ID: 956171591

View in Genome Browser
Species Human (GRCh38)
Location 3:66437693-66437715
Sequence TGCTACATGCAGCTGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956171585_956171591 13 Left 956171585 3:66437657-66437679 CCTCAGAGTCATTCATCCATACA 0: 1
1: 1
2: 1
3: 33
4: 369
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224
956171581_956171591 28 Left 956171581 3:66437642-66437664 CCCTTCCACTTGGTCCCTCAGAG 0: 1
1: 0
2: 0
3: 27
4: 213
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224
956171582_956171591 27 Left 956171582 3:66437643-66437665 CCTTCCACTTGGTCCCTCAGAGT 0: 1
1: 0
2: 0
3: 24
4: 234
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224
956171583_956171591 23 Left 956171583 3:66437647-66437669 CCACTTGGTCCCTCAGAGTCATT 0: 1
1: 0
2: 0
3: 24
4: 143
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224
956171589_956171591 -3 Left 956171589 3:66437673-66437695 CCATACATGGATGGGATGCCTGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224
956171584_956171591 14 Left 956171584 3:66437656-66437678 CCCTCAGAGTCATTCATCCATAC 0: 1
1: 0
2: 0
3: 22
4: 168
Right 956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956171591 Original CRISPR TGCTACATGCAGCTGCTGCA AGG Intronic
901650275 1:10739214-10739236 TGCAACCTGCAGCTGCGGGACGG + Intronic
902134562 1:14293756-14293778 TGCTAATAGCAGCTGTTGCAGGG - Intergenic
902488296 1:16762498-16762520 AGCCACAGGAAGCTGCTGCAGGG - Intronic
903375548 1:22863533-22863555 TGATTCAGGCAGCTGCTGCCAGG - Intronic
904607615 1:31706644-31706666 GCCTGCATGCTGCTGCTGCATGG + Intergenic
905033485 1:34902822-34902844 TGCTCCCTGCTGCTGCTTCAGGG - Intronic
905664737 1:39756144-39756166 AGCCAGGTGCAGCTGCTGCATGG - Intronic
906126209 1:43428419-43428441 TCCTCCATGCTGCTGCTGAAGGG - Exonic
907269303 1:53281250-53281272 TGCTGAGAGCAGCTGCTGCATGG + Intronic
908096937 1:60749152-60749174 TCCTGCATTAAGCTGCTGCAAGG + Intergenic
908564049 1:65336197-65336219 TTCTTCATGCAGCAGCAGCAAGG + Intronic
908826934 1:68142146-68142168 GGCAACATGCAGCTGCTTCAGGG + Intronic
909232307 1:73106000-73106022 TCCTACAGGAAGCTGCTGGAGGG + Intergenic
910122255 1:83803130-83803152 TGCTACATGCTGAAGATGCATGG + Intergenic
910746477 1:90580325-90580347 TGGAACCTGCAGCAGCTGCAGGG - Intergenic
911477121 1:98387236-98387258 TCCTACATGCAGCAGCCACATGG - Intergenic
912305303 1:108560516-108560538 TGCAAGATGCGGCTGCTGGACGG + Exonic
912533326 1:110341806-110341828 TCCAACATGCATCTGTTGCAGGG + Exonic
913614565 1:120545404-120545426 TACTTCTTGTAGCTGCTGCAAGG + Intergenic
914575706 1:148965497-148965519 TTCTTCTTGTAGCTGCTGCAAGG - Exonic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
916161556 1:161921140-161921162 TGCAGCAAGCAGCTGCTGCTTGG - Intronic
917021303 1:170591116-170591138 TTCTACATGCTGCTGTTGGAAGG - Intergenic
920147288 1:203872846-203872868 ACCTACATGAAGCTGCTGGAGGG - Intergenic
920536784 1:206742640-206742662 TGCTACAGGGGTCTGCTGCAGGG + Intergenic
920560454 1:206934784-206934806 TGGTACTTGGAGATGCTGCAGGG + Intronic
