ID: 956148861

View in Genome Browser
Species Human (GRCh38)
Location 3:66220719-66220741
Sequence CTGTAAACCCAGAAGAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956148861_956148863 -7 Left 956148861 3:66220719-66220741 CCACGCCTCTTCTGGGTTTACAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 956148863 3:66220735-66220757 TTTACAGTTCAGAATCACGCCGG 0: 1
1: 0
2: 0
3: 10
4: 87
956148861_956148866 20 Left 956148861 3:66220719-66220741 CCACGCCTCTTCTGGGTTTACAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 956148866 3:66220762-66220784 ATTCTACCGCTGCTCTCTCCTGG 0: 1
1: 0
2: 8
3: 39
4: 148
956148861_956148868 27 Left 956148861 3:66220719-66220741 CCACGCCTCTTCTGGGTTTACAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 956148868 3:66220769-66220791 CGCTGCTCTCTCCTGGATCTCGG 0: 1
1: 0
2: 1
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956148861 Original CRISPR CTGTAAACCCAGAAGAGGCG TGG (reversed) Intronic
900299754 1:1970653-1970675 CTGGAGGCCCAGAAGAGGTGAGG - Exonic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
902720177 1:18298801-18298823 CTGTAAGCTCCGAAGAGGCAGGG - Intronic
904758044 1:32780121-32780143 CTGAAACCCCAGAAGATGAGAGG - Exonic
907662510 1:56406366-56406388 TTGTAAACCAAGTAGAGGAGAGG + Intergenic
909134225 1:71776978-71777000 CTGTAAATCCATAAGAGTCAAGG + Intronic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
913477384 1:119251493-119251515 CTGTAATCCCAGCCGAGGCAGGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
916233788 1:162565101-162565123 CTGTAATCCCAGCACAGGCCTGG - Intronic
916527217 1:165621922-165621944 CTGTAATCCCAGCATAGGCTAGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
922358417 1:224798347-224798369 CTGTAAACCCAGAGCTGGCAGGG + Intergenic
924648229 1:245899981-245900003 CTGGAGACCCAGAAGAGCCATGG - Intronic
1066550912 10:36555770-36555792 CTGTAAAACCAGAAGAGGTCAGG + Intergenic
1067204135 10:44199187-44199209 CTGTAGACCCAGGAGAGTTGAGG + Intergenic
1067279016 10:44857409-44857431 CTGAGAACCCAAAAGAGGCAGGG - Intergenic
1067686778 10:48470537-48470559 CTCTATACCCAGAAGAGGCCAGG + Intronic
1071743327 10:88387187-88387209 CTCCAAACCCAGAAGAGGGGAGG + Intronic
1073121466 10:101124772-101124794 CTGCACGCCCAGCAGAGGCGAGG + Intronic
1075756691 10:124817838-124817860 GTGTAAATCTAAAAGAGGCGAGG - Intronic
1080589286 11:33707571-33707593 CTGTAAATCCAGATGAGTGGAGG + Intronic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1084542219 11:69794126-69794148 CTGTAATCCCAGCAGATGGGAGG + Intergenic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1089029164 11:115305410-115305432 CTGAAAACACAGAAAAGGAGAGG - Intronic
1089579879 11:119474964-119474986 CTGTGACCCCAGGAGAGGTGGGG - Intergenic
1097835264 12:64266524-64266546 CTGTAATTCCAGAAGTGGCGTGG + Exonic
1098344900 12:69491753-69491775 CTGTAAACCCAGCAGTTGAGAGG - Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1100845110 12:98650237-98650259 TTGTAATCCCAGCTGAGGCGTGG + Intronic
1102163303 12:110786571-110786593 CTAAAAACCCTGAAGAGGCCGGG + Intergenic
1102312880 12:111860859-111860881 CTGTAATCCCAGCACAGGCATGG + Intronic
1102801104 12:115734662-115734684 CTGCAAAACCACAAGAGGCCAGG + Intergenic
1103122232 12:118389954-118389976 CTGCAAACCCAGAAGATCCGTGG - Intronic
