ID: 956149371

View in Genome Browser
Species Human (GRCh38)
Location 3:66224972-66224994
Sequence GGGTTCCCATGGTGGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956149364_956149371 14 Left 956149364 3:66224935-66224957 CCATGTCTTACATCCAGGTCACG 0: 5
1: 190
2: 1259
3: 1815
4: 1613
Right 956149371 3:66224972-66224994 GGGTTCCCATGGTGGCTTTGTGG 0: 1
1: 0
2: 0
3: 24
4: 160
956149362_956149371 23 Left 956149362 3:66224926-66224948 CCTTTGACTCCATGTCTTACATC 0: 58
1: 1410
2: 2079
3: 1539
4: 992
Right 956149371 3:66224972-66224994 GGGTTCCCATGGTGGCTTTGTGG 0: 1
1: 0
2: 0
3: 24
4: 160
956149365_956149371 1 Left 956149365 3:66224948-66224970 CCAGGTCACGCTGCTGTAAGAGG 0: 1
1: 13
2: 280
3: 1307
4: 1647
Right 956149371 3:66224972-66224994 GGGTTCCCATGGTGGCTTTGTGG 0: 1
1: 0
2: 0
3: 24
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956149371 Original CRISPR GGGTTCCCATGGTGGCTTTG TGG Intronic