920694018 1:208167986-208168008 TGCTATATGCAGCAGCTTGATGG + Intronic
921343349 1:214156191-214156213 TGCCACAGGCAGCTTCTGCAGGG - Intergenic
921607695 1:217174812-217174834 TTCTCCATGCTGCTGCTGGAGGG + Intergenic
922649384 1:227324044-227324066 TGCTGCCTGGAGCTGCTGAATGG - Intergenic
923101379 1:230820508-230820530 TGCTACTAGGAGCTGCAGCATGG + Intergenic
1063221819 10:3975806-3975828 TGGTGTGTGCAGCTGCTGCAAGG + Intergenic
1066700739 10:38125479-38125501 TGCAACATGCCCCTACTGCATGG + Exonic
1066990943 10:42512736-42512758 TGCAACATGCCCCTGCTGCATGG - Intergenic
1067168005 10:43880456-43880478 TGCTTCATGCTGCTGCTCCCCGG + Intergenic
1069909536 10:71751063-71751085 TGCTACATGGGGATGCTGGACGG - Exonic
1070326300 10:75391560-75391582 TGCTATTTCCAGCTGATGCATGG + Intergenic
1072704888 10:97673998-97674020 TGCTACCAGCAGATGCTGGAAGG - Exonic
1072971302 10:100020130-100020152 TGCTACACCCACCTGCAGCAGGG + Intergenic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1074851071 10:117440110-117440132 TGCTACAGGCATCTGCTGGGTGG - Intergenic
1075408517 10:122210746-122210768 TGCTATATGCATCTGGGGCAAGG - Exonic
1076800712 10:132826760-132826782 TGCTGCATCCAGCTCCTGCCTGG - Intronic
1076834034 10:133012047-133012069 AGGCACAGGCAGCTGCTGCAAGG + Intergenic
1076922601 10:133462570-133462592 TGCCACAGGCAGCAGCAGCAAGG + Intergenic
1080905223 11:36538331-36538353 TGCTAGCTGCAGCTCCTGCTTGG + Intronic
1081607926 11:44538745-44538767 TGCTAGATGCAGCATCTCCAAGG + Intergenic
1083832710 11:65243054-65243076 TTAAACATGCAGCTTCTGCAAGG - Intergenic
1085022822 11:73219720-73219742 GACTCCAGGCAGCTGCTGCAAGG - Intronic
1091536151 12:1411676-1411698 AACTACATCCAGCTACTGCACGG - Intronic
1092032659 12:5301214-5301236 TGCTGCAGGCAGCTGCTGTTAGG - Intergenic
1092265998 12:6981040-6981062 CACTACATGAAGCTGGTGCAGGG - Exonic
1093914748 12:24788912-24788934 TGCTACATTTACCTCCTGCAGGG - Intergenic
1094169522 12:27478334-27478356 TGGTGCATGCATATGCTGCATGG - Intronic
1096329052 12:50693188-50693210 TGCAGCATGCAGCTTATGCATGG - Intronic
1097277133 12:57821304-57821326 GGCTTCATGCAGATGCAGCAGGG + Exonic
1097640780 12:62178666-62178688 TGCCACATGCAGCATCTGCATGG - Intronic
1099728204 12:86461947-86461969 TGCTGCATGCAGCTGGTACAGGG - Intronic
1103889146 12:124225457-124225479 TCCTGCATGCTCCTGCTGCAGGG - Intronic
1105441811 13:20421521-20421543 TTCTACCTGCAGCTGATGGAAGG + Intronic
1106895885 13:34302033-34302055 TGTGACAAGCAGCTGCTGCCAGG - Intergenic
1109332468 13:60946501-60946523 TGTTACATGCATCTATTGCATGG + Intergenic
1109419038 13:62085629-62085651 TGCTACATAGAGCTGATGCAGGG - Intergenic
1111487270 13:88920095-88920117 TACCACATCCAGCAGCTGCATGG + Intergenic
1112650908 13:101397266-101397288 TGATACATGCAGGATCTGCATGG - Intronic
1112694708 13:101935246-101935268 GGCTACATCCAGCAGCTGCTTGG + Intronic
1114803703 14:25808722-25808744 TGGCACATGCAGCTTCTGAAAGG - Intergenic
1116151381 14:41145826-41145848 TGCTCCATGCAGCAGGAGCAGGG - Intergenic
1123976690 15:25560294-25560316 TGCAGTATGCAGCTGCTGAACGG - Intergenic
1125522061 15:40353795-40353817 GGCAACACGCAGCTGCTCCAGGG + Intronic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1129296104 15:74600982-74601004 TGCTACCTTCAGGGGCTGCAAGG + Intronic
1131424691 15:92335898-92335920 AGCTACATCCAGCTCCTTCAAGG - Intergenic
1132074176 15:98805965-98805987 TGCTACTCGCATCTGCAGCAAGG - Intronic
1132572803 16:651362-651384 TGCTGGCTGCAGCTGGTGCAGGG + Intronic
1132938372 16:2493990-2494012 TGCTTCAGGCAGGTGCTCCAGGG - Intronic
1133022890 16:2974606-2974628 TGCAACATGGAGCTGCCCCACGG - Exonic
1133102142 16:3486059-3486081 TGCCACAAGCTGCTGCTCCAAGG + Exonic
1133231614 16:4369664-4369686 TGCTACAAGGAGCAGCTGCAAGG + Intronic
1134230798 16:12427948-12427970 TGGCAAATGAAGCTGCTGCAGGG - Intronic
1134466885 16:14486811-14486833 TGCTACATGCTGCTTCTGACAGG - Intronic
1137610124 16:49812329-49812351 AGCTACAGGCACCTGCTGCCTGG + Intronic
1137727761 16:50668659-50668681 AGCTAAATGCAGTTGCTGCATGG + Intronic
1138762140 16:59557748-59557770 TGCTACAGGGAGCTGCTTTATGG - Intergenic
1139572344 16:67821091-67821113 TGCTGCTGGCAGCTCCTGCAGGG - Exonic
1141950192 16:87334929-87334951 GTCTCCATGCAGCTGCTGGAGGG + Intronic
1142280741 16:89146370-89146392 AGCTCCATGCACCTCCTGCATGG - Intronic
1142350681 16:89577962-89577984 TGCCCCATCCAGCTGCTGCCAGG + Intronic
1143428772 17:6863217-6863239 TGCTGCAAGCAGATGCAGCAGGG + Intergenic
1145050411 17:19655132-19655154 TTCTACATGCAGTTGCTACAGGG + Intronic
1145069075 17:19787862-19787884 TGCCACACACAGCTGCTGCCAGG - Intronic
1146735161 17:35232600-35232622 TCCTCCATGCAGCCCCTGCATGG + Intergenic
1150134926 17:62690251-62690273 TTCCACATGGAGCTGCTGCTGGG + Exonic
1150346340 17:64407338-64407360 TGCTACGTGCAACTGATGCAGGG - Intronic
1153695888 18:7641142-7641164 TCCTACTTGGAGCTGCTGAAAGG + Intronic
1156155713 18:34299976-34299998 TGTGACATGCAGCTGCTGCCAGG - Intergenic
1161151242 19:2711156-2711178 TGCTCCCTGCAGCTGCAGCTGGG + Intergenic
1161769812 19:6225113-6225135 GGCTCCCTGCAGCTGCTGCCAGG + Intronic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162757202 19:12867518-12867540 TGCTCCCTGCAGCTGCTACTGGG - Exonic
1163470191 19:17492093-17492115 TGCTACTGGCATCTGGTGCAGGG - Intronic
1165091879 19:33392029-33392051 TGCTCCCTGCAGCAGCTCCAGGG - Intronic
1202702901 1_KI270713v1_random:1742-1764 AGCCACAGGAAGCTGCTGCAGGG + Intergenic
925613617 2:5724579-5724601 TGCTGCATGAAGTTGGTGCATGG + Intergenic
930590873 2:53324343-53324365 TGATACATGCATTTGCTCCATGG - Intergenic
931767494 2:65469836-65469858 TGCTACATACAGCTGCCATAAGG - Intergenic
932889372 2:75578955-75578977 TGCACCATGCAGCCGCTGCTGGG - Intergenic
933339572 2:81004917-81004939 TGTGCCATGCAGCTGCTGCCAGG + Intergenic
933990454 2:87630103-87630125 TTCTCCATGCAGGTGCTGCGTGG + Intergenic
935504495 2:103883293-103883315 TGCTAGATGCTACTGCTGCCTGG - Intergenic
936080373 2:109428883-109428905 TGCTACCTGCAGGTGCTGCCCGG + Intronic
936303392 2:111320721-111320743 TTCTCCATGCAGGTGCTGCGTGG - Intergenic
943064411 2:183071302-183071324 ACCTACAGGCAGCTGCTGGAGGG - Intergenic
944085175 2:195837551-195837573 TGCTACCTGTGCCTGCTGCATGG - Intronic
944287346 2:197966594-197966616 TGAACAATGCAGCTGCTGCAGGG + Intronic
944923968 2:204443984-204444006 TGCTACATGCAAATGGGGCAAGG - Intergenic
945404309 2:209425699-209425721 TGGTACCTGCAGCTCATGCATGG - Intronic
946023673 2:216659070-216659092 TTCTAAAGGAAGCTGCTGCATGG + Intronic
948797539 2:240412538-240412560 GGCTTCTTGCAGCTGCTGCCTGG + Intergenic
948979651 2:241486544-241486566 GGCTGCAGGCATCTGCTGCATGG + Intronic
1169072003 20:2738538-2738560 TGCCACATGCAGCGGCAGGAAGG - Intronic
1169342964 20:4810217-4810239 TCCTTCATGCAACTGCTGCAGGG - Intronic
1170714119 20:18817413-18817435 TGCCACGTGAAGCTGCTGGAAGG + Intronic
1170815389 20:19709361-19709383 TACTGCTGGCAGCTGCTGCAGGG + Intronic
1172875152 20:38159647-38159669 TGATAAATGCGCCTGCTGCAGGG + Intronic
1173149160 20:40551050-40551072 TGCTTCAGGCAGCAGCTGCCTGG - Intergenic
1173888223 20:46480434-46480456 TCCTCCATGCAGCTGCCTCATGG + Intergenic
1173895222 20:46545864-46545886 TGCTGCATGCAGCTGGTGAGTGG + Exonic
1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG + Intronic
1175820939 20:61908558-61908580 TGCCACAGGCAGGTCCTGCAAGG - Intronic
1178692512 21:34761349-34761371 TCATGCATGCAGCTCCTGCAAGG + Intergenic
1178781020 21:35603535-35603557 GGCTGAATGCAGCTGCTGCTGGG + Intronic
1179486684 21:41715123-41715145 TGGTACATGCAGCTCCTGAGGGG + Intergenic
1181772561 22:25136757-25136779 TGCTACATTCACCTACTCCAGGG - Intronic
1183362921 22:37391985-37392007 TGCCCCACGCACCTGCTGCAAGG + Intronic
1183500341 22:38175083-38175105 TGCTACCTGCCGCAGCTGCCAGG + Intronic
951315064 3:21179763-21179785 GGCTACCTGCAGCCACTGCAGGG + Intergenic
952344223 3:32468972-32468994 TGCAACTTGCAAGTGCTGCAGGG + Intronic
952589167 3:34930792-34930814 AGCTTCATGCACGTGCTGCATGG - Intergenic
952999382 3:38918241-38918263 TGCTATATGCAGCAGCTGTCGGG + Intronic
953078103 3:39589988-39590010 ATGTACATGCTGCTGCTGCAGGG + Intergenic
953412624 3:42698820-42698842 TGGTACCTGCTGCTGCTGCTTGG - Exonic
953604178 3:44398858-44398880 TGATACATGCAGCAACTGGATGG + Intronic
953775504 3:45813172-45813194 TGCTGGATGCAGCTTCAGCAGGG - Intergenic
955222827 3:57037375-57037397 TGCAGCATGTAACTGCTGCAAGG + Intronic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
956177929 3:66491020-66491042 TTCTCCAAGTAGCTGCTGCATGG - Intronic
960425351 3:117500356-117500378 TGCTGAATTCAGCTGCTTCATGG + Intergenic
961677544 3:128576901-128576923 TGCTATATGCAGGTGCTGCCCGG + Intergenic
962688261 3:137868225-137868247 TGCACCATGCTGCTGCTGCTGGG - Intergenic
963190028 3:142459709-142459731 TCATACATGCAGGTTCTGCAGGG + Intronic
965026048 3:163303321-163303343 TGCAACATGCTGCTGTTGCTGGG - Intergenic
965190365 3:165520114-165520136 TGTTATATGGAGCTGATGCAGGG - Intergenic
967945505 3:194800790-194800812 TGCCACATGCAGAGGCTACATGG + Intergenic
969028822 4:4195031-4195053 TGCTACATACAGCTACTGGGAGG + Intronic
970439335 4:16066735-16066757 GGCTTCATGCAGCAGCTGCTGGG + Intronic
970741888 4:19249437-19249459 AGGTACAGGCAGATGCTGCAGGG + Intergenic
970974523 4:22028168-22028190 AGCTATTTGCAGCTGCTTCAAGG + Intergenic
972169399 4:36326753-36326775 TGCTAAATGCAACTGCTAGATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978030502 4:103936553-103936575 TGCACCATGCTGCTGCTGCCAGG - Intergenic
979142816 4:117200477-117200499 TGCACCATGCAGCTGCTGTAGGG - Intergenic
981602716 4:146508825-146508847 TGCTACAGGAAGCTACTGGAGGG - Intronic
982866182 4:160514735-160514757 TGCTACAGGCAGAAGCAGCATGG - Intergenic
983900967 4:173133752-173133774 TGCTTTTTGCAGCTACTGCAGGG + Intergenic
984409630 4:179379771-179379793 TCCCACATGTAGCTGCTGGATGG - Intergenic
984840388 4:184062203-184062225 TGCAACATGGAGCTGTTTCAAGG - Intergenic
986173300 5:5331251-5331273 TCCTACAGGCAGGTTCTGCATGG + Intergenic
986348852 5:6858655-6858677 TGATACTTGCAGCAGCTGCCAGG + Intergenic
987475884 5:18392176-18392198 TGCCAGCTGCAGCTGCTGCCTGG + Intergenic
988641162 5:33041869-33041891 TGCTACATCCAAGTGCAGCAGGG - Intergenic
990214404 5:53514375-53514397 TGCACCATGCAGCGGCTGGAGGG + Intergenic
990786585 5:59427174-59427196 TGCTACATGCAGTTTCTACAGGG + Intronic
992127115 5:73653639-73653661 TGCTCCATGCATGTGCTGGAAGG + Intronic
993719822 5:91311300-91311322 TGCTAGATGCTGGGGCTGCATGG + Intergenic
994226040 5:97253123-97253145 TGCACCACGCAGCTGCTGCTGGG - Intergenic
995271088 5:110220310-110220332 TGCACCATGCAGCTTCTTCATGG - Intergenic
996779536 5:127170943-127170965 TCCAACATGCAGTTGTTGCAGGG - Intergenic
1000750458 5:165089269-165089291 TGCTACTGGCATCTGCTGAATGG - Intergenic
1000975820 5:167763135-167763157 TGCTGAAGGCAGCTGGTGCAAGG + Intronic
1001749894 5:174120844-174120866 TGTTCCCTGCAGCAGCTGCAGGG + Intronic
1001749895 5:174120848-174120870 TTCACCCTGCAGCTGCTGCAGGG - Intronic
1002043743 5:176530983-176531005 GGGCACAGGCAGCTGCTGCATGG + Exonic
1003474043 6:6465126-6465148 TGCTGGATTCAGCTGCTGCATGG + Intergenic
1005650179 6:27878778-27878800 GGCTTCATGCAGATGCAGCAGGG + Intergenic
1006463107 6:34175373-34175395 TGCACCATGTAGCTGCTGCAGGG + Intergenic
1006735764 6:36271314-36271336 TGCTAGATGCATCTGCTGTCCGG - Intronic
1013760365 6:113510945-113510967 GGCTACAGGCAGCTACAGCAGGG + Intergenic
1019745964 7:2700531-2700553 GGACACATACAGCTGCTGCAGGG - Exonic
1021760624 7:23900197-23900219 TGATACTTGCTCCTGCTGCAGGG + Intergenic
1022130378 7:27399597-27399619 TGTTACATGAACCTGCTGCTGGG - Intergenic
1024562481 7:50656061-50656083 TTCTACATGCAGGTACTGCCTGG - Intronic
1024643382 7:51350478-51350500 TGGAACATGCAACGGCTGCATGG - Intergenic
1029543980 7:101200789-101200811 TTCTAGATGCTGCTTCTGCAAGG + Exonic
1030461210 7:109839228-109839250 GGCTTCATGCAGATGCAGCAGGG - Intergenic
1031253729 7:119421026-119421048 AGATGCATGCAGCTGCAGCAGGG + Intergenic
1031746649 7:125506520-125506542 TGCACCAGGCAGCTGCTGCCAGG + Intergenic
1032084215 7:128875205-128875227 TGCTTCATAGAGTTGCTGCAAGG - Intronic
1032362846 7:131272190-131272212 GGCTACATGCAGCTGTTACATGG + Intronic
1032465017 7:132138738-132138760 TGTGACCTGCAGCAGCTGCATGG + Intronic
1032690091 7:134277046-134277068 TGCTATATGCAGCAGCTCCTTGG - Intergenic
1033887151 7:145963061-145963083 TGCATCATGCTGCTGCTGCTGGG - Intergenic
1034972007 7:155425047-155425069 TGCCTCATACAGCTGCAGCATGG + Intergenic
1036406001 8:8455782-8455804 TCCTAGATGCAGCTGATGGATGG + Intergenic
1036771739 8:11583147-11583169 GGCTACCTGCAGATGCTCCAGGG + Intergenic
1039030123 8:33299662-33299684 GGCTTGCTGCAGCTGCTGCAAGG - Intergenic
1040279005 8:46028516-46028538 TGCTCCATGCTGCAGCTGCGCGG - Intergenic
1043224892 8:77713701-77713723 TGCTACATGCATATATTGCATGG + Intergenic
1044546396 8:93465105-93465127 TGGAACAAGCAGCTCCTGCATGG - Intergenic
1045800542 8:106096341-106096363 TGCAACACACAGCTGCTGCCAGG - Intergenic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1047777483 8:128085085-128085107 TGCTTTATGCAGCTCCTGCCTGG + Intergenic
1047910013 8:129517849-129517871 TGCACCATGCTGCTGCTGCCAGG - Intergenic
1048369317 8:133763895-133763917 TGCTCCATGCAGCAGCCCCAGGG - Intergenic
1048457808 8:134593602-134593624 TGCTGCACGAAGCTGCAGCATGG + Intronic
1048579563 8:135719840-135719862 AGCTTCATGCAGCTGCCACATGG + Intergenic
1050355641 9:4780547-4780569 TGCACCAGGCAGCTGCTGCCAGG - Intergenic
1052063200 9:23986320-23986342 TGCACCATACTGCTGCTGCAGGG - Intergenic
1053611724 9:39720819-39720841 TGCTCTTTCCAGCTGCTGCATGG + Intergenic
1053869758 9:42478821-42478843 TGCTCTTTCCAGCTGCTGCATGG + Intergenic
1054086531 9:60750336-60750358 TGCTCTTTCCAGCTGCTGCATGG - Intergenic
1054241796 9:62621574-62621596 TGCTCTTTCCAGCTGCTGCATGG - Intergenic
1054555920 9:66656097-66656119 TGCTCTTTCCAGCTGCTGCATGG - Intergenic
1057880423 9:98788736-98788758 TCCCACCTGCAGCTCCTGCATGG - Intronic
1060442490 9:123654893-123654915 TGCTCCCTGCAGCTGCTCCTGGG - Intronic
1062153319 9:135032599-135032621 TGCCACCTGCACCTGCTGAAAGG + Intergenic
1062543034 9:137049903-137049925 GGCTGCCTCCAGCTGCTGCAGGG + Exonic
1186029722 X:5354609-5354631 TGCTACATGCATATATTGCATGG + Intergenic
1187508588 X:19897462-19897484 TCCCACATGCTGCTGCTGCTGGG - Intergenic
1187786684 X:22896333-22896355 GGCTACAGGCTGCTGCTGCCAGG - Intergenic
1188724885 X:33570681-33570703 TTGTATATGCAGCTCCTGCAGGG - Intergenic
1189658128 X:43268085-43268107 CGCACCATGCAGCTGCTGCTGGG + Intergenic
1190212556 X:48459844-48459866 TGGGAAAAGCAGCTGCTGCAGGG + Exonic
1190525515 X:51325908-51325930 TGGTACTTACAGCTGCTTCAAGG - Intergenic
1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG + Intergenic
1191650154 X:63528773-63528795 TGCACCATGCAGCTGCTGCTGGG - Intergenic
1192099418 X:68248149-68248171 TGAAACATGCTGCTGCTGCCAGG - Intronic
1192358333 X:70423533-70423555 TCCTACAGGCAGCTCCTGAAGGG + Intronic
1193115931 X:77775214-77775236 TGCTTCATCCAGATGCAGCAAGG - Intronic
1193232729 X:79067021-79067043 TGCACCATGCAGCTGCTGTCAGG + Intergenic
1194389150 X:93294566-93294588 TGTACCATGCAGCTGCTACAGGG - Intergenic
1196607745 X:117674890-117674912 TGCTACAAGCAGGTGCTGCCAGG - Intergenic
1197028439 X:121783458-121783480 TGCTTCATGCTACTGCTGCCAGG + Intergenic
1197069669 X:122280726-122280748 TGCAACATGTTGCTGCTACAGGG - Intergenic
1199324556 X:146482006-146482028 TGCGCCACGCAGCTGCTGCCAGG + Intergenic
1199593957 X:149492407-149492429 TGCTCCAAGCAGGGGCTGCAGGG + Intronic