ID: 956169803

View in Genome Browser
Species Human (GRCh38)
Location 3:66424123-66424145
Sequence GTGGGGTCTTCCCAGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956169803_956169812 20 Left 956169803 3:66424123-66424145 CCCAGCCACTGGGAAGACCCCAC 0: 1
1: 1
2: 3
3: 19
4: 215
Right 956169812 3:66424166-66424188 CTGCAACTTCTGCAGGATTCAGG 0: 1
1: 0
2: 0
3: 17
4: 175
956169803_956169809 13 Left 956169803 3:66424123-66424145 CCCAGCCACTGGGAAGACCCCAC 0: 1
1: 1
2: 3
3: 19
4: 215
Right 956169809 3:66424159-66424181 TCCCAGACTGCAACTTCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 164
956169803_956169813 21 Left 956169803 3:66424123-66424145 CCCAGCCACTGGGAAGACCCCAC 0: 1
1: 1
2: 3
3: 19
4: 215
Right 956169813 3:66424167-66424189 TGCAACTTCTGCAGGATTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 188
956169803_956169814 24 Left 956169803 3:66424123-66424145 CCCAGCCACTGGGAAGACCCCAC 0: 1
1: 1
2: 3
3: 19
4: 215
Right 956169814 3:66424170-66424192 AACTTCTGCAGGATTCAGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956169803 Original CRISPR GTGGGGTCTTCCCAGTGGCT GGG (reversed) Intronic
900485363 1:2920296-2920318 GTGGGGGCTTCCCTGTGGGTGGG + Intergenic
900562636 1:3315035-3315057 GCGGGGCTTTCCCAGGGGCTGGG - Intronic
902143304 1:14375281-14375303 CTGGGGCCTTCCTAGTGGTTTGG - Intergenic
903138880 1:21326810-21326832 GTGGGGTCTCCCCAGCAGCGGGG - Intronic
903889010 1:26557395-26557417 GTTTGGTCTTCCCAGTGGGCTGG - Intronic
904036332 1:27561130-27561152 GTGGGGGCTCCCCAAGGGCTTGG - Intronic
905366112 1:37452508-37452530 GAGGTGTCTACCCAGTGCCTCGG + Intergenic
905416725 1:37808766-37808788 GTGGGGTCTGCCCACTGGCTAGG + Intronic
908853842 1:68400662-68400684 GTGGGTTCTTTCCAGTGTTTTGG + Intergenic
920767164 1:208844279-208844301 GTGGTGGCCACCCAGTGGCTAGG - Intergenic
923688813 1:236173620-236173642 ATGTGGTCTTCCCAGATGCTGGG + Intronic
924176689 1:241398615-241398637 GTGGGCTCTTCTCAGTGGTCTGG - Intergenic
924432698 1:244010212-244010234 GTGGGGAGTTCCCTTTGGCTGGG - Intergenic
1062828490 10:588784-588806 GGGGGCTCTTGTCAGTGGCTGGG - Intronic
1063126115 10:3138099-3138121 GTGTGCTCTTCCCAGTGCCGAGG + Exonic
1063421417 10:5915398-5915420 TTGAGGTCTTCCCAGTGCCTGGG - Exonic
1064132760 10:12724604-12724626 GTGAGGACTTCTCAGTGTCTAGG - Intronic
1065902810 10:30223582-30223604 GTGGGCTGTTCCCTCTGGCTGGG + Intergenic
1067071085 10:43132539-43132561 GTGTGGTAGTCACAGTGGCTGGG - Intergenic
1067680875 10:48439805-48439827 GTGGCGTCATTACAGTGGCTGGG - Intergenic
1067879275 10:50029655-50029677 TTAGGGTCTTCCAAGTGGCCAGG + Intergenic
1067892622 10:50149776-50149798 TTAGGGTCTTCCAAGTGGCCAGG - Intergenic
1070142392 10:73747981-73748003 ATGGGGTTTTACCAGTGGCCAGG + Intronic
1071797174 10:89019310-89019332 GTTGTCTCTCCCCAGTGGCTGGG - Intergenic
1072207123 10:93214532-93214554 GGGGGGCCTTCCTAGTGCCTGGG + Intergenic
1073375552 10:103031164-103031186 TAGGGGTCTTCCCAGGGCCTTGG - Intronic
1075737461 10:124672766-124672788 ATGGGGCCTCCCCAGTGGCAAGG + Intronic
