ID: 956163667

View in Genome Browser
Species Human (GRCh38)
Location 3:66380487-66380509
Sequence GGTTCGTTCTTTCCTTGTAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956163667 Original CRISPR GGTTCGTTCTTTCCTTGTAG GGG (reversed) Exonic
903804991 1:25998901-25998923 GCTACGTTCTTTCCTTATATCGG - Intergenic
904041790 1:27589813-27589835 GGTTGGTTCTCTCCTTGGACAGG - Intronic
906053596 1:42895951-42895973 TGTTTGTATTTTCCTTGTAGAGG + Intergenic
912857953 1:113188599-113188621 CCTTCCTTCTTTCCTTATAGTGG + Intergenic
916370105 1:164082612-164082634 GGTTCGTTCTCTACTTTTAAGGG - Intergenic
917565095 1:176205568-176205590 GTTTCGTACTTTCCTTTTTGAGG - Intronic
918846538 1:189622192-189622214 GCCTCCTTCTCTCCTTGTAGTGG - Intergenic
1068274725 10:54779178-54779200 GGTTACTTATTTCATTGTAGTGG - Intronic
1068469819 10:57447391-57447413 GGTTCTTAGTTTCCTTGTATTGG + Intergenic
1070868855 10:79730295-79730317 GGTTGGTTCTCTCTTTTTAGGGG - Intergenic
1071659474 10:87485462-87485484 GGTTGGTTCTCTCTTTTTAGGGG + Intergenic
1071668592 10:87585725-87585747 GTTTAATTCTTTCCTTTTAGTGG - Intergenic
1075551446 10:123395614-123395636 GGTTCCTTCTTCCCTTGGAGTGG - Intergenic
1077933812 11:6761647-6761669 AGTTCCTTCTTTCCTTATGGAGG + Intergenic
1085233679 11:74994489-74994511 GCTTCCTTCTATCCTTGCAGAGG + Exonic
1091416770 12:294676-294698 GTTTCCTTCTTTCCATGTAATGG - Intronic
1093290761 12:17318705-17318727 TTTTCCTTGTTTCCTTGTAGAGG + Intergenic
1097424209 12:59422262-59422284 GGTCCGTTATTTTCTTGTTGAGG - Intergenic
1098074444 12:66713656-66713678 GGTTGGTAGTTTCCTTGAAGAGG - Intronic
1101529730 12:105563009-105563031 GGTTCTTTCTTTCTTTTTTGGGG + Intergenic
1107042264 13:35961385-35961407 AGTTTGTCCTTTCCTTGTACTGG + Intronic
1110871137 13:80453288-80453310 GGTTTGTTCTTTTCTTCTTGAGG - Intergenic
1117184714 14:53227958-53227980 CCTTTGTTCTTTTCTTGTAGTGG + Intergenic
1119690966 14:76672221-76672243 GGTTCATTCTCACCTTGGAGGGG - Intergenic
1121981777 14:98460827-98460849 AGTACCTTCTTTCCTTGTTGAGG + Intergenic
1133167257 16:3957109-3957131 TCTTCGTTCTTTCCTTGAAAAGG + Intronic
1136021669 16:27444516-27444538 GGTGCATCCTTTCCTTGTACTGG + Intronic
1137471764 16:48766884-48766906 GATATGTTATTTCCTTGTAGTGG - Intergenic
1138195088 16:55045985-55046007 CTTTTGTTCTTTCTTTGTAGTGG - Intergenic
1139619274 16:68123989-68124011 GGTTCTTTTTTTTTTTGTAGGGG - Intronic
1142654885 17:1384999-1385021 GGTTTGTTTTTTCTTTTTAGAGG + Intronic
1143139315 17:4732039-4732061 GGCCCATTCTTTCCTTTTAGAGG - Intronic
1150103101 17:62441278-62441300 GGTTCTTCATTTCCTTGTTGTGG + Intronic
1150197440 17:63315101-63315123 GCTTCGTTGTGTCCTTGAAGGGG + Intronic
1153838165 18:8982947-8982969 GGTCCCTTCGTTCCTGGTAGTGG - Intergenic
1155485825 18:26341373-26341395 TGTTCTTTCTTTCCTTCCAGAGG + Intronic
1158297540 18:56015467-56015489 GGTTCTTACTTTCCTTGCATTGG + Intergenic
928449692 2:31367201-31367223 GTGTCGTTCTTTCTTTGTTGTGG - Intronic
929838156 2:45427077-45427099 GGTTCTTAGTTTCCTTGTATTGG - Intronic
929953004 2:46431138-46431160 GCTTTGTTCTTTGCTTCTAGTGG + Intronic
931480534 2:62634500-62634522 GGTTCGTAGTTTCCTTGCATTGG - Intergenic
933398176 2:81757943-81757965 GGTTCTTTCTTTTCTTCTACTGG - Intergenic
934868464 2:97836829-97836851 GTTACTTTCTTTCCATGTAGTGG + Intronic
936479540 2:112872860-112872882 GGGTCCTTCTATCCTTCTAGAGG + Intergenic
944178954 2:196865929-196865951 GGTTTGTAGTTTCCTTGAAGAGG - Intronic
1168764474 20:372401-372423 GGTTCTCTCTTTCTGTGTAGTGG - Intronic
1170862785 20:20123916-20123938 GTTTTGTAGTTTCCTTGTAGAGG + Intronic
1171271627 20:23822757-23822779 TGTTCTTTGTTTCCATGTAGGGG + Intergenic
1171458789 20:25286874-25286896 GTTTCCTTCTTTCCTAGTTGTGG + Intronic
1174119572 20:48252574-48252596 GGTTAGATCTTTCTTTGTTGTGG - Intergenic
1174123678 20:48287150-48287172 GTTTCTTTCTTCCCTTGCAGGGG + Intergenic
1175130130 20:56782555-56782577 GGAGCGTTCCTTCCTTCTAGCGG + Intergenic
1176714577 21:10339866-10339888 TGTTCGTTCTTTCCTTTTTTGGG - Intergenic
949586246 3:5441111-5441133 GGTTAGTTCATTCCTGCTAGAGG + Intergenic
949959543 3:9300841-9300863 GGTTGGATCATTCCTTGTTGTGG - Intronic
951058621 3:18177851-18177873 GTTTTGTTCATTCATTGTAGGGG + Intronic
952267614 3:31801679-31801701 GCTTCTTTCTTTCCTTGCAATGG - Intronic
952478114 3:33732100-33732122 GGTTGGTTTTTTCCTTCTGGAGG - Intergenic
954497569 3:50979219-50979241 GTTTTGTAGTTTCCTTGTAGAGG + Intronic
956163667 3:66380487-66380509 GGTTCGTTCTTTCCTTGTAGGGG - Exonic
957217997 3:77346731-77346753 GGTTAGTTCTCACCTTCTAGTGG + Intronic
960278308 3:115752101-115752123 GGTTCTTTGTTTCCTTGCATTGG - Intergenic
962677330 3:137766622-137766644 AGTTCATTCATTCCTTGAAGTGG - Intergenic
964049340 3:152372216-152372238 GGTTCTTAGTTTCCTTGCAGTGG + Intronic
964142868 3:153423052-153423074 GATTCTTTGTTTCCTTGTATTGG - Intergenic
967748534 3:193087066-193087088 CATTCTTTCTTTCCTTGGAGTGG + Intergenic
976967046 4:91056203-91056225 GGTTTGTTTTTTCCTTTGAGAGG + Intronic
979515961 4:121610688-121610710 TGTTCTTTATTTCCTTGTTGGGG - Intergenic
980280409 4:130711349-130711371 CCTTCCTTCTTTCCTTGCAGGGG + Intergenic
981909409 4:149961379-149961401 GGTTTGTTGTTTTCTTTTAGGGG + Intergenic
982447686 4:155512797-155512819 AGCTCTTTCTTTCCTTTTAGGGG - Intergenic
982792257 4:159606658-159606680 GGGTCGTTCTTTCCTTATGAAGG + Intergenic
994588927 5:101749079-101749101 GGATCATTCTTTCCTTTTAAGGG + Intergenic
997080176 5:130728973-130728995 GTTTCTTTCTTTCCTTTTTGTGG - Intergenic
1000894326 5:166836862-166836884 TGTTCTTTCTTTCTTTTTAGTGG + Intergenic
1005572588 6:27159358-27159380 GATTTGTTCTTTCCTTCTTGGGG + Intergenic
1007310472 6:40941642-40941664 GTTTTGTAGTTTCCTTGTAGAGG - Intergenic
1009539070 6:64927354-64927376 GGATATTTCTTTTCTTGTAGAGG - Intronic
1009640780 6:66332860-66332882 GGTCTGTTCTTTCCTGGAAGAGG + Intergenic
1018056260 6:160054907-160054929 GATGCGTTCTTTCCCTGCAGTGG + Intronic
1027052727 7:75029988-75030010 CTTTCGTTATTTTCTTGTAGAGG - Intronic
1030019971 7:105263935-105263957 CTTTCTTTCTCTCCTTGTAGAGG - Intronic
1030390853 7:108926717-108926739 GGTTTGTAGTTTCCTTGAAGAGG + Intergenic
1031876128 7:127142981-127143003 GGTTGGTTCTCTCCTTGGAGTGG - Intronic
1032032291 7:128494462-128494484 GGTTCTTCATTTCCTTGTTGTGG + Intronic
1033889108 7:145986460-145986482 TGTTTGTTCTTACCTTCTAGAGG - Intergenic
1038593295 8:28860893-28860915 TGTTGGTTCTATCTTTGTAGTGG + Intronic
1038999474 8:32963651-32963673 GGTTTGCTCTTTTCTTGTACTGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1043128793 8:76434606-76434628 GGTAAGTTCTTTCCTTGGGGTGG + Intergenic
1043949862 8:86296849-86296871 GATTCTCTCTTTCTTTGTAGAGG - Intronic
1044630824 8:94277081-94277103 GATTCCTCCTTTCCTTGTATTGG - Intergenic
1049740370 8:144237782-144237804 GGTTCCTTGTTTCCCTGTTGCGG + Intronic
1050037473 9:1452470-1452492 GGTTTGTAGTTTCCTTGAAGAGG + Intergenic
1050965518 9:11796581-11796603 GGTTTGTTATTTCCTTATTGCGG - Intergenic
1053419581 9:37968979-37969001 GGTTCGTGCTTTCATTGGAGGGG - Intronic
1058264023 9:102874920-102874942 AGTTCATTCTTTCATTGCAGAGG + Intergenic
1060422553 9:123479764-123479786 GATTCGTTTGATCCTTGTAGGGG - Intronic
1187001494 X:15184255-15184277 GTTTTGTGTTTTCCTTGTAGAGG + Intergenic
1192018588 X:67358971-67358993 GGTTCTTTGCTTCCTTGTATTGG - Intergenic
1193284491 X:79696196-79696218 GGTTCGTTGCTTCCTTGCATTGG + Intergenic
1194094960 X:89627981-89628003 GTTTTGTAATTTCCTTGTAGTGG + Intergenic
1195580144 X:106492744-106492766 GGTTCTTACTTTCCTTGCATTGG + Intergenic
1197426417 X:126302403-126302425 GTGTGGTTCTTTCCTTGTGGTGG - Intergenic
1200698365 Y:6381176-6381198 GGGTCATTTTCTCCTTGTAGGGG - Intergenic
1200939565 Y:8767611-8767633 GGTTTGTTGTTTCATTGTAGGGG - Intergenic
1201035749 Y:9783523-9783545 GGGTCATTTTCTCCTTGTAGGGG + Intergenic
1201620365 Y:15950236-15950258 TGTTCTTTCTTTAATTGTAGTGG - Intergenic