ID: 956147837

View in Genome Browser
Species Human (GRCh38)
Location 3:66210116-66210138
Sequence TAGAAAAGGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2023
Summary {0: 1, 1: 1, 2: 17, 3: 197, 4: 1807}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956147837_956147844 9 Left 956147837 3:66210116-66210138 CCTCCCTCCTTCTCCCTTTTCTA 0: 1
1: 1
2: 17
3: 197
4: 1807
Right 956147844 3:66210148-66210170 TTGAGCCTATATGATGTATCTGG 0: 1
1: 0
2: 3
3: 24
4: 190
956147837_956147845 10 Left 956147837 3:66210116-66210138 CCTCCCTCCTTCTCCCTTTTCTA 0: 1
1: 1
2: 17
3: 197
4: 1807
Right 956147845 3:66210149-66210171 TGAGCCTATATGATGTATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 99
956147837_956147847 23 Left 956147837 3:66210116-66210138 CCTCCCTCCTTCTCCCTTTTCTA 0: 1
1: 1
2: 17
3: 197
4: 1807
Right 956147847 3:66210162-66210184 TGTATCTGGGACTGAGTATTCGG 0: 1
1: 0
2: 0
3: 5
4: 163
956147837_956147848 26 Left 956147837 3:66210116-66210138 CCTCCCTCCTTCTCCCTTTTCTA 0: 1
1: 1
2: 17
3: 197
4: 1807
Right 956147848 3:66210165-66210187 ATCTGGGACTGAGTATTCGGTGG 0: 1
1: 0
2: 1
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956147837 Original CRISPR TAGAAAAGGGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr