ID: 956175383

View in Genome Browser
Species Human (GRCh38)
Location 3:66468361-66468383
Sequence ATTCTGTTAATGTTGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956175383_956175386 -1 Left 956175383 3:66468361-66468383 CCATTTTTCAACATTAACAGAAT 0: 1
1: 0
2: 5
3: 52
4: 485
Right 956175386 3:66468383-66468405 TAATTCAAAGTGGAAGGAATTGG 0: 1
1: 0
2: 5
3: 36
4: 373
956175383_956175385 -7 Left 956175383 3:66468361-66468383 CCATTTTTCAACATTAACAGAAT 0: 1
1: 0
2: 5
3: 52
4: 485
Right 956175385 3:66468377-66468399 ACAGAATAATTCAAAGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956175383 Original CRISPR ATTCTGTTAATGTTGAAAAA TGG (reversed) Intronic
902366284 1:15976371-15976393 ATTCTCCTAATTTTAAAAAAGGG + Intergenic
907083786 1:51649878-51649900 TTTTTGTTGTTGTTGAAAAAAGG + Intronic
908586181 1:65572097-65572119 ATTCTATTACTTTAGAAAAAAGG + Intronic
908876101 1:68678242-68678264 ATACTATTCATCTTGAAAAAAGG - Intergenic
909196479 1:72632625-72632647 ATTCTCTAATTGTTGAAATAGGG + Intergenic
909707096 1:78598492-78598514 ATTCTGTAAATGTTGACCCAAGG - Intergenic
910050763 1:82971480-82971502 AATCTTTTAAAGTTGGAAAAAGG + Intergenic
910244475 1:85123893-85123915 ATTCATTTAAGCTTGAAAAATGG + Intronic
910303674 1:85736938-85736960 ATTCTGTGGATGTTTAAGAAAGG + Intronic
910535007 1:88287736-88287758 ATTCTGTTTTTCTAGAAAAAAGG + Intergenic
910561313 1:88595034-88595056 ATTCTTCTAATGGGGAAAAATGG + Intergenic
910697749 1:90039222-90039244 ATTTTGTTAATTTTGACCAAAGG - Intergenic
911064553 1:93776423-93776445 ATTGTGGTAATGTTTACAAAGGG - Intronic
911180730 1:94858115-94858137 ATTCTTTTAATATTAAAAAAAGG + Intronic
911994104 1:104741031-104741053 ATTCTGTTAAATTTAAACAATGG - Intergenic
912190299 1:107330828-107330850 ATTCTGTAAATGTTCTATAATGG - Intronic
912479362 1:109968372-109968394 ATTTTGTGAATATTGATAAACGG + Intergenic
913308665 1:117461951-117461973 ATACTGTCAATGTTGATAACTGG - Intronic
913551117 1:119917693-119917715 ACTCTTTTGTTGTTGAAAAATGG - Exonic
914170810 1:145221807-145221829 ATTGTGTTTCTGGTGAAAAAGGG + Intergenic
914525925 1:148465766-148465788 ATTGTGTTTCTGGTGAAAAAGGG + Intergenic
914640477 1:149601350-149601372 ATTGTGTTTCTGGTGAAAAAGGG - Intergenic
916262733 1:162858739-162858761 ATTATTTTAATGATGAACAAAGG + Intronic
916339184 1:163709870-163709892 ATTTTGTTATTGTGGAAAACTGG + Intergenic
916395076 1:164377795-164377817 ATACTGTGAATATTGAAAAAGGG - Intergenic
917032252 1:170706434-170706456 TTACTGTTGCTGTTGAAAAAGGG - Intronic
917178860 1:172270134-172270156 ATTCAGTTAGAGTTGAATAATGG + Intronic
917251609 1:173068751-173068773 ATTATGTCAATGATTAAAAATGG - Intergenic
917303046 1:173598894-173598916 ATTCCTTTATTTTTGAAAAATGG - Intronic
917875524 1:179283288-179283310 ATTCTGTTACTAAAGAAAAAGGG + Intergenic
918495330 1:185129161-185129183 AATCAGTTAATTTTGAAATATGG - Intronic
919113480 1:193249974-193249996 ATCAAGTTAATGTTGAAAGAAGG - Intronic
919526038 1:198652080-198652102 ATTTTGCTTAAGTTGAAAAAAGG + Intronic
920642256 1:207763758-207763780 ATTCTTTTAAGGTTCAAATAAGG + Intronic
921066838 1:211629314-211629336 ATTCTCTGAATGGTGAAAAAGGG + Intergenic
922295766 1:224248641-224248663 ATGCTGCAAATGTTGAAAAGTGG + Intronic
924072093 1:240291220-240291242 AATCTTTTAATGTGCAAAAAAGG + Intronic
1062888927 10:1041744-1041766 TTTTTTTTAATGTTAAAAAAAGG + Intronic
1063041614 10:2344995-2345017 ATTCTAATAATGTTGGATAAAGG - Intergenic
1063560079 10:7118022-7118044 ATTGTGTTGACGCTGAAAAACGG - Intergenic
1063688233 10:8258730-8258752 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
1064231549 10:13533285-13533307 ATTGTCCTAATGTTGAAAAGTGG - Intergenic
1064402666 10:15034440-15034462 GTTCTAATAATGTTCAAAAAGGG - Intronic
1064555832 10:16546277-16546299 ATTCTGTTGAGTTTGAAAGAAGG - Intergenic
1064634730 10:17352854-17352876 AGTATATTAATGCTGAAAAATGG + Intronic
1065213490 10:23427124-23427146 AGTCTGGCCATGTTGAAAAATGG - Intergenic
1065609359 10:27456413-27456435 ATTCTGTTGATTTTGAGTAAGGG + Intergenic
1067260856 10:44690162-44690184 ATTTTGTTGTTGTTGAAAATTGG + Intergenic
1067329892 10:45305239-45305261 ATTGTTTTAATTTTAAAAAAAGG + Intronic
1067664035 10:48257983-48258005 ATTTTGCTAAGGTTGAAAATGGG - Intronic
1068325041 10:55474111-55474133 ATTTTGTTAATGTAGAAAATTGG - Intronic
1068347706 10:55804372-55804394 ACACTGTTACTCTTGAAAAAAGG + Intergenic
1068371274 10:56119171-56119193 ACTATGTTAATCTTGTAAAAAGG - Intergenic
1068822879 10:61398308-61398330 ATTCTGATTATGCTGAGAAATGG + Intergenic
1069505127 10:68990533-68990555 ATTTTGTTGTTGTTGAGAAAAGG - Intronic
1071058073 10:81534335-81534357 TTTCTGATAGTGTTGAAAAATGG + Intergenic
1071227615 10:83548780-83548802 ATTCACATAATGTTGAAAATAGG - Intergenic
1071356003 10:84796717-84796739 ATTCTGCTAATATTGGATAAAGG + Intergenic
1072761138 10:98057854-98057876 ATTCTGTTCATGATGAAATGAGG - Intergenic
