ID: 956152931

View in Genome Browser
Species Human (GRCh38)
Location 3:66262142-66262164
Sequence TCTTATATGAAGAGGTGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956152931 Original CRISPR TCTTATATGAAGAGGTGAGA TGG Exonic
901473564 1:9473909-9473931 GCTTATAAGAAGAGGAGACATGG - Intergenic
902176044 1:14651864-14651886 TATTATGTGAAGAAGTTAGAAGG - Intronic
904851185 1:33460941-33460963 TCTTCTATGGAGAGAAGAGAAGG + Intergenic
905710899 1:40101998-40102020 GCTTGTCTGAAGAGGGGAGAGGG - Intergenic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
906536471 1:46553564-46553586 ACCTATATGAAGAGCTGGGACGG - Intergenic
906623325 1:47303580-47303602 ACTTAAATGAATAGGTTAGATGG + Intronic
906715643 1:47966392-47966414 TCTCACCTGAGGAGGTGAGAAGG + Intronic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908530743 1:65031276-65031298 TCTCATATAAAGTGCTGAGAAGG + Intergenic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909122229 1:71617807-71617829 TCTTATACACAGAAGTGAGATGG + Intronic
909471498 1:76033941-76033963 CCTTATAAGAAGAGGAGACATGG + Intergenic
910593112 1:88949477-88949499 TCTCATGTGAAGAACTGAGAAGG + Intronic
913284508 1:117214258-117214280 TCTTATAAGAAGAGGAGATTAGG - Intergenic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
914821998 1:151111842-151111864 TCATATATGAAGAGCTAACATGG + Intronic
915608338 1:156969591-156969613 TCTTATTTCAGGAGGTGACATGG - Intronic
915844335 1:159247944-159247966 TATTTTAAGAATAGGTGAGAAGG - Intergenic
917233331 1:172862227-172862249 TCTTATATTAAAATGTGAGAAGG + Intergenic
918681437 1:187359810-187359832 TCATATTTGGAGAGATGAGAAGG - Intergenic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
919021495 1:192111351-192111373 TCTGATGGCAAGAGGTGAGAAGG + Intergenic
919091258 1:192980909-192980931 TCTTATACCCAGAAGTGAGATGG + Intergenic
920311871 1:205053239-205053261 TCTTACCTGAAGAGGAGACAAGG - Exonic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921854258 1:219964266-219964288 GAAAATATGAAGAGGTGAGAAGG + Intergenic
921892500 1:220367249-220367271 CCTTTTAAGAAGAGGTCAGAAGG - Intergenic
923719225 1:236452849-236452871 TCCTATAGGAGGATGTGAGATGG - Intronic
923903558 1:238356537-238356559 TCTTATAAGAAGAGGAGATTAGG - Intergenic
1062878788 10:961976-961998 TCTTATAAGAAGAGGAGATTGGG - Intergenic
1063226738 10:4022422-4022444 TATTATTTGAAGATGTGAAACGG + Intergenic
1063255310 10:4320988-4321010 TCTTATAAGAAGAGGAGATCAGG - Intergenic
1067057805 10:43062436-43062458 GCTGAGATGAAGAGGAGAGAGGG + Intergenic
1067709149 10:48634873-48634895 TCTTATAAGCAGAGGAGATAAGG + Intronic
1068133130 10:52920253-52920275 TCTTATAAGAAGAGGAGATTAGG + Intergenic
1068470200 10:57451753-57451775 TCTTTTATGGAAAGGTGACATGG - Intergenic
1069279732 10:66640210-66640232 TCCAATATGAAGAGGAGATATGG - Intronic
1071269107 10:83990799-83990821 TCTTAGCTGAAGAGCTCAGAGGG + Intergenic
1072755210 10:98016115-98016137 ATTTTTATGAAGAGGTGAGAAGG + Intronic