1104476601 12:129075591-129075613 CTGCAGACCCAGAAAAGGCAGGG - Intronic
1104865677 12:131952040-131952062 CTGTAATCCCAGCAAAGGGGAGG - Intronic
1105871690 13:24511244-24511266 CTGTTAACCCAGAAGAGGGCTGG - Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1107334685 13:39342227-39342249 CTGTAATCCCAGCCGAGGTGGGG - Intergenic
1107479360 13:40772402-40772424 CTGTGACCCCAGAAGAGATGTGG + Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1112407382 13:99133371-99133393 CTGTCAAGCCAGAGGAGGCTTGG + Intergenic
1113326121 13:109282973-109282995 CTGCACACCCAGGAGAGGCCAGG - Intergenic
1114460351 14:22882672-22882694 CTCTTAGCCCAGAAGAGGCAGGG + Intergenic
1115433306 14:33346107-33346129 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1118571826 14:67201715-67201737 CTGTTAATCCAGAAGAAGAGGGG + Intronic
1120568561 14:86089963-86089985 CTACAAACCCAGAAAAGGCCTGG - Intergenic
1121974392 14:98389547-98389569 CTGCAGACCCAGGAGAGTCGAGG - Intergenic
1122051815 14:99066009-99066031 CTGGAAAGCCAGAAAAGGCCAGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1126448192 15:48774264-48774286 CTGAACTCCCAGAAGAGGAGAGG + Intronic
1129062144 15:72868648-72868670 CTGTAAGCCAAGAAGAGACCTGG - Intergenic
1129250442 15:74305933-74305955 CTGAAAAGCCTCAAGAGGCGGGG - Intronic
1129349712 15:74948375-74948397 CTTAAAACCCAGAGGAGGCCGGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147060088 17:37869065-37869087 CTGTAATCCTAGCATAGGCGTGG + Intergenic
1148219424 17:45851334-45851356 CTGTAAGCCCAGGAAAGGCCTGG - Intergenic
1151625396 17:75272500-75272522 CTGTAGCCCCAGAAGGGCCGTGG - Intergenic
1151714130 17:75822921-75822943 CTTGAAACCCTGGAGAGGCGAGG - Intronic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1152897177 17:82919167-82919189 CTTTAAACTCAGAGGAGGGGAGG - Intronic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1153839656 18:8995010-8995032 CTTTCAACCCTGAAGAAGCGTGG - Intergenic
1155224200 18:23714222-23714244 CCTTAAACCCAGAATAGGCCAGG + Intronic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1160202072 18:76804290-76804312 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1163552791 19:17974714-17974736 CTGTAAACTCTGAAGTGCCGAGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1167784319 19:51625065-51625087 CTGTAAACACAGAAGAGAAGGGG + Intronic
1168632603 19:57969049-57969071 CAGAAACCCCAGTAGAGGCGGGG + Intronic
926756789 2:16242979-16243001 CTGTAAAGCCAGAAGAGACAGGG - Intergenic
928087641 2:28355881-28355903 CTGGAACCCTAGAAGATGCGAGG - Intergenic
928330102 2:30351213-30351235 CTGCAAACCGAGAGGAGGCTTGG - Intergenic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
935934386 2:108166103-108166125 ATATAAACCAAGAAGAGGCTAGG - Intergenic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
948102108 2:235383489-235383511 CTGTATACCCAGCATTGGCGAGG - Intergenic
1169365167 20:4986208-4986230 CTATAATCCCAGCAGAGGCGGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174863105 20:54111093-54111115 CTGTAGACCCTGTAGAGACGGGG - Intergenic
1175186893 20:57184816-57184838 CTCTGAAGCCAGAAGAGGCAAGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1182546568 22:31080207-31080229 CTGTTAACCCAGAAGAGCCCCGG - Intronic
1184319280 22:43727163-43727185 CTGTAATCCCAGAATTGGGGAGG + Intronic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