1073222034 10:101882834-101882856 ATTCTTAAAATGTTGTAAAAGGG + Intronic
1073581582 10:104671755-104671777 ATTCTGTTAATGTGGTATACTGG + Intronic
1074715738 10:116217032-116217054 TTTCTTTTTATGTTGAAAAGTGG + Intronic
1074786355 10:116845286-116845308 ATTTTGTTATTGTTGTTAAAAGG + Intergenic
1074810738 10:117102760-117102782 ATTCTCTCAGTGATGAAAAAGGG + Intronic
1076392386 10:130112450-130112472 ATTTTTTGAATGTTTAAAAAAGG + Intergenic
1079530806 11:21450787-21450809 ATTATATTAATGTTAAGAAAGGG - Intronic
1079775179 11:24516149-24516171 AATCTGTTAATCTTCAAAACAGG - Intronic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1080096101 11:28408897-28408919 TTTGTGTTATTGTTGAAAGAGGG - Intergenic
1080162071 11:29188969-29188991 ATTCTTTTAGTGTTGAAGAATGG + Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1081413485 11:42786585-42786607 ATTATATTAATGTTGAACCAAGG - Intergenic
1081951700 11:47049663-47049685 ATTATGTTAATGTTTTAAGATGG + Intronic
1082760246 11:57120393-57120415 ATGCTGTGAATTTTGAATAAAGG - Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1086606011 11:88697012-88697034 AATCTGGAAATATTGAAAAAAGG - Intronic
1087720207 11:101655697-101655719 ATTCTGTTAATCCTAAATAAAGG - Intronic
1087805389 11:102549727-102549749 ATTATATTAATGTTGAAAAAAGG + Intergenic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1087898029 11:103609465-103609487 GTTCTGTAAGTGTTGGAAAAAGG + Intergenic
1088024237 11:105158285-105158307 GTTCTGTTACTGTAGAAAAACGG + Intergenic
1088480660 11:110293897-110293919 ATGCTACTAATGTTTAAAAACGG - Intronic
1088683529 11:112265684-112265706 ATTGTGTTAAGGTTTAAAAGAGG + Intronic
1088737765 11:112742298-112742320 TTTCTGTTAATGATAAGAAATGG - Intergenic
1088785706 11:113179956-113179978 ATTTTGTTAATGTAGAAACTGGG + Intronic
1092178048 12:6424403-6424425 ATTTTTTTAATTTTTAAAAAGGG + Intergenic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1092604475 12:10103229-10103251 ATTCTGTTAATATGATAAAATGG + Intronic
1092837819 12:12507963-12507985 ATTGTGTTTATGTTACAAAAAGG - Intronic
1092850958 12:12626097-12626119 ATTCTGTTTGTCCTGAAAAATGG + Intronic
1093557320 12:20491597-20491619 ACTCTGTTTATCTTTAAAAATGG - Intronic
1093644074 12:21563105-21563127 ATTCTGTTAATGTACAAAGGGGG + Intronic
1094104003 12:26789437-26789459 ATTCTCATAATGGTGAAAAACGG - Intronic
1094334814 12:29337605-29337627 ATTTTGATTGTGTTGAAAAAGGG + Exonic
1095245838 12:39920214-39920236 ATTCTGTAAGTATAGAAAAAAGG - Intronic
1095338393 12:41058595-41058617 ATTCTTTTTAAGTTAAAAAAAGG - Intronic
1099149663 12:79094635-79094657 TTTCTATTAATATTGATAAAGGG - Intronic
1100197290 12:92261350-92261372 ATTCTGTTATTGTTGTTAAATGG + Intergenic
1100756244 12:97753775-97753797 ACTCTGTTAATGGTGAATCAGGG - Intergenic
1100818927 12:98412940-98412962 ATTCCAATAATGATGAAAAAAGG - Intergenic
1104257203 12:127149925-127149947 AATATGTTAATGTGGAGAAAGGG - Intergenic
1104570718 12:129922934-129922956 AGGGTGTTAATGTTGTAAAAGGG + Intergenic
1106977600 13:35239404-35239426 ATTCTGAAAAATTTGAAAAATGG + Intronic
1107435202 13:40375647-40375669 ATAGTATTAATGTTGAAAATGGG + Intergenic
1107839291 13:44439047-44439069 TTTCTGTTTATGTTGAAGAACGG - Intronic
1107850168 13:44563230-44563252 ATTCTTCTCATTTTGAAAAAGGG - Intronic
1108300714 13:49072185-49072207 ATTTTGTATATGTTGAAATATGG + Intronic
1108966967 13:56320082-56320104 ATAATGTTAAAGTTGATAAAGGG - Intergenic
1110674795 13:78228811-78228833 ATTCTGTGAATCTTGGCAAATGG + Intergenic
1111850300 13:93565031-93565053 ATTTTGACAATGTTGAAAAAGGG - Intronic
1112167918 13:96939520-96939542 ATTCTGTTTAAGTTGAAAGTAGG + Intergenic
1112335899 13:98515711-98515733 ATTCTTTTAGTCTAGAAAAAAGG - Intronic
1112888328 13:104201327-104201349 AAACTGTTAATGTTCAAATAGGG + Intergenic
1113050689 13:106208339-106208361 AATCTGTGAATGTTTGAAAAGGG - Intergenic
1113165755 13:107439913-107439935 ATTCTTTAACTGTTGGAAAAAGG + Intronic
1113192022 13:107759622-107759644 ATTCTGTGAATGTTGAAGACTGG - Intronic
1114367659 14:22047093-22047115 CCACTGTTAATATTGAAAAATGG + Intergenic
1115666024 14:35548439-35548461 AGCCTGCTAATTTTGAAAAAAGG + Intronic
1115966124 14:38890388-38890410 ATTCTGTTAAGAGTGAGAAATGG - Intergenic
1115988287 14:39125718-39125740 ATTCTATTAAGATTGAAATATGG + Intronic
1116344894 14:43780357-43780379 ACTCTGTTAAGGGTGAAAATGGG + Intergenic
1116848663 14:49887824-49887846 ATTCAGTTAATGTGGAAAGTCGG + Intergenic
1117688354 14:58279039-58279061 ATTCTGATAATTTAGAGAAAAGG + Intronic
1117932864 14:60863636-60863658 ATTTTTTTAATTTTAAAAAATGG + Intronic
1117933286 14:60871112-60871134 ATTGTGTGAATGTTTAATAAAGG + Intronic
1118100330 14:62592662-62592684 ATTTTATGAATGTGGAAAAATGG + Intergenic
1118285949 14:64472863-64472885 ATTATTTTAATGTTGTTAAATGG - Exonic
1118924571 14:70180269-70180291 ATTTTTTAAATGTTGAAATATGG + Intronic