1073704735 10:105970326-105970348 TCAAATATGAAGTGGTGATAAGG - Intergenic
1074072280 10:110084484-110084506 TCTTATATGAACAGATCATATGG + Intronic
1075287424 10:121199045-121199067 TCTTGAAAGAAGAGGTGAGGGGG - Intergenic
1075906662 10:126087585-126087607 TCTCAAATGAAGAGTTAAGATGG + Intronic
1076810255 10:132882716-132882738 TCTGTCATGAAGAGGTGGGAAGG + Intronic
1076961732 10:133767944-133767966 TGGTATCTGGAGAGGTGAGATGG + Intergenic
1077114846 11:879441-879463 TCTTATAAGAAGAGGAGAAGAGG + Intronic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1078003410 11:7514707-7514729 TCTGATGTGATGAGGTGAGGAGG - Intronic
1078597857 11:12703873-12703895 TTTTATAAAAAGAGGTGAGGGGG - Intronic
1079570064 11:21932039-21932061 TCGTATACGCAGAAGTGAGATGG + Intergenic
1080759655 11:35236274-35236296 TACTATATGATGAGGTGTGAGGG + Intergenic
1082972663 11:59040014-59040036 TTTTATTTGAATAGGTGAAAAGG + Intronic
1083053459 11:59797184-59797206 TTTTCTATGTAGAGGTGACAGGG + Intronic
1085528349 11:77176938-77176960 TCTTGGATGAGGAGGAGAGAGGG + Intronic
1085703328 11:78764225-78764247 CCTTATTTGTAAAGGTGAGAAGG - Intronic
1085773850 11:79348078-79348100 TCTTATCAAAAGAAGTGAGAGGG - Intronic
1085993853 11:81886635-81886657 TCTTATATGTAGAGCACAGACGG - Intergenic
1088667596 11:112108952-112108974 TCTTATACACAGAAGTGAGATGG - Intronic
1088780980 11:113133772-113133794 TATTAAATAAAAAGGTGAGAGGG + Intronic
1089523500 11:119081385-119081407 TCTTAAATGAGGAGGTGATAAGG - Intronic
1090285983 11:125499798-125499820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1091147135 11:133289845-133289867 AGTTATATGATGAGGAGAGAGGG - Intronic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1091446134 12:545174-545196 ACTTATATGGAGAGATGAGCTGG - Intronic
1092488986 12:8927492-8927514 TTTGATAGGAAGAGGAGAGAAGG + Intronic
1092982141 12:13807340-13807362 TCTTATATGAAGTGGTGTGAAGG - Intronic
1093138531 12:15479579-15479601 ACTTAGATGAAGAGATGAGATGG - Intronic
1093892535 12:24539976-24539998 ATTTATATGAAGAGGTGAACTGG + Intergenic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094235285 12:28157574-28157596 TTTTATATAAGGAGGTGAAATGG - Intronic
1095208272 12:39463023-39463045 TCTTTTAGAAAGAGGTCAGAGGG + Intergenic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1096224602 12:49858385-49858407 TCTGATATGATGTGCTGAGAAGG - Intergenic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099627506 12:85093493-85093515 TCTTATACAGAGAAGTGAGATGG + Intronic
1100602251 12:96121992-96122014 TGTTATGTGAACAGGTAAGACGG - Intergenic
1100996980 12:100311886-100311908 TCTTATATGTAGTCGTTAGAGGG + Intronic
1103494085 12:121347760-121347782 TTATATATGAAAAGGTGTGAAGG - Intronic
1104149965 12:126072794-126072816 TTTTATATGATGAGGTAAAAAGG + Intergenic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1104427782 12:128692400-128692422 TCTTAGTTTAAGAGGTGATATGG + Intronic
