ID: 956168311

View in Genome Browser
Species Human (GRCh38)
Location 3:66413071-66413093
Sequence TAGCCAGGACTGCTTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956168311_956168317 12 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168317 3:66413106-66413128 AGAGGAGAAATCCCAGTGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 278
956168311_956168313 -6 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168313 3:66413088-66413110 TGGCTAAGTTTCCAAGCCAGAGG 0: 1
1: 0
2: 4
3: 85
4: 294
956168311_956168316 11 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168316 3:66413105-66413127 CAGAGGAGAAATCCCAGTGCAGG 0: 1
1: 0
2: 1
3: 31
4: 278
956168311_956168322 29 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168322 3:66413123-66413145 GCAGGGATCCCTGGGAAGCCAGG 0: 1
1: 0
2: 5
3: 50
4: 443
956168311_956168319 21 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168319 3:66413115-66413137 ATCCCAGTGCAGGGATCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 163
956168311_956168318 20 Left 956168311 3:66413071-66413093 CCATTCTGAAGCAGTCCTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 956168318 3:66413114-66413136 AATCCCAGTGCAGGGATCCCTGG 0: 1
1: 0
2: 4
3: 26
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956168311 Original CRISPR TAGCCAGGACTGCTTCAGAA TGG (reversed) Intronic
900598103 1:3491526-3491548 CAGCCAGGACTGCCTTAGAAAGG + Intronic
903697400 1:25218027-25218049 TAGCCAGGACTGTTGCAGCTGGG + Intergenic
904720106 1:32501038-32501060 TAGACAGGACTGTCACAGAAGGG + Intronic
904787798 1:32995742-32995764 TGGCCAGGGCTTTTTCAGAAAGG + Intergenic
907670595 1:56471656-56471678 TAGCCAGGACCTCATAAGAATGG + Intergenic
911709288 1:101051181-101051203 TAGCCAGGAGAGGCTCAGAAAGG + Intergenic
915455161 1:156035705-156035727 CAGCCCTGACAGCTTCAGAAAGG + Exonic
920982712 1:210853375-210853397 TAGCCAGGACTGCTCCCCAGAGG + Intronic
921263927 1:213406783-213406805 TAGCAAGGACTCCATCAGTAGGG - Intergenic
921929618 1:220744527-220744549 TAGCCAGGTCCTCTTCAGGAAGG - Intergenic
924627194 1:245705432-245705454 TGACTGGGACTGCTTCAGAATGG - Intronic
1068687902 10:59888352-59888374 AAGCCAGGTCTGCTTCACACAGG + Intronic
1068959401 10:62851426-62851448 TAGTGAGGACTTCTTAAGAAAGG - Intronic
1069898291 10:71692414-71692436 TAGCCAGGGCTGCTCCACAGAGG + Intronic
1072786467 10:98286509-98286531 TAGAAAGGTCTGCTTCAGCACGG - Intergenic
1074752837 10:116603328-116603350 TAGCCAGCTCTGCCCCAGAATGG - Intronic
1075417062 10:122271954-122271976 TGACCAGGTCTGCTTTAGAATGG + Intronic
1078363035 11:10684705-10684727 TAGCCAGCAATGCCTCAGGAAGG - Intronic
1085121405 11:73969805-73969827 TAGCCAGAACTGGTTGGGAAAGG - Intronic
1085173753 11:74469177-74469199 AAGCCAGGACTGCTTCCTCATGG - Intergenic
1085605548 11:77894668-77894690 AAGCAAGGACTCCTGCAGAAGGG - Intronic
1085700410 11:78740763-78740785 CAGCCAGGACAGCCCCAGAAAGG - Intronic
1087068131 11:94046662-94046684 AAGACAGGGCTGCTTCACAAAGG - Intronic
1087859405 11:103135744-103135766 TAGCCCGGATTTCTTCAAAAGGG - Exonic
1088849170 11:113691038-113691060 GAGCCAGGACTGTTTGAGAAGGG - Intronic
1089012882 11:115145032-115145054 TAGTCAGGACTACTTCAGCATGG - Intergenic
1090452974 11:126822822-126822844 TTGCTTGGACTTCTTCAGAACGG + Intronic
1090532888 11:127609561-127609583 TAGGAAGGGCTGCTCCAGAACGG + Intergenic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1093551483 12:20417599-20417621 TAGCCAGAACTGCTTTTGAATGG + Intronic
1096368349 12:51047656-51047678 TCGCCGGCACTGCTTCAGATAGG + Intergenic
1097524797 12:60718543-60718565 TAGCCAGTACTGGCTGAGAAAGG - Intergenic
1097622515 12:61957812-61957834 GAGGCAGGCCTGCATCAGAAAGG - Intronic
1097974364 12:65668593-65668615 TATCCAGGCCTGCTTCTTAAGGG + Intergenic
1100756122 12:97752730-97752752 TAGCCAGGTATTGTTCAGAATGG + Intergenic
1102382539 12:112479785-112479807 TATCCAGGAGAGCTTCTGAAAGG - Intronic
1103214563 12:119191621-119191643 TAGGCAGGACTCCTTCTGGAGGG - Intronic
1103491820 12:121327258-121327280 CAGCCAGGTCTGCTGCTGAAAGG - Intronic
1104093542 12:125536015-125536037 AAGCCAGGATTGCTTCTGCAGGG + Intronic
1104199893 12:126578492-126578514 TAGGCAACACTGCTTCAGAAAGG + Intergenic
1106040399 13:26084686-26084708 TGTCCAGGACAGGTTCAGAAGGG + Intergenic
1113292087 13:108918573-108918595 TGGCCAGGACTGCTGGAGATAGG - Intronic
1117460284 14:55938528-55938550 TACCCAGGAGTGCTTGGGAATGG + Intergenic
1117598972 14:57354161-57354183 GACCCAGGACTGCTTGAGACTGG + Intergenic
1120631786 14:86900558-86900580 TAGCCTGGGCTGCTTCATTATGG - Intergenic
1127898527 15:63323695-63323717 TGGCCAGGACACCTTCAGAGAGG + Exonic
1129114038 15:73355050-73355072 CAGCCAGGCTTGCTCCAGAAAGG + Intronic
1130244289 15:82229646-82229668 TTGCCAGTAGTTCTTCAGAAAGG - Intronic
1130376129 15:83330554-83330576 TAGCCATTACTTCTTGAGAAGGG + Intergenic
1130456165 15:84111482-84111504 TTGCCAGTAGTTCTTCAGAAAGG + Intergenic
1131082680 15:89549972-89549994 TAGACAGGATTGTTTGAGAAGGG - Intergenic
1131510944 15:93049151-93049173 GGGCCAGGACCCCTTCAGAAGGG - Intronic
1135913185 16:26579477-26579499 TAGCTGGGAGGGCTTCAGAAAGG + Intergenic
1143659538 17:8315998-8316020 TAGCCATGCCTGCTTCTGCAGGG + Exonic
1143895479 17:10133061-10133083 TAGACAGGACTGATTTTGAAGGG - Intronic
1144712492 17:17411048-17411070 TAGCAATGACTGCTTCAACAGGG + Intergenic
1146609347 17:34290666-34290688 CAGCCAGGGCTGGTTCAGATGGG - Intergenic
1147861373 17:43525799-43525821 TATCCAGGAGTGTTTCTGAATGG - Intronic
1156884107 18:42114072-42114094 TACCCATGATTGCATCAGAACGG + Intergenic
1157851599 18:51058190-51058212 CAGCCAGGACAGCAGCAGAATGG + Exonic
1163190788 19:15675176-15675198 TACCAAGGACGGCTTCTGAAAGG - Intronic
1164618648 19:29681109-29681131 AAGCCAGGAAGGCTTCAGAGAGG - Intergenic
1165486651 19:36100705-36100727 CAGCCATGCCTGCCTCAGAATGG + Intronic
1166558610 19:43717678-43717700 TAGCCAGGGCTGCATAGGAAAGG - Intronic
1166978058 19:46616697-46616719 TAGGCAGGAGGGCTTCTGAAAGG - Intergenic
925790130 2:7476216-7476238 TAGGCAGGACTCCATAAGAATGG - Intergenic
927650915 2:24913262-24913284 TGGCCAGGAGTACTTGAGAAAGG - Intronic
931345703 2:61444037-61444059 AAAGCAGGACTGCTTCAGCATGG + Intronic
936607353 2:113971805-113971827 GAGGCAGCACTACTTCAGAAGGG - Intergenic
940155060 2:150647178-150647200 TAGCCAGAACTCCATGAGAAAGG - Intergenic
946169412 2:217885754-217885776 GAGCCAGGACTGCTCTTGAAGGG - Exonic
946949104 2:224852934-224852956 TAGCCAGAAATGCTTCAACAAGG - Exonic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170480350 20:16759149-16759171 TTGCTAGGCCTGCTTCAGAAAGG - Intronic
1174522940 20:51145818-51145840 TAGCCTGGATTCCTCCAGAAAGG - Intergenic
1174979012 20:55370731-55370753 TAGCCAGGACTTCTACAATAAGG - Intergenic
1175633382 20:60560540-60560562 TAGGGAAGACTCCTTCAGAAAGG + Intergenic
1178231583 21:30791081-30791103 TAGCCTGGGCTGATGCAGAAGGG + Intergenic
1179358134 21:40681310-40681332 TAGCCTGGTCTGTGTCAGAACGG - Intronic
1180010861 21:45050313-45050335 TAACCAGAACTACTTTAGAAAGG + Intergenic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1182755854 22:32678336-32678358 TAGACAGGAGAGATTCAGAAAGG - Intronic
1184347375 22:43922090-43922112 AAGCAAGGACTGCAGCAGAATGG + Intergenic
1185027832 22:48425642-48425664 TAGCCAGAATAGGTTCAGAATGG + Intergenic
949412198 3:3778165-3778187 TAGCCAGGAGTGCCTCACAACGG + Intronic
950448184 3:13050149-13050171 TAGCTAGGACTGGCTCTGAATGG + Intronic
954104927 3:48404845-48404867 TAGCCAGGATGGCTGCAGCAGGG - Intronic
954352860 3:50059848-50059870 TAACATGGACTGCTTCAGATAGG + Intronic
954726052 3:52611709-52611731 GTGGAAGGACTGCTTCAGAAGGG + Intronic
956168311 3:66413071-66413093 TAGCCAGGACTGCTTCAGAATGG - Intronic
957299210 3:78369093-78369115 TAGCCAAGACGGCTTTTGAATGG - Intergenic
960248006 3:115420949-115420971 TAGCCAGGACTTAGGCAGAAGGG + Intergenic
960561971 3:119094523-119094545 GAGCTAGGAGTGCTACAGAAGGG + Intronic
963732072 3:148984588-148984610 CAGCCCTGACAGCTTCAGAAAGG + Intergenic
964235655 3:154523988-154524010 TATCCAGGACTGTTTCAGAGAGG + Intergenic
965746556 3:171932440-171932462 CAGCCAGTTCTGCTTCAGCACGG + Intronic
967803321 3:193689149-193689171 AAGCCAGGAATGCTTCTCAAAGG + Intronic
969798398 4:9543575-9543597 TTGCCAGGAATGTTTGAGAAAGG - Intergenic
970345204 4:15146466-15146488 CAGCCAGGGATGTTTCAGAAAGG - Intergenic
971412393 4:26388008-26388030 TATCCAGCACTCCCTCAGAAAGG + Intronic
972628343 4:40822140-40822162 TAGCCAGGCCGAATTCAGAAAGG + Intronic
973287292 4:48432777-48432799 TAACAATGACTGCTTCTGAAGGG + Intergenic
975682019 4:76886503-76886525 CAGCCAGGACAGCTTCACCAGGG - Intergenic
977933891 4:102779195-102779217 CAGACAGGGCTGCTTCAGAGAGG - Intergenic
978541219 4:109818193-109818215 TAGACAGGATTGCTACAGATTGG + Intronic
979109918 4:116740073-116740095 TACCCAGGAATGGTACAGAAAGG + Intergenic
979127684 4:116997134-116997156 TAGCCAGGACACCTCCAAAAAGG - Intergenic
980233804 4:130078040-130078062 TAGCGAGTAGGGCTTCAGAAAGG + Intergenic
984776442 4:183485306-183485328 GAGCCAGGAATGGTACAGAACGG + Intergenic
986336075 5:6756534-6756556 GAGCCAGTCCTGCTTCAAAAGGG - Exonic
994577004 5:101590746-101590768 TAGCCAGGAAGGCATCAAAAAGG + Intergenic
997130414 5:131270872-131270894 TTGCCAGGTCTTCTTCAGTATGG + Intronic
1002118203 5:176981567-176981589 TAGGCAGGATTGCTTGAGGATGG + Intronic
1004397408 6:15257935-15257957 TAGTCAGAACAGCTCCAGAAGGG + Intronic
1005995077 6:30925959-30925981 CAGCCAGGACCCCATCAGAAGGG + Exonic
1007162175 6:39800621-39800643 TAGCCGGGGCTGCTCCAAAAAGG - Intronic
1012385678 6:98679189-98679211 TAGCCTGGACTGGTTGGGAAAGG - Intergenic
1015226417 6:130862115-130862137 TAGATAGTACTGCTTCTGAAAGG - Intronic
1017467638 6:154709321-154709343 AAGGCAGGACTGCTTCACACTGG - Intergenic
1020721861 7:11755401-11755423 TAACTAGGACAACTTCAGAATGG - Intronic
1025156720 7:56613706-56613728 AAGCCAGGACATGTTCAGAATGG - Intergenic
1025956054 7:66183957-66183979 AAGCCAGGAGTGCTTCAACAAGG + Intergenic
1028103419 7:86848895-86848917 TAGCAAGGAGTGCTTCAGTGTGG - Intronic
1029248359 7:99218730-99218752 CAGGCAGATCTGCTTCAGAAAGG + Intergenic
1031895810 7:127347181-127347203 TAGCAAGGACTGATTCTGAAGGG + Intronic
1031935982 7:127735959-127735981 TTGCCAGGAAAACTTCAGAAAGG - Intronic
1033179948 7:139166773-139166795 TTGGGAGGACTGCTTCAGGAGGG + Intronic
1033291875 7:140092044-140092066 AAGCCAGAAATGCATCAGAAAGG - Exonic
1037274679 8:17165323-17165345 TAGCCAGGGCATCTTCAGAGAGG + Intronic
1039432834 8:37538969-37538991 TAGGCAGGTCAGCTACAGAAAGG - Intergenic
1041453626 8:58034043-58034065 TACCCAGGCCTGTTTCAGGAGGG - Intronic
1044553514 8:93537429-93537451 GAGCCAGGCCAGCATCAGAAGGG - Intergenic
1044584966 8:93860883-93860905 TAGCAAGGACAGCCTCAGCAGGG + Intronic
1047333933 8:123918782-123918804 TAGCCTGGACGGCATCAGATAGG + Intronic
1048158208 8:131983460-131983482 TATCCAGGAATGCTTTAGAAAGG + Intronic
1052764555 9:32627482-32627504 GAGCCAGGAATGCTTCACAGGGG + Intergenic
1053272146 9:36757687-36757709 CATCTAGGACTGGTTCAGAAAGG + Intergenic
1055592712 9:77834278-77834300 TAGCCAGGGCTTCTTGAAAATGG - Intronic
1059517425 9:114908784-114908806 TTGCCAGAGCTGGTTCAGAAAGG + Intronic
1060199593 9:121644982-121645004 CAGGCAGGCCTGCTTGAGAAGGG + Intronic
1060240350 9:121897740-121897762 TACCCAGGGATGCATCAGAATGG - Intronic
1061041207 9:128141819-128141841 CAGCCAGGATTGCTTTTGAATGG + Intergenic
1061088176 9:128411501-128411523 GAGCCAGGACTGCTTCCTGATGG + Intergenic
1189885741 X:45542546-45542568 TAGCCAGAACTCCTCCAGAGAGG - Intergenic
1196977740 X:121179109-121179131 TACCCTGGACTGTTCCAGAAAGG + Intergenic
1200983387 Y:9282380-9282402 TATCCAGTATGGCTTCAGAAAGG - Intergenic
1202126987 Y:21577317-21577339 TATCCAGTATGGCTTCAGAAAGG + Intergenic
1202152261 Y:21854212-21854234 TATCCAGTATGGCTTCAGAAAGG - Intergenic
1202167311 Y:22003510-22003532 TGGCAAGGACTCCTGCAGAATGG + Intergenic
1202224049 Y:22582859-22582881 TGGCAAGGACTCCTGCAGAATGG - Intergenic
1202319066 Y:23612802-23612824 TGGCAAGGACTCCTGCAGAATGG + Intergenic
1202551703 Y:26057255-26057277 TGGCAAGGACTCCTGCAGAATGG - Intergenic