ID: 956153590

View in Genome Browser
Species Human (GRCh38)
Location 3:66269531-66269553
Sequence GATTCCTAATGGAAGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956153587_956153590 3 Left 956153587 3:66269505-66269527 CCCTAATTGATGATTGAGCTGAT 0: 1
1: 0
2: 1
3: 16
4: 104
Right 956153590 3:66269531-66269553 GATTCCTAATGGAAGTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 108
956153588_956153590 2 Left 956153588 3:66269506-66269528 CCTAATTGATGATTGAGCTGATC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 956153590 3:66269531-66269553 GATTCCTAATGGAAGTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956153590 Original CRISPR GATTCCTAATGGAAGTGTGT TGG Intronic
900092749 1:927531-927553 GCTTCCTAGGGGAAGGGTGTGGG - Intronic
903048905 1:20586639-20586661 AATTCCTAATGGAAGGGGCTTGG - Intergenic
905243874 1:36598987-36599009 GATAACTCATGGAACTGTGTGGG - Intergenic
910814504 1:91276190-91276212 GATTCCTAATAGATGTGATTGGG - Intronic
910828019 1:91429685-91429707 GATTCCTAATGGCAGTATAGAGG - Intergenic
911143476 1:94530724-94530746 CTTTCCTAATGTAAGTGTGGTGG - Intronic
919987385 1:202685356-202685378 CATTGCTAATGGAATTCTGTTGG - Intronic
921718174 1:218440041-218440063 TTTTACTAATGGAAGTATGTAGG - Intronic
924551755 1:245084548-245084570 AATTCCTAAAGGAAATATGTTGG - Intronic
1068729902 10:60345656-60345678 GATTCCTAATAAACATGTGTTGG - Intronic
1071686098 10:87759221-87759243 GATACCTAATGCATGTGTATAGG - Intronic
1074659529 10:115637224-115637246 GCTTCCTAAAGGACTTGTGTGGG - Intronic
1081877582 11:46420189-46420211 GAGTCCTACAGGAAGGGTGTAGG - Intronic
1085811255 11:79683575-79683597 GTTTCCTGATGCAAGTGCGTAGG + Intergenic
1086916422 11:92534618-92534640 AATTCATATTGGATGTGTGTGGG + Intronic
1091060468 11:132456631-132456653 GATTCTTCATGGAAGAGAGTTGG - Intronic
1092161082 12:6315906-6315928 GACTGCTGATGGAAGTGAGTGGG + Exonic
1094740947 12:33288018-33288040 GTTTCCTTATGGAACTGTATGGG - Intergenic
1095269255 12:40197152-40197174 GATTCTTAATTAATGTGTGTTGG - Intronic
1099148902 12:79083413-79083435 AACTCCTTATGGAAATGTGTGGG - Intronic
1100182326 12:92099073-92099095 GATTTCTATTGGAAGGGTGGGGG + Intronic
1107992208 13:45828638-45828660 GATTCCTTATGGAAATGTCCTGG - Intronic
1108125318 13:47236493-47236515 GATTTCTAATGCAGTTGTGTTGG - Intergenic
1111104276 13:83625551-83625573 GATTCTTAATTTAAATGTGTGGG + Intergenic
1112059459 13:95723003-95723025 CATTCTTAATTGAAGTCTGTAGG + Intronic
1114650275 14:24280322-24280344 GCTTCCTAAAGGAAGTGAGTGGG + Intergenic
1114887297 14:26869738-26869760 GAGTCCTGATGGAAGTGTTGAGG - Intergenic
1115753131 14:36509615-36509637 TATTCCTGGTGAAAGTGTGTGGG - Intronic
1118405344 14:65417345-65417367 TATTCCAAATGGAAGACTGTTGG - Intronic
1129943481 15:79518918-79518940 GCTTCCTAGAGGAAGTGTGGGGG + Intergenic
1131627977 15:94144461-94144483 GGGTCCTAATGGATGTGTTTTGG + Intergenic
1137660251 16:50199356-50199378 GTTTCCCAAAGAAAGTGTGTGGG + Intronic
1138807805 16:60111578-60111600 GATTCCTCATGCAAGGCTGTGGG + Intergenic
1144458453 17:15437858-15437880 GAATCCGCATGTAAGTGTGTGGG + Exonic
1147286824 17:39409001-39409023 GATTCCTAAGGGAACAGTGATGG - Exonic
1148165813 17:45483399-45483421 GCTTCCTCCTGGAAGTGGGTGGG + Intronic
1157795905 18:50575040-50575062 AATTCCTAATGCAACAGTGTTGG + Intronic
1158445090 18:57512670-57512692 GTTTCCTAAAGGACTTGTGTGGG - Intergenic
1158719559 18:59912303-59912325 GATTCCTTATGGACAAGTGTTGG + Intergenic
1159992273 18:74922765-74922787 GATTCCTTATCGAAGAGTCTAGG + Intronic
1164883696 19:31759384-31759406 CAATCCTAATCAAAGTGTGTTGG - Intergenic
1165135442 19:33665561-33665583 GATGGCAAATGGAAATGTGTTGG + Intronic
925500880 2:4503412-4503434 GAGTCCCACTGGAAGTGTGGTGG + Intergenic
925818276 2:7774505-7774527 GCTTCTTAGTGGAAGTGTGCTGG - Intergenic
927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG + Intronic
927877026 2:26664801-26664823 GATTTCTATTGGGATTGTGTTGG + Intergenic
930305609 2:49670911-49670933 AATTCCTAATGCAACAGTGTTGG + Intergenic
930616072 2:53595522-53595544 GATTCCTAATGAGATTGTATGGG + Intronic
933591877 2:84242204-84242226 TCTTCCTAATGGAATTGTCTTGG + Intergenic
934138626 2:89022350-89022372 GATTCCTAATACAAATTTGTTGG + Intergenic
934144719 2:89080411-89080433 GATTCCTAATACAAATTTGTTGG + Intergenic
934224536 2:90120140-90120162 GATTCCTAATACAAATTTGTTGG - Intergenic
934230621 2:90178213-90178235 GATTCCTAATACAAATTTGTTGG - Intergenic
936733287 2:115408632-115408654 GATTCCTAATAGAATTGTATTGG - Intronic
936969004 2:118157094-118157116 GATTTTTAATGGAAGTGCATTGG - Intergenic
937017568 2:118619654-118619676 GATTCCTTGTGGAAATGTATGGG - Intergenic
940062810 2:149591347-149591369 GATTCCTAGTTAAAGTCTGTGGG + Intergenic
944286599 2:197957154-197957176 AATTCCTAGTGGAAGTGAGTTGG - Intronic
946409011 2:219507273-219507295 GATTCCGAAGGGAAGGGTGAAGG + Intergenic
947694694 2:232175225-232175247 GTTTTCTCATGGAAGAGTGTTGG + Intronic
948687966 2:239682692-239682714 GACTCCAGATAGAAGTGTGTTGG + Intergenic
1171400059 20:24867375-24867397 GTTTCAGAGTGGAAGTGTGTGGG + Intergenic
1171418842 20:25003430-25003452 TATTCCAAATGGAAGTTTGGAGG + Intergenic
1173267543 20:41498740-41498762 GAGTCCTAATGGAAACGTGGGGG - Intronic
1181320065 22:21997706-21997728 GATTCCTAAGGGCAGTGGGTGGG - Intergenic
1181933952 22:26426943-26426965 GTTTCCCAATGCAAGTGTTTTGG + Intergenic
1183879410 22:40814323-40814345 GTTTCATCATGGCAGTGTGTTGG - Intronic
1184308783 22:43627812-43627834 AGTTCCTCATGCAAGTGTGTGGG + Intronic
949229328 3:1731818-1731840 GATACCTAAAGCATGTGTGTGGG - Intergenic
950854163 3:16089827-16089849 GATTCATGTTGGAAGTGTGAGGG + Intergenic
951105155 3:18733666-18733688 GTTTCCTAATGAAAGACTGTAGG - Intergenic
952613913 3:35246069-35246091 GATTCCTAATTCAAGTTTTTGGG + Intergenic
956153590 3:66269531-66269553 GATTCCTAATGGAAGTGTGTTGG + Intronic
958001543 3:87756573-87756595 GATTTCTAATAGAATTCTGTGGG + Intergenic
958196078 3:90244213-90244235 AATTCCCAATGGAACAGTGTTGG - Intergenic
958419272 3:93912856-93912878 AATTCCCAATGGAACAGTGTTGG - Intronic
959720226 3:109478690-109478712 GATGCCTAATGGGGGTGTTTGGG + Intergenic
960030865 3:113053523-113053545 GGTTCCTAATGGAAGAGTATGGG + Intergenic
961065690 3:123874102-123874124 AATTCCTGATGGAAGTCTGTTGG - Intronic
963765595 3:149332960-149332982 TAGTCCTAATGAAAGTCTGTGGG - Intronic
964147602 3:153484168-153484190 AATTCCTCCTGTAAGTGTGTGGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973812853 4:54589131-54589153 GATTACTATTTGAAGGGTGTAGG + Intergenic
974243365 4:59281589-59281611 TCTTCCTAATGGAGGTATGTAGG - Intergenic
980334416 4:131452069-131452091 GAGTCATAATGGAAATGAGTTGG - Intergenic
980621373 4:135309023-135309045 GATTCCCAATGCAACAGTGTGGG + Intergenic
981621383 4:146703554-146703576 GAGGCCTAATGGAGGTGTTTAGG - Intergenic
982657239 4:158164964-158164986 GAATTTAAATGGAAGTGTGTGGG + Intronic
985046714 4:185948121-185948143 GATTCCTGAAGGAAGAGTCTAGG - Intronic
986524904 5:8663414-8663436 GAGGCCTAATGGAGGTGTTTGGG + Intergenic
991588194 5:68220953-68220975 AATCCCTAATGCAACTGTGTTGG + Intronic
993936173 5:94005694-94005716 GTTTTCTAATGGAATTGTTTGGG - Intronic
1001009010 5:168081083-168081105 GATTCATAATGCAAGTGCTTAGG - Intronic
1003004654 6:2369568-2369590 AATTCCTAATGGGGGTGGGTTGG - Intergenic
1007255027 6:40522462-40522484 GATTCCTGGGGGAAGTGGGTAGG + Intronic
1009330675 6:62416103-62416125 TTTTCCTATTGGAAGTGTTTAGG - Intergenic
1009630271 6:66189711-66189733 GATTCCTCATGCAATTTTGTGGG - Intergenic
1009940675 6:70283979-70284001 GTTTTCTAATGGAAATGGGTTGG + Intronic
1011972280 6:93241458-93241480 GATTACAAATGGAAGTGTCTAGG + Exonic
1013794888 6:113876383-113876405 TATTACTGCTGGAAGTGTGTAGG + Intergenic
1015503768 6:133960359-133960381 TATTGCTAATGGAAATCTGTAGG + Intronic
1024773611 7:52755963-52755985 GCTTCCTAATGTCAGTTTGTTGG - Intergenic
1030879835 7:114864155-114864177 TATTAGTAATGGAAGTGAGTTGG + Intergenic
1037087308 8:14868429-14868451 GTTTCATAATGGAATTGGGTAGG - Intronic
1037779332 8:21856892-21856914 GATTCCTGATGGAGGTGGGGAGG - Intergenic
1037780501 8:21865221-21865243 GGTGCCTAATGAGAGTGTGTTGG - Intergenic
1038458892 8:27699299-27699321 GATTTTGATTGGAAGTGTGTAGG - Intergenic
1043956511 8:86366177-86366199 GATTCCTAGTGGGAGATTGTGGG + Intronic
1052117096 9:24662609-24662631 GATTGATAAGGGAACTGTGTAGG - Intergenic
1052651333 9:31306552-31306574 GAATCTTAATAGAAGTGTGTGGG - Intergenic
1056254894 9:84788885-84788907 ACTTCCTAATGGATGGGTGTGGG - Intronic
1189031442 X:37455479-37455501 TATTCCTAATCTGAGTGTGTGGG + Exonic
1190818938 X:53954873-53954895 AAATCCTAATGGAATTTTGTGGG - Intronic
1194958288 X:100206664-100206686 GAGTCCTAATGAATCTGTGTGGG + Intergenic
1195407743 X:104535266-104535288 AATTCCTAATGCAACAGTGTTGG + Intergenic
1196751604 X:119122777-119122799 GATTCTTAATGGCAGTGCTTGGG - Intronic
1200874753 Y:8141488-8141510 GATTTCTAATGGAAATGTGCTGG - Intergenic
1201467648 Y:14301826-14301848 GGTATCTAATTGAAGTGTGTAGG + Intergenic