1118967296 14:70599916-70599938 ATCCAGTTAATATTAAAAAAAGG + Intronic
1119078218 14:71666048-71666070 ATTCTGTAGTTGTTGAAAAATGG - Intronic
1119987842 14:79159725-79159747 ATTCTGCTAAAATTGAAACAAGG - Intronic
1123498170 15:20851760-20851782 ATTCTGCTTATGGTGTAAAATGG - Intronic
1123555401 15:21425388-21425410 ATTCTGCTTATGGTGTAAAATGG - Intronic
1123591644 15:21862719-21862741 ATTCTGCTTATGGTGTAAAATGG - Intergenic
1125078852 15:35653135-35653157 TTTCTTTTAATGTAAAAAAAAGG - Intergenic
1125186255 15:36933971-36933993 ATTTTATTAATGTTGAAAAGAGG - Intronic
1126244612 15:46489827-46489849 ATTCTGGTAATATTACAAAATGG - Intergenic
1126840327 15:52711372-52711394 ATTCTTTGAACGTTGAAAAGAGG - Intergenic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1127117293 15:55741877-55741899 TTTCTGTTAGGCTTGAAAAAAGG - Intronic
1127212233 15:56785020-56785042 ATTCTGTTAAAATGGAAGAAGGG + Intronic
1127452384 15:59129842-59129864 ATTCTTTGAATGTTGAATATTGG + Intergenic
1128230088 15:66028427-66028449 TTACTGATAATGTTGAAAATAGG + Intronic
1128697343 15:69778075-69778097 ATTTTGTCATTGTTGAAAATTGG + Intergenic
1129635084 15:77307372-77307394 ATTCTGGTAATGTTTTCAAAAGG - Intronic
1130089808 15:80811211-80811233 AATCTGGAAATGGTGAAAAAAGG + Intronic
1130745574 15:86650172-86650194 ATTCTGTTACTAATGAAGAATGG - Intronic
1131590569 15:93743572-93743594 TTTCTCTTAATTTTGAAAAGTGG - Intergenic
1131853154 15:96564252-96564274 ACTCCGTTATTGTTGGAAAATGG - Intergenic
1202963745 15_KI270727v1_random:152598-152620 ATTCTGCTTATGGTGTAAAATGG - Intergenic
1132919475 16:2378057-2378079 ATTTTGTTGATGTGGACAAATGG + Intergenic
1132922395 16:2404647-2404669 GTTCTTTTAATGTTGAAAAAAGG + Intergenic
1133945350 16:10343388-10343410 AGCCTGTTACTGTTGATAAACGG + Intronic
1135560964 16:23476493-23476515 ATTATGTAAATGTCCAAAAAAGG + Intronic
1135648856 16:24187884-24187906 CTTCTGTTTATTTTAAAAAATGG + Intronic
1137473465 16:48784454-48784476 ATTCATTCAATGTTGACAAAGGG + Intergenic
1137641375 16:50033427-50033449 ATACAGCTAATGGTGAAAAATGG - Exonic
1137796409 16:51223952-51223974 AGTCTGTTAAGGTTGAAGAGGGG - Intergenic
1138174663 16:54885836-54885858 ATTTTGTAAAAGTTAAAAAAAGG + Intergenic
1139101725 16:63775365-63775387 ATTAGCATAATGTTGAAAAATGG + Intergenic
1140190418 16:72811185-72811207 ACTCTGTTTTTGTTGTAAAAGGG - Intronic
1140387098 16:74550828-74550850 ATTTTGATAATGCTGAACAAGGG + Intronic
1140611032 16:76599211-76599233 ATTTTGTGGATATTGAAAAAAGG + Intronic
1141292404 16:82731872-82731894 ATTCTGGTAATGTTAATAATTGG - Intronic
1141764380 16:86048946-86048968 ACTCTGTTAGTGTGGAGAAAGGG - Intergenic
1142020522 16:87779385-87779407 CTTCTGTTGACGTTGACAAAGGG - Intergenic
1142798435 17:2327942-2327964 ATTCTTTTATTGTTTCAAAATGG - Intronic
1143356974 17:6337604-6337626 ATTCTGGTCATCTTGAGAAATGG + Intergenic
1143696103 17:8620119-8620141 ATTCTGTTACTGTTGGATATAGG - Intronic
1143972925 17:10808641-10808663 ATTTTGTTAATTTTTAAAAATGG + Intergenic
1144120499 17:12148002-12148024 TTTCTGTTAAATGTGAAAAAAGG + Intergenic
1144318267 17:14085222-14085244 ATTCAGTAAATGTTCAAGAAAGG + Intronic
1144401969 17:14913522-14913544 AATTTGTTTTTGTTGAAAAATGG - Intergenic
1147775694 17:42899351-42899373 TTTCAGTTATTTTTGAAAAAGGG - Intergenic
1148009874 17:44469597-44469619 ATTTTGTCACTGTTGAAAATGGG - Intronic
1149152977 17:53592109-53592131 AGTCTATTAATTTTTAAAAAGGG - Intergenic
1149200938 17:54185271-54185293 TTTCTCTTAATGGTGATAAAAGG + Intergenic
1149414213 17:56441818-56441840 AATGTTTTAATGTTGAAAATGGG - Intronic
1149617308 17:58012164-58012186 ATTCTGTTAAAATTGAAGCAAGG + Intergenic
1150535034 17:66029394-66029416 ATTCTGCTTATGTTAAAAACAGG + Intronic
1152402472 17:80075826-80075848 CTTCTGTTAATGTTGATATTAGG - Intronic
1152853858 17:82652662-82652684 ATTCTCTTACTTTGGAAAAAGGG + Intergenic
1153133720 18:1888099-1888121 ATTTTGTTGATGTTGAAAGCTGG - Intergenic
1153657841 18:7301208-7301230 ATTTTGTTGTTGTTGAAAACTGG + Intergenic
1153673340 18:7433587-7433609 ATACTTTTAAATTTGAAAAATGG + Intergenic
1154257893 18:12800453-12800475 ATTCTATTTAAGATGAAAAAAGG + Intronic
1154456172 18:14528184-14528206 ATTCTGCTTATGGTGTAAAATGG - Intronic
1156074759 18:33260963-33260985 CTATTGTTAATTTTGAAAAATGG + Intronic
1156810717 18:41246893-41246915 TTTTTTTTAATGGTGAAAAATGG + Intergenic
1156889783 18:42177588-42177610 ATTATGTTAATATTGCAAATGGG - Intergenic
1157012977 18:43674164-43674186 ATTTTATTAATTTTTAAAAATGG - Intergenic
1157185385 18:45536193-45536215 AATCTGTTAATGCTGAGAGATGG + Intronic
1157642691 18:49233675-49233697 AATCTGTTAGTGTAGAAGAAAGG - Intronic
1157768021 18:50317177-50317199 ATTCTGGTAGTTTTAAAAAATGG - Intergenic
1157968762 18:52241279-52241301 ATTCTGTTAATGAAGAAGAAGGG - Intergenic
1158922296 18:62206660-62206682 ATCCAGCTAATGTTTAAAAAGGG - Intronic
1159340739 18:67129317-67129339 ATTCTGTTAATTGTGAGTAAAGG + Intergenic
1159395428 18:67849280-67849302 ATTCTCATCATGTTCAAAAAAGG + Intergenic
1159906223 18:74095067-74095089 ATTCTGTGAATGCTGATAAAAGG - Intronic
1161150646 19:2706646-2706668 ATACTGCTAAATTTGAAAAAGGG - Intergenic
1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG + Intronic
1162593612 19:11610017-11610039 ATTTTGTTTTTGTTGAAAAGTGG + Intronic
1164054364 19:21609447-21609469 ATTTTGTTTAAGTTAAAAAATGG + Intergenic
1164184488 19:22850880-22850902 AATGTGATCATGTTGAAAAATGG + Intergenic
1167024861 19:46908033-46908055 TTTCTGTCAATGGGGAAAAATGG - Intergenic
1167960375 19:53100199-53100221 TTTCTGTAAATGTGGAAAGATGG - Intronic
1168535666 19:57167305-57167327 ATACAGTTAAAGTTTAAAAATGG + Intronic
925141458 2:1552597-1552619 ATCATGTTGATGTTGAAAAGGGG - Intergenic
925591729 2:5516657-5516679 ATTCTGTTCATGTTAAATAATGG + Intergenic
926256248 2:11203098-11203120 ATTATGTTAATCTTCAATAAAGG + Intronic
926782482 2:16486474-16486496 ATTTTGTTTGTGTTGTAAAAGGG - Intergenic
927027251 2:19081672-19081694 ATTCTGTAAGTATTGAAAAAAGG + Intergenic
928155955 2:28876999-28877021 ATTCTATTATTATTGAAGAAGGG + Intergenic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
929139727 2:38656301-38656323 ATTCTGTTAATGTAGCAAAAAGG - Intergenic
929679964 2:43983295-43983317 ATTGTGTTTATTTTAAAAAAAGG - Intronic
930308552 2:49708455-49708477 ATTATGGTAATATAGAAAAATGG - Intergenic
930343884 2:50153394-50153416 ATTTTTTTTTTGTTGAAAAATGG + Intronic
930345389 2:50173794-50173816 ATTAAATTAATGTTAAAAAAAGG + Intronic
930362740 2:50402348-50402370 ATTTTTTTGATGTTAAAAAAGGG - Intronic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930974496 2:57440946-57440968 ATTCAGTGAATATTAAAAAAAGG + Intergenic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
931523606 2:63127801-63127823 ATTCTTTTAATGTGGAATTATGG - Intronic
931826183 2:66003480-66003502 ATTCTGCAAATGTAGAAACATGG - Intergenic
932910564 2:75801892-75801914 ATTCTCCAAATGTTGAAAAAAGG + Intergenic
933028946 2:77301006-77301028 ATCCTGTTAATTTAAAAAAAAGG - Intronic
933374591 2:81463219-81463241 ATTCTATTAATCTTGAATAAAGG + Intergenic
933467242 2:82668917-82668939 ACTATGTTACTGTAGAAAAATGG - Intergenic
933874492 2:86605088-86605110 TTTTTGTTAATGTAGAAAATTGG - Exonic
935138024 2:100324566-100324588 GTTCTTTTTATGGTGAAAAAGGG - Intergenic
935892382 2:107692900-107692922 ATTCTGTAAATATGGACAAAGGG - Intergenic
936676952 2:114726715-114726737 ATTCAGTTGATGTTAAAACATGG - Intronic
937836546 2:126476561-126476583 ATAATGTTAATGATAAAAAATGG + Intergenic
938283879 2:130091142-130091164 ATTCTGGTTATGGTGTAAAATGG - Intronic
938285033 2:130105708-130105730 ATTCTGGTTATGGTGTAAAACGG - Intronic
938335676 2:130494257-130494279 ATTCTGGTTATGGTGTAAAACGG - Intronic
938354145 2:130626407-130626429 ATTCTGGTTATGGTGTAAAACGG + Intronic
938430572 2:131233184-131233206 ATTCTGGTTATGGTGTAAAACGG + Intronic
938431728 2:131247751-131247773 ATTCTGGTTATGGTGTAAAATGG + Intronic
938475396 2:131606354-131606376 ATTCTGGTTATGGTGTAAAATGG + Intergenic
939020334 2:136950850-136950872 ATTCTCTTGATGTGGAAGAAAGG + Intronic
939515283 2:143159177-143159199 TGTATGTTAATGTTTAAAAATGG - Intronic
940699698 2:157025123-157025145 ATTTGGTTGATGTTGAAGAAAGG + Intergenic
941028885 2:160489915-160489937 ATTCTGTTTCTTTTGAAGAAAGG - Intronic
941505532 2:166339366-166339388 ATTATGTTGCTGTTGATAAAAGG - Intronic
943311971 2:186336800-186336822 AATCTGTTAATTCTGAAAATAGG - Intergenic
943693787 2:190899319-190899341 ATTTTTTTAATGTTGTAATAGGG + Intronic
943696079 2:190933164-190933186 TTTCTGTTACTATTGTAAAATGG - Intronic
943795882 2:191993219-191993241 CTTCCTTTAATGTGGAAAAACGG + Intronic
943805691 2:192122265-192122287 ATTTTCTTAATGCTAAAAAAAGG + Intronic
943825687 2:192388485-192388507 AGTTTGTTACTGTTCAAAAAAGG - Intergenic
944954546 2:204793324-204793346 AATCTGTTAATTTTCAAGAAAGG - Intronic
945316142 2:208372734-208372756 ATTCTATTAATGATGAAATTAGG + Intronic
945489198 2:210434864-210434886 ATGTTGTTAATGTTAAAAAATGG - Intronic
945544614 2:211136107-211136129 CTTGGGTTAATGTAGAAAAAAGG + Intergenic
947129953 2:226911444-226911466 ATTCTATTAGTGTTGCAGAATGG + Intronic
947760644 2:232601300-232601322 ATTCTGTGAGTTTTGAGAAATGG - Intergenic
948194063 2:236082042-236082064 GTTGTTTTAATGTTGGAAAAAGG + Intronic
948234221 2:236375432-236375454 ATTCTGTTAATATTTTAAAATGG - Intronic
948430493 2:237915537-237915559 ATTATGTTAATGAGGTAAAATGG + Intergenic
1169515316 20:6310611-6310633 ATTCTATTTATGTTGATATAGGG + Intergenic
1169760609 20:9088410-9088432 ATTCTTCTAATGATGAGAAAAGG - Intronic
1172019086 20:31900126-31900148 ATTCTTTTACTGTAGAGAAAGGG + Intronic
1173064429 20:39696885-39696907 ATTGTGATTATGTTTAAAAAAGG + Intergenic
1173068103 20:39733978-39734000 ATTCTATCAATTTTGAAAACAGG - Intergenic
1173097443 20:40049495-40049517 ATTCTGATTATTTTAAAAAATGG - Intergenic
1173612842 20:44383273-44383295 TTTGTGTTAATGTATAAAAAGGG - Intronic
1173708900 20:45137274-45137296 GTTCAGGAAATGTTGAAAAAAGG + Intergenic
1174714334 20:52741057-52741079 ATTCTTTTATTCTTGCAAAATGG + Intergenic
1175035548 20:55996976-55996998 TGTCTTTTAGTGTTGAAAAAAGG + Intergenic
1176817993 21:13625152-13625174 ATTCTGCTTATGGTGTAAAATGG + Intronic
1176945187 21:14971514-14971536 ATTATGTTCATTTTTAAAAAGGG + Intronic
1178073439 21:28993762-28993784 ATTCTGTGATTGTTGGAAAAAGG - Intergenic
1178378504 21:32089068-32089090 ATGCTGTTGATGCAGAAAAATGG + Intergenic
1179047221 21:37856739-37856761 CTTTTTTTAATTTTGAAAAATGG - Intronic
1179242361 21:39603539-39603561 ATACTGTTAATGATAAAAAGGGG + Intronic
1180577635 22:16794413-16794435 TTTTTTTTAATGTTGAAAATAGG - Intronic
1183943570 22:41310740-41310762 CTTCTGTTACTGTTTTAAAAAGG + Intronic
1184542329 22:45134789-45134811 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
949119062 3:363498-363520 ATTCTAGGAATTTTGAAAAACGG - Intronic
951079460 3:18435168-18435190 ATTCTGTTATTGTTATAATAAGG + Intronic
951101743 3:18696070-18696092 TTTTTGCTAATGTTGAAATAAGG - Intergenic
951288103 3:20840194-20840216 ATTTTGTTAAATTTGAGAAAAGG - Intergenic
951765850 3:26197940-26197962 AATCTGTTAAAGTTGTAACATGG + Intergenic
951782169 3:26376152-26376174 ATTCTGTTAAAATTGAGAGAAGG + Intergenic
952401851 3:32970546-32970568 ACTTTGTTTAGGTTGAAAAATGG + Intergenic
953940829 3:47095093-47095115 ATTCTGTAAGTTTTGAAAATAGG + Intronic
954568967 3:51624637-51624659 TTTCTGTTCATGTTTAAAAACGG - Intronic
955612967 3:60777119-60777141 CTTTTGGTAATGTTGACAAAAGG + Intronic
955901009 3:63754496-63754518 ATTATGTAAATGATGAGAAAAGG + Intergenic
956086146 3:65613042-65613064 AATATGTTAATTTTTAAAAATGG + Intronic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956287228 3:67623565-67623587 ATTCTTTAAATTTTCAAAAAGGG + Intronic
956662092 3:71609002-71609024 ATTCTATTAAAGAAGAAAAATGG - Intergenic
956682819 3:71797411-71797433 ATTATTTTAAAATTGAAAAAGGG + Intergenic
956970634 3:74520127-74520149 ATTATGTTTATGTAGAAAAGTGG + Intronic
957615056 3:82516498-82516520 CTTCTGATAATGATGGAAAAGGG + Intergenic
957618459 3:82564625-82564647 AGTCTGTTAATATTTAAAATAGG - Intergenic
957646461 3:82937037-82937059 ATTGTTTTAATGTTGGAGAAAGG - Intergenic
958575515 3:95945739-95945761 ATTCTTGTAATCTAGAAAAATGG + Intergenic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
958636394 3:96751862-96751884 ATTCTGATGATGCTGAACAAAGG - Intergenic
958724194 3:97883794-97883816 ATTCTGACAACGTTGGAAAAAGG - Intronic
959650652 3:108747387-108747409 ATTCTGTTAACAGTGAGAAAGGG + Intronic
959841422 3:110981293-110981315 ATTCTGTAAATATTCATAAAAGG - Intergenic
960355201 3:116643588-116643610 AGTCTGTTCATGTTGAAAGCAGG + Intronic
960730056 3:120717360-120717382 ATTGTGTTATTGTGGAAGAATGG - Intronic
961358147 3:126351744-126351766 CTTCTGTTAATGGTGGAAAATGG + Intronic
962221689 3:133569698-133569720 CCTCTGTTAATGTGGAAAACTGG + Intergenic
963666409 3:148193302-148193324 ATTATATTAATGATGAAAAAGGG - Intergenic
965167439 3:165213503-165213525 ATTCTCCTAATTTTGAAAATTGG + Intergenic
966022539 3:175233324-175233346 ATTATGTTGATGTTGATAGAAGG + Intronic
967447950 3:189588898-189588920 ATTTTGTAAATGTGGAAACAAGG + Intergenic
968790467 4:2657246-2657268 CTTCTGTCAAGGCTGAAAAAGGG - Intronic
970214274 4:13742866-13742888 ATTCTGTTAATTTGGAATGAAGG + Intergenic
970349487 4:15187270-15187292 ATTCTGTAAAGGTTGGGAAAAGG - Intergenic
970460657 4:16271552-16271574 CTTCTGGTAATGTTGTACAATGG + Intergenic
970936328 4:21574822-21574844 ATACTGGGAATGTTGAAATAAGG - Intronic
971233963 4:24824871-24824893 AAACTGTTCATGTTGAAACATGG + Intronic
971638253 4:29092866-29092888 ATTATGGGAATGTTAAAAAATGG + Intergenic
971977245 4:33706609-33706631 ATCCAGTTAATGAAGAAAAAAGG - Intergenic
972022437 4:34332729-34332751 TATCTGTTAATGTTCAATAATGG - Intergenic
972380038 4:38510926-38510948 ATTCTGTCAATGTTAAAAAATGG - Intergenic
972821527 4:42707345-42707367 ATTCAGTTAATGTTTATTAAAGG + Intergenic
972888601 4:43525569-43525591 ATTCTGTGAATTTTGACATAAGG - Intergenic
972959453 4:44434392-44434414 ATTCTGATAATTTTACAAAAGGG + Intronic
973006278 4:45010535-45010557 ATTCACTTAAAATTGAAAAATGG - Intergenic
973750582 4:54015926-54015948 ACTCTATCAATGGTGAAAAATGG + Intronic
973820805 4:54659800-54659822 ATTCTTTTAATTTTTTAAAAGGG - Intronic
974150024 4:57994922-57994944 ATTGTGTTAATTTTGAAGAGTGG - Intergenic
974330893 4:60477204-60477226 ATCCTATCAATGATGAAAAATGG - Intergenic
974336048 4:60545818-60545840 ATTTTTTTAACTTTGAAAAATGG - Intergenic
974810514 4:66940029-66940051 TTCTTGTTGATGTTGAAAAAAGG - Intergenic
974960136 4:68688499-68688521 TTTCTTTTTATGTTGAAGAATGG + Intergenic
975020971 4:69488179-69488201 ATTTTGTCAATGTAGAAATAAGG + Intronic
976358620 4:84150771-84150793 GTTCTGGTAATGTTGAAGAAAGG + Intergenic
977531296 4:98203352-98203374 ATTATGTTAATGCTAAAAAAAGG + Intergenic
977583950 4:98754655-98754677 ATTTTATTAATTTTGGAAAATGG + Intergenic
977787034 4:101048143-101048165 TTTCTGTTAAAATGGAAAAAGGG + Intronic
978323906 4:107529057-107529079 ATTCTGTTAATCTTCTATAATGG - Intergenic
978480533 4:109185071-109185093 ATATTGTTAAGGTTGAAGAAAGG + Intronic
978645866 4:110930879-110930901 TTTCTGTTTATGTTAACAAAAGG + Intergenic
979008848 4:115340432-115340454 ATTTTGTCATTGTTGAATAAGGG - Intergenic
979022239 4:115517767-115517789 ATTTTTTTAATGTTTTAAAAGGG + Intergenic
979506856 4:121508800-121508822 TTTCTTTTAATTTTCAAAAAGGG - Intergenic
979819588 4:125154158-125154180 ATTCTGTCAATTTTCAAATAAGG - Intergenic
979900619 4:126212329-126212351 ATGCTGTGAATATTGTAAAACGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980768628 4:137341843-137341865 ATTCTAATAATGTAGATAAAGGG - Intergenic
980912040 4:139002534-139002556 ATGCTGTTAAAGTTTGAAAAAGG + Intergenic
981209695 4:142088322-142088344 CTGCTTTTAATGTTGATAAATGG + Intronic
981696960 4:147568561-147568583 ATTCTTTAAATATTGAAAAATGG + Intergenic
981764038 4:148227658-148227680 AATCTATCAATGGTGAAAAAGGG - Intronic
981804360 4:148696883-148696905 GCCCTTTTAATGTTGAAAAATGG + Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
984200555 4:176715221-176715243 ATTCAGTTAATTTTGTCAAAAGG + Intronic
984555124 4:181204405-181204427 ATTCTGTTAATTTTAAAAAATGG + Intergenic
985067774 4:186139997-186140019 ATGCTTTAAATGCTGAAAAAAGG + Intronic
985100671 4:186455262-186455284 ATTGTGAAAATTTTGAAAAATGG + Intronic
986135202 5:4970646-4970668 AATCTCATAATGTTGAAAGAAGG - Intergenic
987820914 5:22965366-22965388 TTTTTGTTTATGCTGAAAAAGGG + Intergenic
987971392 5:24949682-24949704 ACACTGTAAATGATGAAAAAGGG - Intergenic
988471017 5:31538594-31538616 ATTCTGGAAATTTTGAAGAAAGG + Exonic
991035960 5:62127717-62127739 ATACTCTAATTGTTGAAAAAAGG + Intergenic
991414844 5:66381134-66381156 ATTCTGGTAATTTGAAAAAAAGG + Intergenic
991925460 5:71701161-71701183 ATTTTGCTAATGATTAAAAATGG + Intergenic
992048423 5:72921339-72921361 ATTTTGTTATTGTTGTTAAAAGG - Intergenic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
993191869 5:84693941-84693963 ATTTGAGTAATGTTGAAAAAAGG + Intergenic
993827716 5:92712800-92712822 AATCTGTTATTTTTGAGAAAGGG - Intergenic
994121118 5:96114048-96114070 ATACACTTATTGTTGAAAAATGG - Intergenic
995008987 5:107236859-107236881 ATTCAATCAATGTTGACAAATGG + Intergenic
995989395 5:118218299-118218321 ATTGTGGTAGTGGTGAAAAATGG + Intergenic
996009083 5:118460648-118460670 ATGCTGTTAAATTTAAAAAATGG - Intergenic
996517265 5:124384930-124384952 TTTTTGTAAATTTTGAAAAATGG - Intergenic
996858466 5:128037851-128037873 CCTCTGTTAAAGGTGAAAAATGG - Intergenic
997374284 5:133385641-133385663 TTTTTGCTAATTTTGAAAAAGGG + Intronic
997674851 5:135705294-135705316 ATGCTGTCACTGTTGATAAATGG + Intergenic
998046726 5:138993021-138993043 ATTCTGCTACTGTGGAAGAATGG - Intronic
998724747 5:144997745-144997767 ACTCTGTTATTGTAGAACAAAGG + Intergenic
998770182 5:145534598-145534620 ATTTTGTGAATGAGGAAAAAGGG - Intronic
999033100 5:148316485-148316507 ATTCTGTTAATTGGCAAAAAGGG - Intergenic
999356014 5:150931765-150931787 ATTATGTGAATGTTGAAACTGGG - Intergenic
1000447509 5:161341680-161341702 ATTGTGTAAATGTTTTAAAATGG - Intronic
1001976568 5:176005043-176005065 ATTCTGCTAAATTTGAAACAGGG - Intronic
1002240859 5:177838729-177838751 ATTCTGCTAAATTTGAAACAGGG + Intergenic
1004339943 6:14799200-14799222 GTTCTTGTAATGTTAAAAAAGGG - Intergenic
1004494355 6:16149753-16149775 ATTCTTTTCATGTTGACAGATGG - Intergenic
1006348281 6:33501326-33501348 ATTTTGTTTATGTACAAAAAAGG + Intergenic
1006548829 6:34803258-34803280 AGTCTGTTAGGGTTGAAAACTGG + Intronic
1007591462 6:43023390-43023412 ATTTTATTTATTTTGAAAAAAGG - Intronic
1008047075 6:46862311-46862333 CTTCTGTCAATGTAAAAAAATGG - Intronic
1008901268 6:56619591-56619613 AATCTCTTAATCATGAAAAAGGG - Intronic
1009347751 6:62637633-62637655 ATTCTCTTAATGTAGGACAAAGG - Intergenic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1009834869 6:68986850-68986872 ATTGTGTGAATATTAAAAAAAGG - Intronic
1009853077 6:69223136-69223158 ATTCTTATAATTTTGAAAATGGG - Intronic
1009939776 6:70277789-70277811 TTTTTGATAATGTTAAAAAATGG - Intronic
1010145308 6:72661827-72661849 ATGCTGTAAATGCAGAAAAATGG - Intronic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010890325 6:81300195-81300217 ATTCTGTCAATGTTGCAATCTGG + Intergenic
1010897933 6:81389016-81389038 ATTTTGTTAATGTATAAAATGGG + Intergenic
1011465969 6:87657560-87657582 ATTCTGTTAGTATGGCAAAAAGG + Intronic
1011915115 6:92494533-92494555 AGTCTGTTACTGTTAAAGAAGGG - Intergenic
1012411103 6:98958066-98958088 ATACTGTTATTGTCAAAAAATGG - Intergenic
1012710182 6:102589948-102589970 ATGTTGTTAATGTTCAGAAAGGG + Intergenic
1012974101 6:105761036-105761058 ATTGATTAAATGTTGAAAAATGG + Intergenic
1013682278 6:112537895-112537917 ATTCTGTTAATTTTTACAGATGG - Intergenic
1013949800 6:115766092-115766114 AATCTGTTGATGCTGAGAAAGGG - Intergenic
1014872431 6:126613329-126613351 ATTCTTTGAATGTTGAATATTGG + Intergenic
1014925497 6:127266298-127266320 ATTCTGTTTTTTTTAAAAAAAGG + Intergenic
1015170426 6:130246553-130246575 ATTATGTTGATGCTGGAAAACGG + Intronic
1015417297 6:132963841-132963863 ATTCTGTTAGTTTTGACAAGAGG - Intergenic
1016089478 6:139959002-139959024 AATCTTTTCATGTTGGAAAAAGG - Intergenic
1016169388 6:140990823-140990845 ATTTTGTTAATGTAGACTAATGG - Intergenic
1016188210 6:141224157-141224179 ATACTTTTAATTCTGAAAAAAGG - Intergenic
1016768050 6:147817113-147817135 AGTCTGATGATGATGAAAAAAGG - Intergenic
1017246163 6:152227903-152227925 ATTCTGTTTCTGATCAAAAAGGG + Intronic
1018161304 6:161045443-161045465 ATTATGTTTATGTGGAAAAATGG + Intronic
1018945247 6:168343434-168343456 AGTATGTTAAGGTTGAAAAGGGG - Intergenic
1019036655 6:169065940-169065962 ATTCCTTTACTGTTTAAAAAGGG + Intergenic
1020398108 7:7740981-7741003 CTTCTGTTAATGTTGAAATTAGG + Intronic
1020604090 7:10313727-10313749 ATTCTCTTTATTTTGTAAAATGG - Intergenic
1020846500 7:13291173-13291195 ACTCTGCTAGTGATGAAAAATGG + Intergenic
1022625288 7:32029730-32029752 ATTGTGTAAATGTTGTAAAAGGG + Intronic
1022705351 7:32796865-32796887 ATGCAGTTAATTTTGAAAAACGG - Intergenic
1023145853 7:37150319-37150341 AGTCTGTTAATCTTTAAAATAGG - Intronic
1023246623 7:38211778-38211800 ATTTTCTTACTGATGAAAAAGGG - Intronic
1023479992 7:40623950-40623972 TTTCTGTTAATGTTAATTAAGGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1025090790 7:56062346-56062368 TTTCTATTAATGTTGACAATAGG - Intronic
1025748352 7:64267514-64267536 ATTTTCTTAATGTAGAATAAGGG - Intergenic
1027661665 7:80995395-80995417 AATGTGTTAATGTGGAAAGAAGG - Intergenic
1028170815 7:87593329-87593351 TTTCTGTAAATGTTGAAACAAGG + Intronic
1028393661 7:90343952-90343974 ATTTTTTTAGTTTTGAAAAATGG + Intronic
1028777007 7:94688614-94688636 ATTTTCCTAATCTTGAAAAATGG + Intergenic
1028777755 7:94699225-94699247 ATTCTGTAAATCTGGCAAAAGGG + Intergenic
1028823354 7:95239368-95239390 ATTATGTTTATGTTAAAAATAGG - Intronic
1029001831 7:97162462-97162484 ATTCTTTTAATTTTGATAATAGG + Intronic
1029920257 7:104254873-104254895 ATTATTTTAATGTTGAAAGGTGG + Intergenic
1030038455 7:105428428-105428450 ATTTTTTTAATCTTTAAAAAAGG + Intergenic
1030161662 7:106515724-106515746 ATTCTGATATTGTTGATTAAGGG - Intergenic
1030970152 7:116046141-116046163 TTTGGGTTAATGTTGAAATAAGG + Intronic
1031953279 7:127914435-127914457 ATTATGTAAATGTTGAAGAAGGG - Intronic
1032933553 7:136702317-136702339 ATTTTATTAATGATGAATAAAGG - Intergenic
1033906669 7:146213490-146213512 ATTCTGTTAAAGTAGTTAAAAGG - Intronic
1034592697 7:152156090-152156112 ATTCAGTCAATATTGATAAATGG + Intronic
1035400351 7:158561020-158561042 ATTCTGTTAGTGTGGCAAGAAGG + Intronic
1036720297 8:11168127-11168149 ATTTTGTTGCTGTTGAAAATGGG - Intronic
1037029562 8:14087247-14087269 ATTTTGGAAATGTTGAACAAGGG + Intergenic
1037541607 8:19877386-19877408 ATGCAGTCAATATTGAAAAAAGG - Intergenic
1038265468 8:26036350-26036372 AATATGTTACTGTTGGAAAATGG - Intronic
1038411135 8:27360705-27360727 ATTCTGTGAACTTTCAAAAAAGG + Intronic
1039536842 8:38324076-38324098 ATTCTTTTAATATTCAAAGAAGG + Intronic
1039784086 8:40817209-40817231 ATTCTTTTAATAATGTAAAAAGG - Intronic
1039866177 8:41504525-41504547 ATTCTTTGAATGCTGAAAATAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040851701 8:51907557-51907579 ATTCTGTTCTTCTTGGAAAATGG - Intergenic
1041159380 8:55022800-55022822 ATGGTATTAATGGTGAAAAATGG + Intergenic
1042144289 8:65712075-65712097 ATTCTGTTAATGTTGCCTAATGG + Intronic
1042187346 8:66150296-66150318 TTTCTGTCACTGTTGAAAATTGG - Intronic
1042856173 8:73270367-73270389 ATTCTGTTAATTTTCAAGTAAGG - Intergenic
1042886382 8:73556760-73556782 TTTCTGTTACTGTTGATAACTGG - Intronic
1042928047 8:73987021-73987043 ATTCATTCGATGTTGAAAAATGG + Intergenic
1043219248 8:77637776-77637798 ATTGAGTTAATGATGAAATAAGG + Intergenic
1043543532 8:81289783-81289805 GTTCTCTGAATGTTGAAAATTGG + Intergenic
1045242524 8:100415094-100415116 ATTCTGTTAATACTTGAAAATGG + Intergenic
1045566048 8:103316862-103316884 ATTCTGTAAATATAGAGAAATGG + Intronic
1045999259 8:108399562-108399584 ATTGTCTTAATATTGAAAAATGG + Intronic
1046269962 8:111881952-111881974 ATTGTGTTAGTGGTGAACAAAGG - Intergenic
1046905469 8:119567790-119567812 ATTATCTTAATGGTTAAAAAGGG - Intronic
1047320063 8:123770495-123770517 CTTTTGTTAATCTTGAATAAAGG + Intronic
1047385227 8:124403073-124403095 ATTCTGTTAGCCTTGAAAAGTGG + Intergenic
1047456159 8:125014099-125014121 ATTCTGTCAATGATGATAAAAGG + Intronic
1047562055 8:125997594-125997616 CTCCTGTTAATTTTGAAAAGTGG + Intergenic
1047587070 8:126284018-126284040 ATTCAGTAAATGATCAAAAATGG + Intergenic
1048561815 8:135546759-135546781 ATACAGTTAATGTTGAATTAGGG + Intronic
1048644780 8:136408100-136408122 TTTCAGTAAATGTTGAATAAAGG - Intergenic
1050447236 9:5738183-5738205 ATTGTGATAATTTTTAAAAAAGG - Intronic
1050469062 9:5965968-5965990 ATTCAGTAACTGATGAAAAAAGG + Intronic
1050472012 9:6003100-6003122 ATATTGTTACTGTTAAAAAATGG - Intronic
1051312026 9:15785938-15785960 ATCCTGTAAATGTTGAAACTGGG + Intronic
1051520669 9:17983367-17983389 ATTCTTTAAAAGTTGAAAAGGGG - Intergenic
1052180687 9:25523317-25523339 ATTTTGTTAATGTGAAGAAAAGG + Intergenic
1052648066 9:31263638-31263660 ATTCTGTTAATAGGCAAAAATGG + Intergenic
1053569989 9:39294699-39294721 ATTCTGTTTATTATGAAAAATGG - Intergenic
1053835949 9:42135728-42135750 AATCTGTTTATTATGAAAAATGG - Intergenic
1054091618 9:60853702-60853724 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054113033 9:61129276-61129298 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054127160 9:61324311-61324333 ATTCTGTTTATTATGAAAAATGG + Intergenic
1054594683 9:67052916-67052938 ATTCTGTTTATTATGAAAAATGG + Intergenic
1055090513 9:72360896-72360918 ATTCCGTTAATCATTAAAAAGGG + Intronic
1055865008 9:80802672-80802694 ATTTTGATAATATTAAAAAAGGG - Intergenic
1056336606 9:85575134-85575156 ATTCTTTTAATGTTGATATTTGG - Intronic
1057464999 9:95304955-95304977 ATTCTGTTAATTTTCTAATAAGG - Intronic
1057595952 9:96416735-96416757 ATTCTGTAAATGCTCAATAAAGG - Intronic
1057984529 9:99698234-99698256 ATTCTATGAAGGTTGAGAAAGGG + Intergenic
1058577988 9:106423855-106423877 ATTCAGGCAGTGTTGAAAAATGG + Intergenic
1059024966 9:110616592-110616614 ATTCTGGTTATGGGGAAAAAAGG - Intergenic
1060322300 9:122573901-122573923 ATTGAGTTAATGTTTATAAAGGG + Intergenic
1203529366 Un_GL000213v1:124351-124373 ATTCTGCTTATGGTGTAAAATGG - Intergenic
1186707984 X:12162824-12162846 ACTCTGCTTATGTTGCAAAATGG + Intronic
1186840523 X:13480393-13480415 ATTCTGTTATTATAGAAGAAAGG - Intergenic
1187943835 X:24407544-24407566 ATTTTTTTAATGTTGATAAATGG - Intergenic
1188782218 X:34299633-34299655 ACTCTGCTGATGTAGAAAAATGG + Intergenic
1188920180 X:35965041-35965063 ATTTTTTTCATGTTGAAAACTGG + Intronic
1188978757 X:36706859-36706881 AGTCTGTAAAAGTTGAGAAAGGG + Intergenic
1190573553 X:51809812-51809834 TTTCTGTAGAGGTTGAAAAATGG + Intronic
1190635921 X:52433859-52433881 ATTCTTTTATTTTTTAAAAAAGG - Intergenic
1192085493 X:68092381-68092403 ATTCTGCTATTTTTCAAAAAAGG + Intronic
1192592397 X:72371079-72371101 ATTGTGTTTATGTTAAGAAAAGG + Intronic
1193449008 X:81643863-81643885 TTTTTTTTAATGTTGAAAATAGG + Intergenic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1193903299 X:87210531-87210553 ATTTTATAAATGTGGAAAAAAGG + Intergenic
1193992962 X:88331493-88331515 ATTCTGTAAATTTGGGAAAAGGG + Intergenic
1194597620 X:95878265-95878287 ATTATGTTAATTTTAAATAATGG + Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195336992 X:103865122-103865144 ATTTTGTTAATGTTTATAAAAGG + Intergenic
1195450007 X:105000539-105000561 ATTTTATTCATGTTCAAAAATGG + Intronic
1195569383 X:106381722-106381744 CTGCAGTTAATGTTGTAAAAGGG + Intergenic
1196377112 X:115045475-115045497 ATTCTGTTAATTATCAAAACAGG + Intergenic
1197164584 X:123362575-123362597 CTTCTGTTGCTGTTGAAAAAAGG - Intronic
1197183964 X:123565688-123565710 ATTCTCTGTATGTTGCAAAATGG - Intergenic
1197330583 X:125149315-125149337 ATTCTGTTAATGGCGATACAGGG - Intergenic
1197448078 X:126577312-126577334 ATTCTCTAGTTGTTGAAAAAAGG - Intergenic
1197689352 X:129480669-129480691 ATTATATTAATCTTAAAAAATGG + Intronic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1199318788 X:146413657-146413679 AATCTGTTAATATTTTAAAATGG + Intergenic
1199318933 X:146415467-146415489 ATTCTATTAAAGAAGAAAAATGG - Intergenic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1199925478 X:152458510-152458532 ATTCTTTTCATCTTGTAAAATGG - Intergenic
1200241103 X:154494383-154494405 AATCTGTTTATGTAGAAATAGGG - Intergenic
1200860264 Y:7983863-7983885 ATTCACTTAATGTTTCAAAATGG + Intergenic
1200972536 Y:9169307-9169329 ATTTTGTTAACGCTGAAAAAGGG + Intergenic
1200977089 Y:9224388-9224410 ATTTTGTTGGTGTTGAAAAGAGG - Intergenic
1201785873 Y:17778295-17778317 ATTCTGTTAATATAATAAAAAGG + Intergenic
1201798934 Y:17932996-17933018 ATTCTGTTGGTGTCGAAAACAGG - Intergenic
1201802619 Y:17972961-17972983 ATTCTGTTGGTGTCGAAAACAGG + Intergenic
1201815680 Y:18127693-18127715 ATTCTGTTAATATAATAAAAAGG - Intergenic
1202138484 Y:21694944-21694966 ATTTTGTTAACGCTGAAAAAGGG - Intergenic
1202360236 Y:24101608-24101630 ATTCTGTTGGTGTCGAAAACAGG - Intergenic
1202510541 Y:25568507-25568529 ATTCTGTTGGTGTCGAAAACAGG + Intergenic