1075884209 10:125883470-125883492 TTGGTCTCTTCCCGGTGGCTTGG - Intronic
1076118867 10:127920468-127920490 GTGGGGGAGTCCCAGTGGCAGGG + Intronic
1076487684 10:130835302-130835324 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487696 10:130835338-130835360 GTGGGGTGCTCCCTGTGGGTGGG - Intergenic
1076487768 10:130835571-130835593 GTGGGGTGCTCCCTGTGGGTGGG - Intergenic
1076487781 10:130835607-130835629 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487845 10:130835857-130835879 GTGGGGTGCTCCCTGTGGGTGGG - Intergenic
1076487852 10:130835875-130835897 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076734649 10:132453205-132453227 GCGGGGACTTCCCAGGGGCGGGG + Intergenic
1081265899 11:41020787-41020809 GTTGGGACTTCCAAGTTGCTTGG + Intronic
1081598614 11:44476416-44476438 GTAGGGTGGACCCAGTGGCTGGG + Intergenic
1085026197 11:73238024-73238046 CTGGGGTCTGCTCAGTGGATGGG - Intergenic
1085739549 11:79067146-79067168 GTGGGCTCTGCTCAGTGGCCAGG + Intronic
1090662444 11:128891604-128891626 GTGGGGTCATGGCAGGGGCTGGG + Exonic
1091006484 11:131958359-131958381 GTGCGGTCTTCTCTGTGGGTGGG - Intronic
1091124731 11:133083697-133083719 GTGGTCTCTCCCCAGTGGCGAGG - Intronic
1091215170 11:133896905-133896927 GCGGGGTCTTCTCAGTGTTTGGG + Intergenic
1096158913 12:49360367-49360389 TTGCAGCCTTCCCAGTGGCTTGG - Intergenic
1096870066 12:54587674-54587696 GTGGAGTCTTTCCAGGGGCTGGG - Intronic
1101798588 12:108000904-108000926 GTGGTGTCTTGGCAATGGCTTGG + Intergenic
1102261068 12:111443655-111443677 TGGGGGTGTACCCAGTGGCTAGG + Intronic
1102353683 12:112214387-112214409 ATGGGAGCTTCCCAGTGGCTGGG + Intronic
1103972498 12:124680881-124680903 ATAGGGTCTCCCCAGTAGCTGGG - Intergenic
1104787334 12:131457960-131457982 GTGGGGTCCTGCCTGTGCCTGGG - Intergenic
1105505776 13:21008342-21008364 GTGGGGTCTCCTCAGTGGGGAGG + Intronic
1113368732 13:109704064-109704086 GAGGGGTCTTCAAAGTGGCTGGG - Intergenic
1114605062 14:23989361-23989383 TTCTGGTCTTCCCAGAGGCTAGG - Intronic
1118616980 14:67580667-67580689 GAGGGGCCTCCCCAGAGGCTAGG - Intronic
1118975455 14:70672208-70672230 GTGGAGACTGCCCAGGGGCTTGG + Exonic
1119068280 14:71552778-71552800 GTGGGGACTACCGAGTGCCTTGG + Intronic
1119129024 14:72154793-72154815 GTGGGGTTTTCCCACTTACTGGG - Intronic
1120194799 14:81469702-81469724 GTCGAGTCTTCACAGTGGTTGGG - Intergenic
1121803819 14:96797324-96797346 ATGGAGCCTTCCCATTGGCTCGG - Exonic
1122299055 14:100721737-100721759 GTGGGGTGCTCCCAGGGGCTTGG - Intergenic
1123114777 14:105889766-105889788 GTGGGGTCTCCCCAGCGTGTGGG + Intergenic
1129318774 15:74762431-74762453 CTGGGGTCTTGCCAGGGCCTGGG + Intergenic
1130888424 15:88112836-88112858 GTGGGGTCTTCCAGGTGCATTGG - Intronic
1132623748 16:880291-880313 GTGGGGACTTCTCTGTGCCTTGG - Intronic
1132870700 16:2114554-2114576 ACGTGGTCTCCCCAGTGGCTGGG - Exonic
1134521831 16:14922350-14922372 ACGTGGTCTCCCCAGTGGCTGGG + Intronic
1134709501 16:16321001-16321023 ACGTGGTCTCCCCAGTGGCTGGG + Intergenic
1134716714 16:16361030-16361052 ACGTGGTCTCCCCAGTGGCTGGG + Intergenic
1134950102 16:18347644-18347666 ACGTGGTCTCCCCAGTGGCTGGG - Intergenic
1134958036 16:18391129-18391151 ACGTGGTCTCCCCAGTGGCTGGG - Intergenic
1135655434 16:24244293-24244315 TGGGGCTCTTCCTAGTGGCTTGG - Intergenic
1136125910 16:28180410-28180432 TTGGGGGCTTCCCACTGCCTGGG - Intronic
1136930177 16:34411180-34411202 GTTTGGTCTGCACAGTGGCTTGG + Intergenic
1136974397 16:35000625-35000647 GTTTGGTCTGCACAGTGGCTTGG - Intergenic
1137542418 16:49373916-49373938 GTGGAGTCTTGCTAGTGGCTTGG - Exonic
1138095392 16:54207235-54207257 GGGGGCTCTTCCCAGTTCCTCGG + Intergenic
1138128793 16:54460866-54460888 CTGGGGTCCTCTCAGTGACTGGG + Intergenic
1141666887 16:85470270-85470292 CGGGGGTCTTCCCACTGACTTGG + Intergenic
1142741346 17:1933480-1933502 CTGTGGTCTTCCCAGAGGCGGGG - Intergenic
1143120664 17:4604560-4604582 CTGGGGTCTCCCCTCTGGCTGGG + Intronic
1145007053 17:19344003-19344025 GCAGAGCCTTCCCAGTGGCTGGG + Intronic
1148759397 17:49991638-49991660 GTGGGGTCGTCCAGGTAGCTGGG + Exonic
1151061182 17:71096359-71096381 GTGAGAACTTCCCAGTGGCTTGG - Intergenic
1151986598 17:77547898-77547920 ATGGGGTCTCCCGAGTAGCTGGG + Intergenic
1153137119 18:1929711-1929733 GGAGGGGCTTCCCTGTGGCTAGG - Intergenic
1154152027 18:11913811-11913833 GGGGGCTCTTCCCAGTTGTTTGG - Intergenic
1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG + Intronic
1156715031 18:39997501-39997523 GTGGAATCTTCTCAGAGGCTGGG + Intergenic
1157510011 18:48264491-48264513 CTGGGGTCTTCTGAGAGGCTGGG + Intronic
1158864735 18:61627381-61627403 GTGGTGTCTTCCCCGTGCCCCGG - Intergenic
1159776894 18:72612942-72612964 GTTGGTTCTTCCCAAGGGCTGGG + Intronic
1160255420 18:77244103-77244125 GAGGGTTCTTCCATGTGGCTTGG + Intergenic
1160716151 19:577734-577756 GTGGGGTCTTGTTAGTGCCTGGG - Intronic
1160867430 19:1262082-1262104 GTGGGAGCTGCCCTGTGGCTGGG + Intronic
1161161321 19:2763156-2763178 ATTGGGTCTCCCCAGAGGCTGGG - Intronic
1161202972 19:3025978-3026000 ATTGGGACTTCCCGGTGGCTGGG - Intronic
1161948672 19:7454872-7454894 ATGGGGGCCTCTCAGTGGCTGGG - Intronic
1162000452 19:7741672-7741694 GTGAATTCTGCCCAGTGGCTCGG + Exonic
1163296906 19:16418359-16418381 GTGAGGTTTTCCCAGGGGGTCGG - Intronic
1163837137 19:19581872-19581894 GTGGGGGCTTCCAAGTGGCTGGG + Intronic
1164473240 19:28553205-28553227 GTAGGGTGTTTCCAGTGCCTGGG - Intergenic
1165591629 19:36973848-36973870 GCGGGGTCTGCCCTGTGGATGGG + Intronic
1165763597 19:38336582-38336604 TCGGGGTCTGCCCAGGGGCTGGG - Intronic
1165962529 19:39547250-39547272 ATGTGGCCTTCCCTGTGGCTTGG - Intergenic
1167337589 19:48896313-48896335 GTGGGGACTTGGCAGTGGATGGG - Intronic
1168348034 19:55660315-55660337 GTGGACTCTTCCCAGTGCTTGGG - Intronic
925271115 2:2608279-2608301 GTGGGTGTTTGCCAGTGGCTGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929559879 2:42949537-42949559 GTGGGGGCTGCCCTGTGCCTTGG + Intergenic
931331825 2:61294418-61294440 GTGAGGACATCCCAGTGTCTAGG - Intronic
936501722 2:113072176-113072198 GTGGGGTCTCCCCAGAGAGTTGG - Intronic
936562183 2:113549619-113549641 GCTGGGTCCTCCCAGTTGCTGGG + Intergenic
941927751 2:170913239-170913261 GTGAGGTTTTCCCATTGGGTGGG - Intergenic
942182858 2:173396995-173397017 GTGAGGGCTTCCCAATGTCTTGG - Intergenic
946200193 2:218067202-218067224 GCGGGGTGGTGCCAGTGGCTGGG - Intronic
946269414 2:218577895-218577917 GTGGGGTCATCCAAGAGACTGGG + Intronic
947462928 2:230318758-230318780 CTGGGCTCTTCCCCATGGCTTGG - Intergenic
948856170 2:240731720-240731742 TGGGGGTCTTCCCAGTGGGGAGG - Intronic
1168864724 20:1075792-1075814 TTGGGGCTTTCCCAGAGGCTGGG + Intergenic
1168888877 20:1280849-1280871 TTGGAGTCTTCCCAGGTGCTAGG - Intronic
1169194910 20:3677840-3677862 GTGGGGTGTTCCCACAGGGTGGG - Intronic
1169787166 20:9371274-9371296 GTTAGGTCTTCCCAGTGGAAAGG + Exonic
1172287962 20:33754474-33754496 GTGGGATCTTCCCACTGGTCTGG - Intronic
1173069859 20:39752966-39752988 GTGAGCTCTTCTCAGTCGCTAGG + Intergenic
1173270358 20:41528629-41528651 ATGGGGTCTCCCCAATAGCTGGG - Intronic
1174366648 20:50060627-50060649 GTTGGGTCTTCCTAGTAGCTGGG + Intergenic
1174568090 20:51481365-51481387 GTGAGGTCTTCTCGGTGGCCTGG + Intronic
1175081019 20:56420306-56420328 GTAGGGTCATCCCTGTGTCTTGG + Intronic
1175175495 20:57109353-57109375 GCGGGGACTTCCCAGCAGCTGGG - Intergenic
1175913447 20:62415182-62415204 GTGGGGGCGTCCCATTGGCGGGG + Exonic
1175977303 20:62717390-62717412 TTGGGTTGTCCCCAGTGGCTTGG + Intronic
1176115889 20:63431847-63431869 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176115904 20:63431883-63431905 GTGGGGCCTTCCCTGTGGGCGGG - Intronic
1176115912 20:63431901-63431923 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176115940 20:63431973-63431995 GTGGGGCCTTCCCTGCGGGTGGG - Intronic
1176115956 20:63432009-63432031 GTGGAGCCTTCCCTGTGGATGGG - Intronic
1176115980 20:63432081-63432103 GTGGGGCCTTCCCTGTGGGTGGG - Intronic
1176115988 20:63432099-63432121 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176116047 20:63432261-63432283 GTGGGGACTTCCCAGAGGCTGGG - Intronic
1176116090 20:63432387-63432409 GTGGGGCCTTCCCTGTGGGTGGG - Intronic
1176116098 20:63432405-63432427 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176116194 20:63432675-63432697 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176116202 20:63432693-63432715 GTGGGGCCTTCCCAGAGGGTGGG - Intronic
1176116236 20:63432783-63432805 GTGGGGCCTTCCCTGAGGGTGGG - Intronic
1176173145 20:63705359-63705381 GTGGGGTGTCCCCAGTGCCTTGG - Intronic
1176257638 20:64160429-64160451 GTGGGGTCTCCCCAGGGCCCTGG + Intronic
1179365172 21:40752339-40752361 GTGGGGCCCTCCCTCTGGCTTGG + Intronic
1179618631 21:42598180-42598202 GTGGGGACTCTCCAGTGCCTGGG + Intergenic
1181118660 22:20650523-20650545 TTAGGGTCTTCCAAGTGGCCAGG - Intergenic
1182389513 22:29980506-29980528 GTGGGGAATTCTCAGTTGCTGGG - Intronic
1182413183 22:30204301-30204323 GTGTGGTCCTCACAGTAGCTTGG + Intergenic
1182547448 22:31084372-31084394 CTGGGCACTGCCCAGTGGCTGGG - Intronic
1183012726 22:34960388-34960410 GGTGGGTCTTCCCATTTGCTAGG - Intergenic
1183185423 22:36289020-36289042 GTGGGGTCATCACAGAGGGTCGG - Intronic
1184046054 22:41972824-41972846 GTGTGGTCTTCCCAGTGGCTGGG - Intergenic
1184138693 22:42564911-42564933 CTTGAGTCTTCCCAGTAGCTGGG + Intronic
1184780368 22:46646039-46646061 CTGGGGGCTTCCCGGTTGCTAGG + Intronic
1184840749 22:47051065-47051087 GTGGGTTCTGCCCTGTGGCCTGG + Intronic
1184920245 22:47600742-47600764 GAGGGGTGTTCACAGAGGCTGGG - Intergenic
950500171 3:13358676-13358698 GTGGGGTTTTCCCAGGGTCCTGG - Intronic
953696874 3:45166665-45166687 CTGAGGCCTTCCCAGAGGCTGGG + Intergenic
954231941 3:49224446-49224468 GGGGGTTCTTCCCAGAGGTTAGG + Intronic
954608854 3:51933725-51933747 CTGGGGACTTCCTGGTGGCTGGG - Exonic
955659259 3:61278929-61278951 GTGAGGTCTTCCCAATGGTGAGG + Intergenic
956169803 3:66424123-66424145 GTGGGGTCTTCCCAGTGGCTGGG - Intronic
956729895 3:72186963-72186985 GTGGGGGCTTCCCCGTGCATTGG - Intergenic
961394649 3:126578514-126578536 GTGGGGTCAGCCCAGTGTGTTGG - Intronic
962776363 3:138664187-138664209 GGGTGGTCTTCACAGGGGCTGGG + Intronic
963552817 3:146745708-146745730 GTGGGGCCTGCCCAGTGGAGAGG - Intergenic
965264064 3:166518301-166518323 ATGGGCAATTCCCAGTGGCTAGG - Intergenic
967882372 3:194310824-194310846 GTGGGTTCATGCCACTGGCTTGG - Intergenic
968959425 4:3735397-3735419 GCTGGCTCTTCCCAGGGGCTGGG + Intergenic
969877191 4:10144531-10144553 TTTGGAGCTTCCCAGTGGCTAGG - Intergenic
975562923 4:75724511-75724533 GCGGGGTCTGCGCAGTGGGTGGG + Intronic
977560592 4:98529614-98529636 TTGGGGTTTTCCCAGTCACTAGG - Intronic
979383017 4:120030833-120030855 CTGGGGTCTTACCAGTAGCTGGG + Intergenic
980681857 4:136172875-136172897 GTGGGGATTTGCCTGTGGCTTGG - Intergenic
981049114 4:140293575-140293597 TTTGGGTCTTCCCATTGGCCTGG - Intronic
985542851 5:494828-494850 GGTGGGTCTTGCCAGCGGCTGGG - Intronic
985544461 5:502225-502247 GTGGGGTCTGCCCAGCGTCCTGG - Intronic
985546376 5:511479-511501 GTGGGGTCTGCCCAGATGTTTGG - Intronic
986183517 5:5416319-5416341 GTGGGTTCTGCCCACTGGCACGG + Intergenic
990981297 5:61604643-61604665 GTGGAGCCTTCCCAGTTGGTGGG + Intergenic
992225188 5:74613479-74613501 GTAGTGTATTCTCAGTGGCTTGG - Intergenic
994367831 5:98935463-98935485 TTGTGGTCATCCCAGTGGGTGGG + Intergenic
997561003 5:134846157-134846179 CTAGGGGCTTCCCAGCGGCTGGG - Exonic
998204211 5:140147616-140147638 GTGGGGTCTTGCCCTGGGCTTGG - Intergenic
998459026 5:142295649-142295671 GGGAGGTCTTCCCAGAGGCCTGG + Intergenic
1002306250 5:178285767-178285789 ATGTGGTCATCCCAGAGGCTGGG - Intronic
1007664931 6:43508499-43508521 CTGGGGTGTCCCTAGTGGCTGGG + Intronic
1010426028 6:75729686-75729708 GTGGGGTCATTCCAGAGGCTGGG + Intergenic
1016403117 6:143701668-143701690 GTGGGATCTTGCTAGTTGCTTGG + Intronic
1017264487 6:152426631-152426653 GTGGGGTATTCCCAGAGGGGAGG - Intronic
1018946798 6:168353143-168353165 GCAGGGGCTTCCCAGTCGCTTGG - Intergenic
1019501453 7:1366874-1366896 GTGGGGTCTGCTCACTGGCTGGG - Intergenic
1022091302 7:27109616-27109638 GTAGGGTCTTCCCAGAGGTAAGG + Intronic
1022574988 7:31488847-31488869 GTGGGGTATACCGAGTGGATGGG - Intergenic
1022902953 7:34828311-34828333 GTGAGCTCCTCCCAGTGACTGGG + Intronic
1023826871 7:44015462-44015484 GTGGGGTCTGCCCAGTCTCCTGG - Intergenic
1023959232 7:44912903-44912925 GTGTGTTCTTCCATGTGGCTTGG + Intergenic
1029738022 7:102475213-102475235 GTGGGGTCTGCCCAGTCTCCTGG - Intronic
1029755156 7:102568863-102568885 GTGGGGTCTGCCCAGTCTCCTGG - Intronic
1029773104 7:102667943-102667965 GTGGGGTCTGCCCAGTCTCCTGG - Intronic
1031967516 7:128037712-128037734 GTTGGGTCTTCCCACTGGGAAGG + Intronic
1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG + Intergenic
1033660475 7:143398813-143398835 GTGAGGTGTTCCCAGTGTCAGGG - Exonic
1034255694 7:149723585-149723607 GCTGAGTCTTCCCAGTGCCTGGG - Intronic
1034294746 7:149962470-149962492 GTAGGGTCTTCCACATGGCTGGG - Intergenic
1034811318 7:154134482-154134504 GTAGGGTCTTCCACATGGCTGGG + Intronic
1034938661 7:155215966-155215988 ATGGGGTCTTCTCAGGGCCTAGG + Intergenic
1038875341 8:31542566-31542588 TTGGTGGCTTCCCAGTGGCATGG + Intergenic
1038896040 8:31783441-31783463 GGGGTCTCTTTCCAGTGGCTGGG - Intronic
1039401564 8:37274375-37274397 GTAAGGTCTTCCCAGTTCCTAGG + Intergenic
1045595947 8:103656866-103656888 GTGGGGGCTTCCCTAAGGCTAGG - Intronic
1046407348 8:113791187-113791209 GTGGGGTTTCACCAGGGGCTGGG + Intergenic
1047023026 8:120796552-120796574 GTGGGAGGTTCCCAGTGCCTGGG + Intronic
1048682059 8:136853886-136853908 GTGTGGTCTTCCCAGTGTACAGG + Intergenic
1049890497 9:65708-65730 GCTGGGTCCTCCCAGTTGCTGGG - Intergenic
1050644857 9:7708300-7708322 GTAGGGTGTTACCAGGGGCTTGG + Intergenic
1051122279 9:13764328-13764350 GTAGGGCCTTCCCAGGGACTTGG + Intergenic
1053731961 9:41066891-41066913 GCTGGGTCCTCCCAGTTGCTGGG - Intergenic
1054696495 9:68364827-68364849 GCTGGGTCCTCCCAGTTGCTGGG + Intronic
1056297578 9:85207887-85207909 GTGAGGTCTTCCCAGTCACAAGG + Intergenic
1058001048 9:99865251-99865273 ATGGGGTGTTCACAGTGACTTGG + Exonic
1058148228 9:101435048-101435070 GTAGGGTCTTCACAGTGTCTGGG + Intronic
1060078061 9:120612950-120612972 ATGGGGCCTCCCAAGTGGCTGGG + Intronic
1060511753 9:124239798-124239820 AGGGGGACTTCACAGTGGCTTGG - Intergenic
1061613195 9:131762399-131762421 GTGCCGCCCTCCCAGTGGCTGGG - Intergenic
1061925861 9:133805795-133805817 GTGTGGCCATCCAAGTGGCTCGG - Intronic
1185572285 X:1144268-1144290 CTGGAGTCTCCCCAGTGCCTTGG - Intergenic
1187272110 X:17788657-17788679 GTGGTTTCTTCCCAGTAGGTGGG + Intergenic
1189185637 X:39052544-39052566 GTGGCTTGTTCCCAGTGGCTGGG + Intergenic
1194544723 X:95219071-95219093 CTGGGGGCTCTCCAGTGGCTAGG - Intergenic
1196824671 X:119731751-119731773 GTGAAGTCTTCCTAGTTGCTTGG - Intergenic
1200906102 Y:8484527-8484549 GTGGGCACTTTGCAGTGGCTTGG + Intergenic
1202256944 Y:22931570-22931592 GTGGGCACTGCGCAGTGGCTTGG + Intergenic
1202409935 Y:24565318-24565340 GTGGGCACTGCGCAGTGGCTTGG + Intergenic
1202460847 Y:25104754-25104776 GTGGGCACTGCGCAGTGGCTTGG - Intergenic