1107431629 13:40345652-40345674 TCTTCTAGAAAGAGGTGGGATGG + Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1110305276 13:73979901-73979923 TCTTATAAGAAGAGGAGATTAGG + Intronic
1110543907 13:76735593-76735615 TCTCATGTGAAAAGTTGAGAGGG - Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1112358713 13:98696882-98696904 TCTCATATGAAGAGATGATTAGG + Intronic
1114882643 14:26805957-26805979 TCTTATTTGGAGAGGTTAGGAGG - Intergenic
1115118515 14:29910897-29910919 AATTATATGACAAGGTGAGAAGG + Intronic
1115914214 14:38292358-38292380 TCTTAAAAGAGCAGGTGAGATGG + Intergenic
1116052035 14:39815611-39815633 TATTACATGAAGATGTAAGAAGG - Intergenic
1117569782 14:57035927-57035949 TCTTATAAGAAGAGGAGATTAGG + Intergenic
1117573758 14:57076793-57076815 TCTAATATGAATATGTAAGATGG + Intergenic
1117763918 14:59060493-59060515 GATTAGATGAAGAGGAGAGAGGG - Intergenic
1117844543 14:59897145-59897167 TACAAGATGAAGAGGTGAGACGG + Intergenic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119882436 14:78111437-78111459 ACTTACATGAAGACTTGAGAGGG + Intergenic
1120001475 14:79308046-79308068 CCTTATATGAAGAGGTGATTAGG - Intronic
1120141169 14:80931491-80931513 TCTTATACACAGAAGTGAGATGG + Intronic
1121148785 14:91610876-91610898 TCTTATAAGAAGAGGAGATTAGG + Intronic
1121448458 14:93993066-93993088 TCTGGTGGGAAGAGGTGAGAGGG - Intergenic
1121561002 14:94875522-94875544 TCTGATATGGAAAGCTGAGAAGG - Intergenic
1123421130 15:20135445-20135467 TATAAAATGATGAGGTGAGATGG - Intergenic
1123530355 15:21141974-21141996 TATAAAATGATGAGGTGAGATGG - Intergenic
1123789409 15:23705473-23705495 TCTAATATGATATGGTGAGAAGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126161809 15:45620656-45620678 TCTTATAATAGGAGGTGGGATGG + Intronic
1127365988 15:58290995-58291017 TGTGATATGAGGTGGTGAGAAGG - Intronic
1128841614 15:70854989-70855011 TCACATTTGGAGAGGTGAGATGG - Intronic
1129879050 15:78995230-78995252 TCTGAAATTAAGATGTGAGAGGG - Intronic
1131981552 15:97999500-97999522 TCTTATAAGAAGAGGAGATTTGG + Intergenic
1132503175 16:293599-293621 TCTTGGATGAAGAGGTGGGAGGG + Exonic
1133361349 16:5176352-5176374 CCTTATAGGAAGAGGAGAGTAGG + Intergenic
1133573435 16:7064478-7064500 TCTTATAAGAAGAGGAGATTAGG + Intronic
1134728359 16:16439356-16439378 TCTTATAGGAAGAGGAGATTAGG - Intergenic
1134939082 16:18272476-18272498 TCTTATAGGAAGAGGAGATTAGG + Intergenic
1138221325 16:55253836-55253858 CCTGATATGAAGTGATGAGAAGG + Intergenic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1142455836 16:90221821-90221843 TGGTATCTGGAGAGGTGAGAGGG + Intergenic
1142627619 17:1202597-1202619 TCATATGTGAAGATGTGAAAAGG - Intronic
1143089218 17:4439024-4439046 TCCCATATGAAGAGGAGGGAAGG + Intronic
1144484507 17:15653592-15653614 TCTTATAAGAAGAGGAGATTAGG - Intronic
1146426656 17:32746382-32746404 TCTTATAGGAAGAAGTGGGAAGG - Intronic
1146605389 17:34253249-34253271 TCTTGGAAGATGAGGTGAGATGG + Intergenic