949901058 3:8815077-8815099 GAGTAGACACAGAAGAGGCGGGG + Intronic
950303276 3:11899854-11899876 CTTCAAACCCAGAGGAGACGTGG - Intergenic
950506783 3:13400001-13400023 CTTCAAACCCAGAGGAGACGTGG + Intronic
953156663 3:40381339-40381361 CTGGAAACCCAGGAGAGCCCAGG - Intergenic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957588106 3:82158645-82158667 CTGTGAAACCAGAAGAGACCAGG - Intergenic
960929370 3:122829455-122829477 TTGGAAACCCACAAGAGGCCTGG + Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
965632696 3:170749545-170749567 CTTTAAACACACAAGATGCGAGG + Intronic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
966791663 3:183676638-183676660 ATGCAAAGTCAGAAGAGGCGTGG - Intronic
969851474 4:9960468-9960490 CTGTAAACCCTTAAGGGGCTGGG - Intronic
970674182 4:18430031-18430053 CTGTAAACTGTGAAGAGCCGTGG + Intergenic
972535104 4:39993348-39993370 ATGTAAACTCAGAAGATGAGAGG - Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
975666659 4:76740470-76740492 CTGAAAGCCCTGAAGAGCCGAGG - Exonic
978585489 4:110272008-110272030 CTGGAGACCCAGGAGAGGCAAGG + Intergenic
978662330 4:111141977-111141999 CTGTCAGCCCAGAAGTGGCATGG - Intergenic
979439405 4:120733639-120733661 CTGCATACCCAGAAGGGGAGTGG - Intronic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
985520300 5:371016-371038 CTGGAGACCCAGGAGAGCCGAGG + Intronic
986401194 5:7383400-7383422 CTGTAACCCCAGAAGAGGTAAGG + Intergenic
992699641 5:79329242-79329264 CAGTGAACTGAGAAGAGGCGAGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
999177965 5:149645284-149645306 CTGTAATCCCAGCGGAGGCGAGG - Intergenic
1000192346 5:158923697-158923719 TTTGAGACCCAGAAGAGGCGTGG - Intronic
1001444722 5:171774523-171774545 CTTCAAACCCACAAGGGGCGTGG - Exonic
1003911351 6:10747084-10747106 CAGGAAACACAGAAGAGGAGCGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006866764 6:37214901-37214923 CTGTGAACCGAGCAGAGGTGAGG - Intronic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1012360004 6:98365619-98365641 CTGTAAGCCCAAAGGAGGAGAGG - Intergenic
1015920141 6:138258233-138258255 CAGAAAACCCTGAAGAGGCGGGG - Intronic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1029111414 7:98214683-98214705 CTGAAAGCCCAGAAGAGCCTCGG + Exonic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1035056227 7:156038593-156038615 CAGTAAACCCACAACAGGCATGG - Intergenic
1035925793 8:3726227-3726249 CTGTAAACCCATGAGAGGCTGGG + Intronic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1038187759 8:25291166-25291188 CTTTAAACCCAGGAGGGGCATGG + Intronic
1040753659 8:50743013-50743035 CTGTCAACAGAGAAGAGGCCTGG + Intronic
1056918472 9:90764733-90764755 CTGTGACCCCTGAAGAGGCAAGG + Intergenic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1185498364 X:576887-576909 ATGGACACCCAGAAGAGGCAGGG + Intergenic
1186159494 X:6761927-6761949 CTGTAATCCCAGCACAGGTGTGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1188745091 X:33831414-33831436 TTAGACACCCAGAAGAGGCGGGG + Intergenic
1188847793 X:35095521-35095543 CTGTAATCCCAGAATTGGGGAGG + Intergenic
1190188871 X:48258900-48258922 CTGTAAATGGAGAAGGGGCGGGG + Intronic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192479484 X:71472473-71472495 CTGTAATCCCAGCACAGGGGAGG + Intronic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic