ID: 956162550

View in Genome Browser
Species Human (GRCh38)
Location 3:66370571-66370593
Sequence CATGGGGTCTGGCGGTCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956162542_956162550 12 Left 956162542 3:66370536-66370558 CCAGCACTGCTGATGGGAATGTG 0: 1
1: 1
2: 7
3: 95
4: 445
Right 956162550 3:66370571-66370593 CATGGGGTCTGGCGGTCACAGGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956162550 Original CRISPR CATGGGGTCTGGCGGTCACA GGG Exonic
900099159 1:953728-953750 CATGGGGTCGGGGGGCCACACGG - Intronic
900357145 1:2270462-2270484 CGAGAGGTCAGGCGGTCACAGGG + Intronic
901513043 1:9727403-9727425 CCTGGCGCCTGGCGGTCACCTGG + Exonic
902512506 1:16974149-16974171 CATGGGGTGGGGGGGGCACAGGG - Intergenic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
904242988 1:29162602-29162624 CATGGCGTCAGGCTCTCACATGG - Intronic
905282770 1:36859708-36859730 CCTGGGGTCTGGCTGACACATGG + Intronic
905528291 1:38655916-38655938 CATGGGGTCGGGGGTTCTCAGGG + Intergenic
910480719 1:87655531-87655553 CTTTGGGTCTGGCAGTCACTCGG - Intergenic
916705194 1:167342053-167342075 CCTGGGGTCTGGGGGTTATATGG + Intronic
919909445 1:202101758-202101780 CTTGGGGCCTGGCGGGCCCAGGG + Intergenic
920137096 1:203778731-203778753 CATGGGGCCTGGCACTCAGAAGG + Intergenic
924744474 1:246818929-246818951 CATGGGGTGGGGGGGGCACAGGG + Intergenic
1063073878 10:2695055-2695077 CATGGGGTATTGGGGTCACCTGG + Intergenic
1063665112 10:8056126-8056148 CCTGGGGCCTGGCGCTCACCTGG + Intronic
1070568398 10:77621066-77621088 CACGGGGTTTGGCAGGCACACGG + Intronic
1074872551 10:117588453-117588475 CATTAGGTCTTGTGGTCACAGGG - Intergenic
1075728239 10:124621487-124621509 CATGGGGTATGCCGGGCACTGGG - Exonic
1075897006 10:126005107-126005129 CATGGGGTCTGGCAGAAGCAGGG + Intronic
1075967881 10:126628524-126628546 CTTGAGGTCTGGTGGTCACTGGG + Intronic
1076405113 10:130206546-130206568 CAGGGAGTCCTGCGGTCACACGG + Intergenic
1077445347 11:2588104-2588126 AAGGGGGTCTGGAGGTCACAGGG + Intronic
1078103397 11:8343494-8343516 TATGTGGTCTGGTGCTCACAGGG - Intergenic
1078602852 11:12748866-12748888 CAGGGGGACTGGGGGTCAAATGG + Intronic
1079097720 11:17521652-17521674 CATGGAGTGTGGCCTTCACATGG - Intronic
1080382786 11:31791245-31791267 TATGGGCTCTGGGGGTCATAGGG - Intronic
1089281128 11:117375279-117375301 CAAGGGGCCTGGGGGTCAGATGG - Intronic
1093986028 12:25534519-25534541 CAAGGTGGCTGGAGGTCACAAGG + Intronic
1097700093 12:62811097-62811119 CATGGGGTATGGGGGGCACACGG + Intronic
1100118767 12:91343392-91343414 CATGGGATCTGGCAGTCAAATGG - Intergenic
1104134890 12:125928030-125928052 CATGGGCTCAGGTGTTCACAGGG - Intergenic
1104728551 12:131092707-131092729 CCTGGGGCCTGGTGGTCACAGGG + Intronic
1110354808 13:74555232-74555254 CATGGGGTGTGCCTGTCCCATGG - Intergenic
1113922367 13:113920257-113920279 CATGGGGCCTGGCACACACACGG - Intergenic
1118474262 14:66102168-66102190 CCTGGGGTCTGGCACTTACATGG - Intergenic
1121754430 14:96391541-96391563 CATCGGGTCAAGCGGACACAGGG + Intergenic
1121787551 14:96673811-96673833 AATGGGGTCTTGGTGTCACAGGG - Intergenic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1125335565 15:38623064-38623086 GGTGGGGTCAGGCGTTCACAGGG - Intergenic
1127060392 15:55176894-55176916 CATGGGGCCTGCCTGGCACATGG - Intergenic
1127257196 15:57302376-57302398 CATGGGTTTTGGTGTTCACAGGG - Intergenic
1128632825 15:69282772-69282794 GCTGGGCTGTGGCGGTCACACGG + Intergenic
1130154404 15:81337266-81337288 CTTGGGGTCTGGAGGACCCAGGG + Intronic
1132571319 16:645654-645676 CCTGGGGTCGGGTGATCACATGG - Intronic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1139664413 16:68446752-68446774 CAAGGGGCCTGGAGTTCACAGGG - Intronic
1139955523 16:70691302-70691324 CAGGGAGACTGGAGGTCACAGGG + Intronic
1141474666 16:84264745-84264767 CCTTGGGTCTGGGGGTAACAGGG - Intergenic
1141744365 16:85915634-85915656 CATGGCGGCTGCCGGGCACAAGG - Intronic
1142027096 16:87820167-87820189 CCTGGGGTCTGCAGGTCACGTGG + Intergenic
1142403209 16:89871876-89871898 CGTGGGGCCTGGAGGTCAGAAGG + Intergenic
1143685867 17:8515088-8515110 CCTGGAGTCTGTCGGTCACTTGG - Intronic
1144314341 17:14045854-14045876 GATGGGGGCTGGGGGTCAAAGGG + Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146060166 17:29600726-29600748 CAGGGGGGCTGGGGGTCACCTGG + Intronic
1147000026 17:37355478-37355500 CATGGGAGGTGGAGGTCACAGGG + Intronic
1147952301 17:44114006-44114028 CATGGGGCCTGGCTGGCACATGG - Intronic
1151403396 17:73871040-73871062 CATTGGGTCTGGGGGTGGCAGGG - Intergenic
1151928809 17:77217813-77217835 CAAGGGGTCTGGCTGGCACCTGG + Intergenic
1152539766 17:80969092-80969114 CACGGGGTCTGGCAGTGGCAGGG - Intergenic
1152794298 17:82299304-82299326 CGTGGGAGCTGGAGGTCACAGGG + Intergenic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1157944031 18:51958729-51958751 CATGGTGACTGGCTGTCCCATGG - Intergenic
1162585965 19:11558814-11558836 AATGGGGTCTGGCTTGCACAAGG + Intronic
1163322733 19:16584040-16584062 CAAGAGGTCTGGCTGTCCCAGGG + Intronic
1163485042 19:17580521-17580543 CCAGGGGTCTGGCGGTCATGGGG - Intronic
1163511089 19:17735454-17735476 CACAGGGTCTTACGGTCACAGGG + Intergenic
1165444667 19:35850296-35850318 CCTGGGGTCTGGGGTTCCCATGG + Intronic
1166631728 19:44412578-44412600 CATGGGCTCTGGCAGCCACGTGG - Intergenic
1166636449 19:44456043-44456065 CATGGGCTCTGGCAGCCACGTGG + Intergenic
1202648519 1_KI270706v1_random:161065-161087 CATGGGCTCTGGCAGCCACGTGG + Intergenic
927495497 2:23549098-23549120 CTTGGGCCCTGGAGGTCACAGGG + Intronic
927805011 2:26139386-26139408 CAAGGGTTCTAGAGGTCACATGG + Intergenic
928372825 2:30753398-30753420 TCTGGGGTCTGCCGGTCACCTGG + Intronic
929865072 2:45710676-45710698 CTTGGGGACTGGCTGTCACAGGG + Intronic
931881767 2:66576620-66576642 CCTGGGGGCTGGAGGGCACATGG + Intergenic
937473851 2:122196752-122196774 GATGGGGGCTGGAGGGCACAAGG - Intergenic
938269182 2:129954187-129954209 CATGGGGTCTGACTTCCACAGGG + Intergenic
941099755 2:161282544-161282566 CATGGGCTCTGGCAGCCACGTGG - Intergenic
941754171 2:169166851-169166873 CATGTGGTCTGTCTTTCACATGG + Intronic
945226171 2:207532645-207532667 GATGGGGTCTCGCTGTCACCAGG - Intronic
1168975085 20:1958828-1958850 CAAGGTGTCTGGAGTTCACAGGG + Intergenic
1170375100 20:15691647-15691669 CATGGTGCCTGGCGCTCACTAGG + Intronic
1171870190 20:30519119-30519141 CATGGGCTCTGGCAGCCACGTGG + Intergenic
1172526513 20:35603036-35603058 CACGCTGTGTGGCGGTCACACGG + Intergenic
1176041861 20:63069937-63069959 CCTGGGGACTGGCGGGCACAGGG - Intergenic
1176171934 20:63699990-63700012 CACGGGGTCACGGGGTCACAGGG + Exonic
1176603335 21:8811622-8811644 CATGGGCTCTGGCAGCCACGTGG - Intergenic
1177321253 21:19523879-19523901 TATGGGGTGTGGCGGTGTCACGG + Intergenic
1178058609 21:28827105-28827127 CATGGGGTCTGGCATTGAGATGG - Intergenic
1179913597 21:44462705-44462727 CCTGGGGTGTAGAGGTCACACGG - Intergenic
1180345620 22:11703179-11703201 CATGGGCTCTGGCAGCCACGTGG - Intergenic
1180940526 22:19657453-19657475 CCTGGGGTCTGGCGTTTACCTGG - Intergenic
1181198416 22:21204139-21204161 CATGGGCTCTGGCGGGCAGTAGG - Intergenic
1181506336 22:23360766-23360788 CATGGGGTCTGCTGGTTATATGG - Intergenic
1184280198 22:43433106-43433128 CATGGGGAGTGGGGGTCACTGGG + Intronic
1185113913 22:48920365-48920387 CAGGTGGTCAGGGGGTCACAGGG + Intergenic
1203228391 22_KI270731v1_random:90698-90720 CATGGGCTCTGGCGGGCAGTAGG + Intergenic
953750842 3:45607284-45607306 CACAGGGTCTCGGGGTCACACGG + Intronic
953897377 3:46812549-46812571 CATGGGTTCTGGCGGCAACTTGG + Exonic
956162550 3:66370571-66370593 CATGGGGTCTGGCGGTCACAGGG + Exonic
963908475 3:150794215-150794237 TATGGGGCCTGTTGGTCACAGGG - Intergenic
964763575 3:160157264-160157286 CCTGGGTTCTGGCAGTGACAGGG + Intergenic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
967941544 3:194770343-194770365 CACGAGGTCAGGAGGTCACAAGG - Intergenic
973374743 4:49279029-49279051 CATGGGCTCTGGCAGCCACGTGG + Intergenic
973375646 4:49285051-49285073 CATGGGCTCTGGCAGCCACGTGG + Intergenic
973376544 4:49291070-49291092 CATGGGCTCTGGCAGCCACGTGG + Intergenic
973379775 4:49312005-49312027 CATGGGCTCTGGCAGCCACGTGG - Intergenic
973381765 4:49325190-49325212 CATGGGCTCTGGCAGCCACGTGG - Intergenic
973382668 4:49331212-49331234 CATGGGCTCTGGCAGCCACGTGG - Intergenic
977773113 4:100882606-100882628 CATGGTGTCTGGGGCTAACAGGG + Intergenic
991647762 5:68818494-68818516 CCTGGCGTCAGGCGGCCACAAGG - Intergenic
999195720 5:149780236-149780258 CCTGGGGCCAGGTGGTCACACGG - Intronic
999237255 5:150106367-150106389 CCTGGGGTCTGGAGGTTCCAGGG - Intronic
999757523 5:154676043-154676065 CTTGGGGGCTGGCTATCACAGGG - Intergenic
999837602 5:155391485-155391507 TATGGGGTCTGGTGGTGAGAGGG - Intergenic
1002044106 5:176532443-176532465 CATGGGCTCTGGCAGTGACTAGG - Exonic
1002350353 5:178578787-178578809 CATGCGGTATGGCGGCAACACGG - Intronic
1003452658 6:6250031-6250053 CATGGAATCTGGTGGTCACAGGG - Intronic
1003835606 6:10069412-10069434 CATGGGGTGTAGGGGGCACAGGG - Intronic
1005854783 6:29852696-29852718 CATGGTGGCTGGTGGGCACAGGG - Intergenic
1008382324 6:50849435-50849457 CACCGGATCTGGCGGTCTCAGGG - Intergenic
1008972452 6:57385552-57385574 AATGGGGTCTGGAGGTTAGATGG - Intronic
1012670020 6:102032439-102032461 GATGGGGCCTGGAGGTCAGAAGG + Intronic
1014571699 6:123016620-123016642 CAAGGGGTTTGGCTGTAACAAGG + Intronic
1015734368 6:136381992-136382014 GATGCAGTGTGGCGGTCACACGG + Intronic
1017107852 6:150904993-150905015 CATGAGGTCTGGCTCACACAGGG - Intronic
1018369703 6:163156465-163156487 CATGGGGCGTGGCGGTCGTAGGG - Intronic
1019337417 7:491920-491942 CCTGGGGTCTAGAGGTCTCATGG + Intergenic
1019506677 7:1394950-1394972 CTTGGGGTCTGTCTGCCACAGGG + Intergenic
1020432462 7:8127949-8127971 CTTGGGGTCTGGCTCTCCCAGGG + Exonic
1026100943 7:67384183-67384205 CTTGGGATCTGTTGGTCACAGGG - Intergenic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1029593091 7:101520220-101520242 GATGGGGTCTGAAGGTCTCAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035042791 7:155942732-155942754 CATGGGGAGGGGCTGTCACAGGG + Intergenic
1035621170 8:1036584-1036606 CATGGGGCCTGGGGGTTATAAGG + Intergenic
1036633696 8:10532802-10532824 GATGGGGGCTGGGGGACACAGGG + Intronic
1036643768 8:10599797-10599819 CCTGGGGTCCGGAGGTCCCAAGG + Intergenic
1039473155 8:37826314-37826336 GATGGGGTCTGGCGGCAAAACGG + Intronic
1043494036 8:80780584-80780606 CATGGGACCTGGGGCTCACACGG - Intronic
1044529806 8:93294155-93294177 CATGGGGCCTGGCTTTCCCAAGG + Intergenic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1050918974 9:11175048-11175070 AATGGAGTCTAGCGTTCACATGG + Intergenic
1051983766 9:23057440-23057462 CCTGGGGTCTGGGGTTTACATGG - Intergenic
1053544519 9:39009346-39009368 CCTGGGGCCTGGAGGCCACAAGG - Intergenic
1053607898 9:39679436-39679458 CAGGGGGTCAGGGGTTCACAGGG - Intergenic
1053808951 9:41832828-41832850 CCTGGGGCCTGGAGGCCACAAGG - Intergenic
1053865741 9:42435796-42435818 CAGGGGGTCAGGGGTTCACAGGG - Intergenic
1054245636 9:62662973-62662995 CAGGGGGTCAGGGGTTCACAGGG + Intergenic
1054559761 9:66697504-66697526 CAGGGGGTCAGGGGTTCACAGGG + Intergenic
1054621641 9:67354600-67354622 CCTGGGGCCTGGAGGCCACAAGG + Intergenic
1057142431 9:92735481-92735503 CATGGGGGCAGGAGGTCCCAGGG + Intronic
1057826789 9:98377848-98377870 CACAGGGACTGGCTGTCACAGGG - Intronic
1057893033 9:98883760-98883782 CATGGGGTATTGGGGACACAAGG - Intergenic
1060391692 9:123283044-123283066 CATGGGATCTGGTGGACACAGGG - Intergenic
1203550798 Un_KI270743v1:164042-164064 CATGGGCTCTGGCAGCCACGTGG - Intergenic
1189207919 X:39257620-39257642 CATGGGGTTTGGGTGTGACAGGG - Intergenic
1191576101 X:62707828-62707850 CATGGGGTGTGGTGATCACATGG + Intergenic
1191586565 X:62833760-62833782 CATGGGGGCTGGGCTTCACAAGG - Intergenic
1192219634 X:69188652-69188674 CATGCAGTCTGGAAGTCACAAGG + Intergenic
1193363989 X:80608629-80608651 CAGGGGGTCAGGAGCTCACAGGG - Intergenic