1146747149 17:35342008-35342030 TCTTTGATTATGAGGTGAGATGG - Intergenic
1149010818 17:51854526-51854548 ACTTGGATGAAGAGATGAGATGG + Intronic
1152964561 18:102900-102922 TGGTATCTGGAGAGGTGAGATGG - Intergenic
1153610671 18:6881052-6881074 TCTTATCAGTAGAGGTTAGAGGG + Intronic
1155112187 18:22726852-22726874 TCTTATACACAGAAGTGAGATGG + Intergenic
1155337937 18:24784489-24784511 CCTTATAAGAAGAGGTGATAAGG - Intergenic
1155488822 18:26377446-26377468 TCATATATGCAGAGTTAAGAAGG - Intronic
1155552450 18:26979605-26979627 TCTTAGAAGAAGAAGAGAGATGG - Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1155808869 18:30206699-30206721 TCTGATATGGACAGGAGAGAGGG - Intergenic
1156764094 18:40630407-40630429 TTTTCTATGAAGAGGTTATAGGG + Intergenic
1157289650 18:46400443-46400465 TCTGAGTTGAAGAGGTGACAGGG - Intronic
1159274681 18:66201498-66201520 TCTAAAAAGAAGAGGTAAGAAGG - Intergenic
1164007044 19:21159679-21159701 TCTTATATAATGAGTTGAAAAGG + Intronic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1166958086 19:46479326-46479348 TTTCAAATGAAGAGCTGAGAAGG + Intergenic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
925193240 2:1902448-1902470 TCTTCTGTGAAGAGGCGACAAGG + Intronic
925250295 2:2428966-2428988 TCTTACATTAAGAGGTAAGCAGG + Intergenic
925876248 2:8313309-8313331 TCTGGTGTGAAGAGGTGAAAGGG + Intergenic
926058649 2:9791733-9791755 ACTTATATAACAAGGTGAGAAGG + Intergenic
926824644 2:16892239-16892261 TCTTATATACAGAAGTGAAATGG + Intergenic
927096700 2:19752691-19752713 TCTTATCTGAAAAGGTGACTGGG - Intergenic
928574638 2:32642561-32642583 TTTTAAAAGAAGAGGTTAGAAGG + Intronic
929133968 2:38604844-38604866 ACTTCTTTGATGAGGTGAGATGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929268055 2:39940784-39940806 GCTTATAGCAAAAGGTGAGAAGG - Intergenic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
933500120 2:83101047-83101069 TCTTATATGAAAATGTGTAAAGG + Intergenic
934989153 2:98909374-98909396 ACTTATAAGAAGGGGTGAGCAGG + Intronic
937086664 2:119176360-119176382 CCTTATAAGAAGAGGTGATTAGG - Intergenic
939390206 2:141558458-141558480 TTTTATGTGAAGAAGAGAGAAGG - Intronic
939723443 2:145683814-145683836 TCTTATTTGAAGAAGTAATATGG - Intergenic
940091872 2:149929153-149929175 TCTAATATGATGAAGTGGGAAGG - Intergenic
940425287 2:153524989-153525011 TCTTCTATCAAGAGGTAGGAAGG - Intergenic
941594754 2:167462003-167462025 TCTGCTATGAAGTGGTGTGAGGG - Intergenic
942538790 2:176994040-176994062 TCTTCTAAGATGAGGTTAGATGG + Intergenic
945566881 2:211412211-211412233 ACTTTTATCAGGAGGTGAGATGG - Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
947129103 2:226903626-226903648 TATTATATGAAGTAGTGACACGG + Intronic
948749066 2:240119070-240119092 TTTTATATGAAGAGGTGATTAGG - Intergenic
949087332 2:242166622-242166644 TGGTATCTGGAGAGGTGAGAGGG + Intergenic
1168762566 20:359436-359458 TCTGAAATGATGTGGTGAGAAGG + Intronic
1171235895 20:23524346-23524368 TCTTATCTGATCAGGAGAGAAGG + Intergenic
