCATGGGGAGGG - Intergenic
993560323 5:89398953-89398975 GTCAGTCAGCACTATGGTGGAGG + Intergenic
994258063 5:97623931-97623953 GATAGACAACATCATGGTGAAGG - Intergenic
994466174 5:100135097-100135119 GTCACCCAGCATCATGGAGGAGG + Intergenic
995283511 5:110360962-110360984 TTCTGCCATCATCATGGTAAAGG - Intronic
997365849 5:133324786-133324808 GCCACCCTGCACCATGGTGACGG + Intronic
999254515 5:150202608-150202630 GCCAGCCAGGATGCTGGTGATGG - Exonic
999795776 5:154988563-154988585 GCCTGGCAGAATCATGGTGAGGG + Intergenic
1001006370 5:168054273-168054295 GCCAGCCAGCAGCAGGGTGAAGG + Intronic
1001112127 5:168905274-168905296 ATCAGCCAGCAACATGGAGGAGG - Intronic
1003154030 6:3575997-3576019 GGCAGCCAGAATGATGCTGATGG + Intergenic
1003498504 6:6685504-6685526 GTCAACCAACATAATGGTTAAGG + Intergenic
1012784390 6:103604949-103604971 ACCAGCTAGCATCATGATGATGG - Intergenic
1014123036 6:117747700-117747722 ACCAGCTAGCATCATGATGACGG + Intergenic
1014128883 6:117809024-117809046 ACCAGCTAGCATCATGATGATGG - Intergenic
1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG + Intronic
1019291484 7:252628-252650 ATCAGCCAGGAACAAGGTGAGGG + Intronic
1020948199 7:14642976-14642998 GTCAGCCATCTTGATGGTGTCGG - Intronic
1021021273 7:15600576-15600598 TGCAGCCAGCATCTTGGTGGTGG + Intergenic
1021187205 7:17577789-17577811 ACCAGCAAGCATCATGATGACGG + Intergenic
1021402744 7:20228443-20228465 GTCAGCCATAATCCTTGTGATGG - Intergenic
1024590187 7:50874469-50874491 ACCAGCTAGCATCATGATGACGG + Intergenic
1026101605 7:67388782-67388804 GTCAGCCAGCATAATGTGCATGG - Intergenic
1028202141 7:87974370-87974392 ATCAGCCAGAAACATGGGGAAGG + Intronic
1028837032 7:95386031-95386053 ACCAGATAGCATCATGGTGATGG - Intronic
1032804271 7:135339666-135339688 GTCAGACAGCTTCCTGTTGATGG + Intergenic
1033791776 7:144798886-144798908 ACCAGCTAGCATCATGATGATGG + Intronic
1035694837 8:1587305-1587327 GTCTGCCAGCTTCAGGGGGATGG + Intronic
1036396718 8:8376977-8376999 GTCAGCCACCATCACAGTCATGG - Exonic
1036400868 8:8406667-8406689 GTAAGCCAACAACAAGGTGATGG + Intergenic
1038468664 8:27791386-27791408 GTCAGTGAGCATAATGGGGAAGG - Intronic
1039581187 8:38668017-38668039 CTCAGGCATCATCATGGGGAAGG + Intergenic
1041394412 8:57376522-57376544 GTCAGCCAGGAGCATGGGGTGGG + Intergenic
1042630167 8:70807370-70807392 AGCAGCCAGCATCATGATGATGG + Intergenic
1043943351 8:86221871-86221893 GTCAGCTAGCACCATTGTTACGG - Intronic
1044377921 8:91498387-91498409 GCCACCTAGCATCATGATGACGG - Intergenic
1045062306 8:98420996-98421018 GACAGCTAGCTTCATGGTGCGGG + Intronic
1045251273 8:100485179-100485201 GACAGGCAGCATCATGATGCAGG - Intergenic
1045288754 8:100813683-100813705 GTCACCCAGCAAAAGGGTGAGGG - Intergenic
1045378624 8:101600704-101600726 TGCAGCCAGCATCATGCTGAGGG + Intronic
1047430031 8:124783008-124783030 GTCAGACAGCATCAAAGTCAGGG + Intergenic
1049371486 8:142270037-142270059 GTCAGCCAGCATCTTGCTCCTGG + Intronic
1049630199 8:143649974-143649996 GTCAGACAGACTCACGGTGATGG + Exonic
1050483822 9:6113995-6114017 TGCAGCCAGCATGATGGTGGTGG - Intergenic
1050886840 9:10777417-10777439 TTCATGGAGCATCATGGTGAAGG + Intergenic
1055116595 9:72611944-72611966 GTCATAGAGCAGCATGGTGAAGG - Intronic
1056726370 9:89122664-89122686 GTCAGCCAGATTCATGGGAAAGG + Intronic
1057829452 9:98395646-98395668 TGCAGCCAGCTCCATGGTGAAGG - Intronic
1058240733 9:102554844-102554866 GACAGCCAACATCATACTGAAGG + Intergenic
1059208691 9:112490103-112490125 TTCAGCAAGCAGCATGGTGTTGG - Intronic
1059347110 9:113636464-113636486 GCAAGCCAGCCTCATGGTGGTGG + Intergenic
1060088294 9:120721042-120721064 ATCATCCAGAATCATGTTGAGGG - Intergenic
1061188382 9:129068311-129068333 GTCAGACAGCTTCAAGGAGACGG + Exonic
1061598761 9:131650903-131650925 GTCCATCAGCTTCATGGTGAAGG + Exonic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1187359689 X:18613703-18613725 GACAGCCAGTAACATGGAGAAGG + Intronic
1190060099 X:47205293-47205315 GTGTGCCAGCATCCTGGTGGTGG + Intronic
1191209886 X:57873425-57873447 CTAAGCCAGCATCATTCTGATGG + Intergenic
1191973143 X:66839748-66839770 ATCAGCTAGCATCATGATGACGG + Intergenic
1193505824 X:82342745-82342767 GTAAGAGATCATCATGGTGAGGG + Intergenic
1193605708 X:83565752-83565774 ACCAGACAGCATCATGATGATGG - Intergenic
1200105519 X:153709955-153709977 GTCAGCCGGGAACATGGTGTGGG + Intronic