1172389594 20:34558189-34558211 TCTCAGAGGATGAGGTGAGAAGG - Intronic
1172432437 20:34903738-34903760 TCTCATATAAAGAGGGGAGCTGG + Intronic
1173355162 20:42280324-42280346 TCTTATCTGATGTGGTGAGAGGG + Intronic
1174883943 20:54310860-54310882 CCTTATAAGAAGAGGAGATAAGG - Intergenic
1178325201 21:31639746-31639768 CCTTATATGAATCTGTGAGAAGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1179032402 21:37732023-37732045 TCTTAGATGAGGAAGGGAGATGG + Intronic
1179128991 21:38617613-38617635 TGTTATATGAAGAGATGAAGGGG - Intronic
1182892868 22:33833412-33833434 CCTTATAAGAAGAGGAGATAAGG + Intronic
1183389489 22:37537064-37537086 TCTTATAGGAAGAGGAGATTTGG + Intergenic
1184266743 22:43351326-43351348 ACTTAGATGAAGAGGTGAAGAGG + Intergenic
949713756 3:6903495-6903517 ACTTATGTGAAAATGTGAGATGG - Intronic
951639344 3:24817793-24817815 TCTTACAAGAAGAGGAGAAAAGG - Intergenic
954816007 3:53281181-53281203 TTTTTTATGACGATGTGAGATGG + Intergenic
955110876 3:55948639-55948661 TCTTTTATGAAGAGGTTATGAGG + Intronic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
956217125 3:66860198-66860220 TCTTATTTGGAGTGGGGAGATGG + Intergenic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962485234 3:135835996-135836018 TCTTATAGGAAAAAGTGAGATGG + Intergenic
962745383 3:138394201-138394223 TGTGAAATGAAGAGGTCAGAAGG - Intronic
962888469 3:139650177-139650199 TATTATATGGAGAAGAGAGAGGG - Intronic
963643189 3:147882602-147882624 ACTTAAATGCAGAGGAGAGAAGG + Intergenic
964281119 3:155066964-155066986 TCTAATGTTAGGAGGTGAGATGG - Intronic
964705503 3:159614696-159614718 GTTTAAATGAAAAGGTGAGAAGG + Intronic
966422659 3:179748695-179748717 TCACAGATGAAGAGTTGAGAGGG + Intronic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969174666 4:5389514-5389536 CCTTATAAGAAGAGGAGAGTAGG - Intronic
971486452 4:27165456-27165478 TCTTATAAGAAGAGGAGATTAGG + Intergenic
972396070 4:38660882-38660904 TCTGAGCTGAAGAGGTGAGTGGG - Intergenic
973125237 4:46574880-46574902 TCTTAGATGAGGAAGTTAGAGGG - Intergenic
973302894 4:48609004-48609026 ATTTATATGCAGAGGTGATAGGG - Exonic
975417393 4:74120751-74120773 TCTTATATACATAAGTGAGATGG + Intronic
975625292 4:76339923-76339945 TCTTATACACAGAAGTGAGATGG + Intronic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
976721697 4:88175025-88175047 TCTTATATGAAGAGGAAATTCGG + Intronic
977409110 4:96638734-96638756 TCTTATATGAACAAGAGAAAAGG - Intergenic
979061712 4:116070025-116070047 TATTTTATTAAGTGGTGAGAGGG - Intergenic
979623313 4:122819724-122819746 TCTTATACACAGAAGTGAGATGG - Intergenic
981537778 4:145817747-145817769 TCCTATAGAAAGAGATGAGAAGG - Intronic
983576207 4:169264300-169264322 TCTTATAAGAAGAGGAGATGAGG - Intronic
985464962 4:190185426-190185448 TGGTATCTGGAGAGGTGAGATGG + Intronic
985822299 5:2168667-2168689 TTTTAGCTGAAGAGGAGAGAGGG + Intergenic
986001545 5:3634545-3634567 ACTTATAAGAAGAGGTGATTAGG + Intergenic
986614438 5:9602050-9602072 TCTTATAAGAAGAGGAGATTGGG + Intergenic
987050941 5:14145542-14145564 TCTGCTATTAAGAGGTAAGACGG - Intronic
987381287 5:17288308-17288330 TCTTATTTGAAGAGATGAGTAGG + Intergenic
987405027 5:17516301-17516323 TCTTAAATGAAAAGATTAGAAGG - Intergenic
987412624 5:17630033-17630055 TCTTAAATGAAAAGATTAGAAGG - Intergenic
988014711 5:25539477-25539499 CCTTATAGGAAGAGGAGAAATGG + Intergenic
990451185 5:55933134-55933156 GCTTATATGAACAGGTAAGTGGG - Intergenic
990790780 5:59476239-59476261 TCTTATGTGATGTGGTGGGAGGG + Intronic
991444253 5:66682683-66682705 ACTTATCTGAAGAGGTGAAGGGG + Intronic
992387118 5:76295330-76295352 CCTTATAAAAAGAGGTGCGAGGG - Intronic
993874327 5:93288743-93288765 CCTTATAAGAAGAGGAGATAAGG - Intergenic
994251786 5:97544231-97544253 CCTTATATGAAGAGGAGATTAGG + Intergenic
994835030 5:104840081-104840103 TCTTATAGGAAAAGGTGAAATGG - Intergenic
995436272 5:112139539-112139561 TCTAATATGATGTGATGAGAAGG + Intergenic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
995861492 5:116645456-116645478 TCTTATACACAGAAGTGAGATGG - Intergenic
996904999 5:128589077-128589099 TCATATATAAAGAGTTGTGAAGG - Intronic
997646125 5:135483136-135483158 AGTTGTATGTAGAGGTGAGATGG + Intergenic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
998010106 5:138688140-138688162 TCTTATAAGAAGAGGAGTGGTGG + Intronic
998158803 5:139801536-139801558 CCTGATATCAAGAGGTGGGAGGG - Intronic
998727621 5:145036084-145036106 ACTTGTATTAACAGGTGAGAAGG - Intergenic
998990202 5:147807014-147807036 TCTTATAAGAGGGGGTCAGAGGG + Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
999332157 5:150682215-150682237 TCTGATATGAAGTGATGAGAAGG + Intergenic
1000006706 5:157192143-157192165 TCTTTTATACATAGGTGAGATGG + Intronic
1000825169 5:166035686-166035708 TTTCATTTGAAGTGGTGAGAGGG + Intergenic
1000830517 5:166095874-166095896 TCCTATATGTAGAGGTGAAGGGG + Intergenic
1001179181 5:169502725-169502747 CCTTATAAGAAGAGGTGATTAGG + Intergenic
1001830830 5:174788032-174788054 TCTTATAAGAAGAGATGTGAGGG - Intergenic
1001899358 5:175411934-175411956 ACTTATATTAATAAGTGAGAAGG - Intergenic
1001900365 5:175422060-175422082 GCTTATACAAAGAGGTGAGTGGG + Intergenic
1003575605 6:7291773-7291795 TGTTATATGCAGATGTGAGCTGG + Intronic
1004310310 6:14539798-14539820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1004867959 6:19872648-19872670 TCTTATATGATGTAATGAGAAGG - Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1006807087 6:36795555-36795577 CCTCATATGAAGAGGTGACTAGG + Intronic
1008809506 6:55478243-55478265 TGTCATACGGAGAGGTGAGAAGG - Intronic
1008954130 6:57196441-57196463 TCTTGTATAAAGAAGTAAGATGG - Exonic
1009674209 6:66795893-66795915 TCTTATACTCAGAAGTGAGATGG - Intergenic
1012614486 6:101260038-101260060 TCTTATACTCAGAAGTGAGATGG + Intergenic
1012692426 6:102330895-102330917 TCTGATATGATGTGATGAGAAGG - Intergenic
1012784901 6:103612043-103612065 TATTATATGATTGGGTGAGAAGG - Intergenic
1013036124 6:106385202-106385224 TCTTATACACAGAAGTGAGATGG - Intergenic
1013849292 6:114494592-114494614 TCTTTAATGCAGAGTTGAGAAGG + Intergenic
1014660013 6:124158251-124158273 CCTTATAAGAAGAGGTGATTAGG - Intronic
1014690840 6:124561532-124561554 TGTTATATGAAGAATTGAGGTGG - Intronic
1015283485 6:131458849-131458871 GCTGACATGAAGACGTGAGAAGG - Intergenic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1017059064 6:150463905-150463927 TCTTATAAGAAGAGGAGATTAGG + Intergenic
1017828699 6:158103921-158103943 CCTTAAATGAAGAGATGTGATGG - Intergenic
1017865993 6:158443664-158443686 TCTTCAGTGAAGAGATGAGATGG + Intronic
1018534392 6:164805080-164805102 TCTTATAAGAAGAGGAGATTAGG - Intergenic
1018549514 6:164979228-164979250 TCTTATGGGAAGGGATGAGAGGG - Intergenic
1019551148 7:1603285-1603307 TCTTATATGAAGAGGAGATCAGG + Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1023503334 7:40873991-40874013 TGTTACATGCAGAGGTGAGCAGG + Intergenic
1024017065 7:45326745-45326767 TATTAAATGAAGAGGAGAAAAGG + Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027508547 7:79050240-79050262 TGTTAAATGAACAGGAGAGAAGG - Intronic
1028692410 7:93668361-93668383 GGGTAGATGAAGAGGTGAGAAGG - Intronic
1030304603 7:108005170-108005192 TCATAGATGAAGTGGTCAGAAGG - Intergenic
1030543460 7:110862902-110862924 TTTTATATGAGGAGGTAAGTGGG - Intronic
1031426343 7:121610120-121610142 CCTTAGAGGAAGAGTTGAGAAGG - Intergenic
1032277140 7:130467875-130467897 CCTTATATGATGTGATGAGAAGG - Intergenic
1032486919 7:132294793-132294815 TCTTAGAAGAAGAGGCGAGTAGG + Intronic
1032488853 7:132308876-132308898 CCTGATATAAAGAGGTTAGAAGG + Intronic
1032745913 7:134785827-134785849 TTTTATATGAACATGGGAGAAGG + Intronic
1035046711 7:155972677-155972699 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1035497394 8:64718-64740 TGGTATCTGGAGAGGTGAGAGGG - Intergenic
1036426468 8:8649489-8649511 ACTTATCAGAAAAGGTGAGAAGG - Intergenic
1037023180 8:13999235-13999257 TCTTATACACAGAAGTGAGATGG - Intergenic
1037980989 8:23254133-23254155 TCCTAGGTGAAGAGGTGAAACGG - Intronic
1038486360 8:27937827-27937849 CCTTATAGGAAGAGGAGATAAGG - Intronic
1038689517 8:29748418-29748440 TCTTATAAGAAGAGGAGATTTGG + Intergenic
1039719612 8:40149291-40149313 TCTTATAAGAAGGAGTCAGAAGG - Intergenic
1040737801 8:50531757-50531779 TCTTAGGAGCAGAGGTGAGATGG - Intronic
1040928444 8:52709778-52709800 CCTTATATGATAAGGTGAAAGGG + Intronic
1040975745 8:53192800-53192822 TCTCAGAAGAAGAGGTGAGAGGG - Intergenic
1041361502 8:57059351-57059373 CCTAAAATTAAGAGGTGAGAGGG - Intergenic
1041662198 8:60411414-60411436 CCTTATATGGAGAGGAGATAAGG - Intergenic
1041842364 8:62286962-62286984 TCTTATATGAAGGGCTGAAAGGG + Intronic
1042209173 8:66361367-66361389 CCTTATATGATGTGATGAGAAGG - Intergenic
1042365068 8:67926631-67926653 TCTCAAATGAAGAAGTGAGATGG - Intergenic
1043168340 8:76932870-76932892 TCATAGATGATGAGGTCAGACGG - Intergenic
1043392763 8:79807577-79807599 GCTTATAAGAAGAGGTGATTAGG + Intergenic
1043395003 8:79827497-79827519 TCTCATAGGAAGATGTGGGAGGG - Intergenic
1043649820 8:82577519-82577541 TTTAATATGATGTGGTGAGAAGG + Intergenic
1043707766 8:83374544-83374566 TCTGAAATAAATAGGTGAGAAGG + Intergenic
1043966487 8:86483037-86483059 TCTTATGAGAAGGGTTGAGAGGG + Intronic
1044045893 8:87431437-87431459 TATTATTTGAACAGGTGAGCAGG - Intronic
1044053221 8:87535749-87535771 TCTTATTTAAAGAGGAGGGAAGG - Intronic
1044704231 8:94993177-94993199 CCTTATAAGAAGAGGAGATAAGG - Intronic
1046233468 8:111389948-111389970 TCTCATATGAAGAGGTTATTGGG - Intergenic
1046256515 8:111704390-111704412 TCATAAATAAAGAGGGGAGAAGG - Intergenic
1046388118 8:113530331-113530353 TCTTATAAGAAGAGATCATATGG - Intergenic
1047266015 8:123309907-123309929 TATTAAATGCAGTGGTGAGAGGG - Intergenic
1047800278 8:128301969-128301991 TCTTCTTTGGAGAGATGAGAAGG + Intergenic
1052235188 9:26204725-26204747 TATTATACGAGGAGATGAGATGG - Intergenic
1052942462 9:34140707-34140729 CCTTATATGATGTGATGAGAAGG + Intergenic
1053104040 9:35395288-35395310 TCTTCTATGAAGCAGTGAGCAGG - Intronic
1055342971 9:75305020-75305042 TGTTAAATGGAGTGGTGAGAGGG + Intergenic
1055950181 9:81723061-81723083 TATTCTTTCAAGAGGTGAGAAGG + Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1056847462 9:90053384-90053406 TCTTATAAGAAGAGGAGATGAGG - Intergenic
1059091924 9:111368628-111368650 CCTTATAGGAAGAGGTGATTAGG + Intronic
1061520099 9:131112721-131112743 TTTTACATGAAGAAGAGAGAAGG + Intronic
1062101658 9:134731650-134731672 CCATCTATGAAGGGGTGAGAGGG + Exonic
1185815378 X:3150282-3150304 CCTTATAAGAAGAGGAGAGGAGG - Intergenic
1185841674 X:3397884-3397906 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1185853484 X:3510707-3510729 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1186764110 X:12753440-12753462 TCAAATATGAAGAGATAAGATGG + Intergenic
1187852406 X:23604311-23604333 TCTTATATAATGAGCTGAGCAGG + Intergenic
1190379169 X:49821983-49822005 TCTGATATGATGTGATGAGAAGG + Intergenic
1193758120 X:85433753-85433775 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1193918465 X:87396995-87397017 TCTTATAAGAAGAGGAGATTAGG + Intergenic
1194266625 X:91761360-91761382 TCTTAAAGGAAGAGGTGCTATGG - Intergenic
1194469253 X:94272307-94272329 GCTTATATTAAGCTGTGAGAAGG + Intergenic
1196967024 X:121067546-121067568 TCTTTGATGAATAGGTGGGATGG - Intergenic
1197781250 X:130162692-130162714 TCCTTTTTAAAGAGGTGAGAAGG + Intronic
1198073367 X:133171164-133171186 CCTTATATGAAGAGGAGATGAGG - Intergenic
1199226774 X:145385317-145385339 TCTTATATGATGTGTTGAGAAGG - Intergenic
1200583828 Y:4982274-4982296 TCTTAAAGGAAGAGGTGCTATGG - Intergenic
1200809948 Y:7473819-7473841 TCTTATAAGAAGAGGAGATAAGG - Intergenic
1201232711 Y:11880116-11880138 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1201265920 Y:12206449-12206471 CCTTATAAGAAGAGGAGAGGAGG + Intergenic